Skip to main content
Biomedical Reports logoLink to Biomedical Reports
. 2015 Feb 26;3(3):371–374. doi: 10.3892/br.2015.437

mRNA overexpression of BAALC: A novel prognostic factor for pediatric acute lymphoblastic leukemia

ZAHRA AZIZI 1, SOHEILA RAHGOZAR 1,, ALIREZA MOAFI 2, MOHAMMAD DABAGHI 1, MOTAHAREH NADIMI 1
PMCID: PMC4467268  PMID: 26137238

Abstract

BAALC is a novel molecular marker in leukemia that is highly expressed in patients with acute leukemia. Increased expression levels of BAALC are known as poor prognostic factors in adult acute myeloid and lymphoid leukemia. The purpose of the present study was to evaluate the prognostic significance of the BAALC gene expression levels in pediatric acute lymphoblastic leukemia (ALL) and its association with MDR1. Using reverse transcription-quantitative polymerase chain reaction (RT-qPCR), the mRNA expression levels of BAALC and MRD1 were measured in bone marrow samples of 28 new diagnosed childhood ALL patients and 13 children without cancer. Minimal residual disease (MRD) was measured one year after the initiation of the chemotherapy using the RT-qPCR method. The high level expression of BAALC had a significant association with the pre-B-ALL subtype, leukocytosis and positive MRD after one year of treatment in leukemic patients. In addition, a positive correlation between BAALC and MDR1 mRNA expression was shown in this group. In conclusion, to the best of our knowledge, the increase of BAALC expression as a poor prognostic factor for childhood ALL is shown for the first time. Additionally, the correlation between BAALC and MDR1 in mRNA expression levels can aid for an improved understanding of the mechanism through which BAALC may function in ALL and multidrug resistance.

Keywords: BAALC gene, acute lymphoblastic leukemia, multidrug resistance, ABCB1 gene

Introduction

Acute lymphoblastic leukemia (ALL) is the most common type of cancer in children, responsible for 25–30% of all cancers in children <15 years (12). Although the complete remission of this disease is ~70–80%, there remains the risk of relapse in 20–30% of these children (36). Resistance to chemotherapy considerably reduces the rate of treatment success and increases the risk of relapse (79).

The BAALC gene is a marker of hematopoietic precursor cells that was detected for the first time in adult acute myeloid leukemia (AML). The BAALC gene is located on chromosome 8q22.3 and is expressed in differentiated cells of the nervous system, neuroectoderm-derived tissues (10) and bone marrow hematopoietic precursor cluster of differentiation 34+ cells (11). Studies have shown that increased BAALC expression causes poor treatment results and resistance to chemotherapy in adult AML and ALL patients (1214).

Adenosine triphosphate (ATP)-binding cassette sub-family B member (ABCB1), also known as multidrug resistance 1 (MDR1), is an ATP-dependent transporter that is responsible for inhibiting the accumulation of chemotherapy drugs in multidrug resistant cells (1517). Increased expression levels of ABCB1 in children with ALL leads to a high risk of relapse (1819). Studies show that the expression levels of the BAALC gene has a positive association with increased expression levels of ABCB1 in AML drug resistance. Additionally, the association of high mRNA expression levels of BAALC with increased levels of ABCB1 contributes to an increased risk of relapse in AML patients, as well as to a decreased rate of complete remission and worse overall survival rate in these patients (1214). The present study is a novel investigation on BAALC that examines the mRNA expression levels of this gene in children with ALL and evaluates its association with ABCB1 and the response to therapy in these patients.

Materials and methods

Patients and sample preparation

Subsequent to obtaining fully informed consent from all the parents, 28 bone marrow samples from children <15 years of age (new case), including 5 cases of T-ALL and 23 cases of B-ALL, were studied and compared to 13 bone marrow samples of children with no cancer symptoms. The latter aforementioned samples were those investigated for autoimmune diseases. A total of 2 ml of bone marrow samples was obtained under general anesthesia, added to 0.1 ml heparin and sent to the laboratory on ice. Mononuclear cell isolation was performed using Lymphoprep (Axis-Shailed Diagnostics Ltd., Oslo, Norway). Hematological indices were measured with automated analyzers (Technicon H1; Bayer Corp, Etobicoke, ON, Canada).

mRNA isolation and assessment

Total RNA isolation from mononuclear cells was carried out using the RNeasy Mini kit (Qiagen, Hilden, Germany). The amount and quality of extracted RNA was measured by a BioPhotometer (Eppendorf AG, Hamburg, Germany) and the extracted RNA samples were loaded on 1.8% agarose gel (Merck KGaA, Darmstadt, Germany) for quality assessment. Subsequently, 2 µg total RNA was converted to cDNA using a cDNA synthesis kit and random hexamer primers (Fermentas, St. Leon-Rot, Germany). The housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), was selected as an internal control. Specific forward primers for BAALC, ABCB1 and GAPDH genes were 5′GCCCTCTGACCCAGAAACAG3′, 5′GAGGCCGCTGTTCGTTTCCTTTAGGTC3′ and 5′GCCCCAGCAAGAGCACAAGAGGAAGA3′, respectively. Reverse primers for the abovementioned genes were 5′CTTTTGCAGGCATTCTCTTAGCA3′, 5′AGATTCATTCGACCTCGCGCTCCT3′ and 5′CATGGCAACTGTGAGGAGGGGAGAT3′, respectively. SYBER Premix Ex Taq II Real Time kit (Takara io, Inc., Tokyo, Japan) was used for reverse transcription-quantitative polymerase chain reaction (RT-qPCR) that was carried out through an optimized program (3–5 min pre-incubation at 95°C, 10–15 sec denaturation at 95°C, 30 sec annealing at 59–61°C and 30 sec product expansion at 72°C in 35–45 cycles). Correlations were investigated between the BAALC and ABCB1 mRNA expression levels. Any association between the BAALC gene expression levels and certain prognostic factors of childhood ALL, including age, white blood cell (WBC) counts, platelet counts and hemoglobin levels, were also examined at the onset of the disease.

Evaluation of treatment response

Newly diagnosed patients were treated based on the Australian and New Zealand Children's Cancer Study Group ALL study 8 protocol (http://www.anzctr.org.au/trial_view.aspx?ID=1568). To assess treatment response in the year following the initiation of the treatment, the amount of minimal residual disease (MRD) was studied using RT-qPCR to detect monoclonal immunoglobulin heavy chain gene rearrangement. Persistence of monoclonality, referred to as MRD+, was considered as a poor response to therapy and drug resistance.

Statistical analysis

Statistical analysis was performed using the Graphpad Prism 5 software. Correlations between gene expression levels and ALL prognostic factors were measured using Pearson and Spearman's correlation tests. Association between gene expression and response to therapy was performed using Fisher's exact test. Data are shown as mean ± standard error of the mean (SEM) and P<0.05 was considered to indicate a statistically significant difference.

Results

Patients

A total of 28 patients were involved in the study. One of the patients succumbed during the induction stages due to infection. Two patients, who relapsed during the first year of treatment, were considered as treatment resistant patients. The remaining 25 patients were investigated for signs of MRD at the end of the first year of chemotherapy. Monoclonality remained persistent for 6 patients who were considered MRD+ and resistant to therapy.

mRNA expression levels of the BAALC gene

The mRNA expression levels of BAALC were significantly different between de novo patients and the control group (mean ± SEM, 3.67±0.66 vs. 1.24±0.27, respectively; P=0.04) (Fig. 1).

Figure 1.

Figure 1.

Relative mRNA expression levels of BAALC in bone marrow samples of children with acute lymphoblastic leukemia (ALL) and children with no sypmtoms of cancer. *P≤0.05.

The comparison of the BAALC gene expression level between the ALL subgroups (T-ALL, early pre-B cell and pre B-cell) showed a significant difference only for early pre-B cell subtype compared to the control group (mean ± SEM, 3.52±1.56 vs. 1.24±0.27, respectively; P=0.03) (Fig. 2).

Figure 2.

Figure 2.

Relative mRNA expression levels of BAALC in different subtypes of acute lymphoblastic leukemia (ALL). *P≤0.05.

Association between the BAALC gene expression and response to therapy

The association between the BAALC gene mRNA expression levels and response to therapy was assessed in 27 ALL patients. BAALC expression levels in MRD+ patients were significantly higher compared to the MRD patients and the control group (mean ± SEM, 4.59±1.28 vs. 1.92±0.48 and 1.24±0.27, respectively; P≤0.0001) (Fig. 3). The results of the Fisher's exact test showed that when BAALC mRNA expression levels are >2-fold more than that of the control group, the risk of drug resistance (MRD+) will be 4.14-fold higher (P=0.001) (Table I).

Figure 3.

Figure 3.

Association between the mRNA expression levels of BAALC and response to therapy. The BAALC expression levels in MRD+ patients are significantly higher than those in MRD patients and also the control group. MRD, minimal residual disease. *P≤0.05.

Table I.

Association between the BAALC expression levels and response to therapy.

Therapy response, n

Cut-off point for BAALC expression MRD+ MRD- P-value Odds ratio
>2-fold 7 4 0.001 4.14
<2-fold 4 10

MRD, minimal residual disease.

Correlation between BAALC and ABCB1

Results of the Pearson and Spearman's correlation tests showed a significant association between BAALC and ABCB1 expression at mRNA levels (P=0.03). Based on the Pearson and Spearman's correlation tests, it was observed that a simultaneous increase in mRNA expression levels of BAALC and ABCB1 increases the risk of relapse by 4.55-fold (Fig. 4).

Figure 4.

Figure 4.

Dot plot demonstration showing a correlation between the expression levels of the BAALC and ABCB1 genes.

BAALC gene expression and certain prognostic factors

Possible correlations between the BAALC gene overexpression and several prognostic factors in childhood ALL, including age, WBC counts, platelet counts and hemoglobin levels, were investigated. Spearman's correlation tests demonstrated a significantly positive correlation between the mRNA expression levels of BAALC and WBC count in childhood ALL (P=0.04). There was no significant correlation between the increased expression levels of BAALC and age (P=0.41), gender (P=0.40), platelet count (P=0.31) and hemoglobin levels (P=0.18).

Discussion

To the best of our knowledge, the present study identifies the role of BAALC as a prognostic biomarker in childhood ALL for the first time. In addition, the data showed that BAALC gene expression in de novo patients is 2.4 times more than in the control group. However, we do not believe that BAALC may be considered as a valuable diagnostic factor for ALL, as BAALC gene overexpression is reported only in immature cells that were increased primarily at the onset of the disease prior to sampling (11,2021). What makes this phenotype more clinically important is the uneven overexpression of the gene in different leukemic blast cells. The present results indicate a significant increase in mRNA expression levels of BAALC in MRD+ patients compared to the control group, which indicates that the immature cells expressing more of the BAALC gene are the more resistant cells to chemotherapy. These data suggest that BAALC has an adverse impact on response to therapy. Therefore, increased expression of BAALC is introduced as a poor prognostic factor for childhood ALL. The first studies to validate the poor prognostic value of BAALC were performed in adult leukemic patients or children with AML (14,2224). These studies indicate an association between the increased mRNA expression levels of BAALC with poor treatment response and early drug resistance. Consequently, BAALC is proposed as a risk factor for adult leukemia patients (1314,21). These findings are consistent with the present study, demonstrating that the 2-fold increase of BAALC expression in MRD+ patients compared to normal levels may elevate the risk of relapse by 4.14 times. These findings allow for the development of improved therapies. By contrast, the present study may open up more opportunities to understand the multifactorial pathophysiology of ALL.

The pathophysiological role of BAALC is under investigation. However, the precise function of this protein in cancer biology has remained undefined. High expression levels of BAALC are reported to increase proliferation and decrease apoptosis in leukemic cell lines (25). By contrast, it is suggested that BAALC may have an impact on multidrug resistance through association with the ABC transporters in AML. The present study has examined, for the first time, the association between BAALC and ABCB1, one member of this large family, in childhood ALL. The mRNA expression profile of ABCB1 in childhood ALL was recently studied by our group and was suggested to be a risk factor for treatment failure and multidrug resistance in this disease (1819). Our findings show that the increase of BAALC expression is positively associated with ABCB1 mRNA expression profiles. However, it is unclear whether these two genes are expressed dependently, or that they are two separate prognostic factors that function in different pathways. The mechanism by which these two genes operate awaits further confirmation.

Cytogenetic studies were not available in the present study, however, statistical tests were performed to investigate the association between BAALC mRNA expression levels and several clinical characteristics, including gender, WBC and platelet counts, hemoglobin levels and serum biochemistries such as lactate dehydrogenase. Results showed that among the aforementioned ALL risk factors, high BAALC expression mRNA levels were solely associated with the increased numbers of WBCs >50×103/µl at the time of diagnosis. This association is supported by the potential role of BAALC in leukemic cells proliferation and resistance to apoptosis, which was previously mentioned in this section.

In conclusion, BAALC mRNA overexpression is proposed as a negative prognostic factor in childhood ALL, which increases the risk of resistance to chemotherapy. It is suggested elsewhere that BAALC may promote leukemic cell proliferation and inhibit their apoptosis. The present results show that simultaneous overexpression of BAALC and ABCB1 in MRD+ children with ALL may introduce a second mechanism through which BAALC may apply its adverse effect on response to treatment. The exact function of BAALC in childhood ALL and the manner of its communication with ABC transporters for increasing the risk of resistance to therapy remain to be established.

References

  • 1.Linet MS, Ries LA, Smith MA, Tarone RE, Devesa SS. Cancer surveillance series: Recent trends in childhood cancer incidence and mortality in the United States. J Natl Cancer Inst. 1999;91:1051–1058. doi: 10.1093/jnci/91.12.1051. [DOI] [PubMed] [Google Scholar]
  • 2.Pui C-H. Acute lymphoblastic leukemia in children. Curr Opin Oncol. 2000;12:3–12. doi: 10.1097/00001622-200001000-00002. [DOI] [PubMed] [Google Scholar]
  • 3.le Viseur C, Hotfilder M, Bomken S, Wilson K, Röttgers S, Schrauder A, Rosemann A, Irving J, Stam RW, Shultz LD, et al. In childhood acute lymphoblastic leukemia, blasts at different stages of immunophenotypic maturation have stem cell properties. Cancer Cell. 2008;14:47–58. doi: 10.1016/j.ccr.2008.05.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Belson M, Kingsley B, Holmes A. Risk factors for acute leukemia in children: A review. Environ Health Perspect. 2007;115:138–145. doi: 10.1289/ehp.9023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kelly PN, Dakic A, Adams JM, Nutt SL, Strasser A. Tumor growth need not be driven by rare cancer stem cells. Science. 2007;317:337. doi: 10.1126/science.1142596. [DOI] [PubMed] [Google Scholar]
  • 6.Kennedy JA, Barabé F, Poeppl AG, Wang JC, Dick JE. Comment on ‘Tumor growth need not be driven by rare cancer stem cells’. Science. 2007;318:1722. doi: 10.1126/science.1149590. [DOI] [PubMed] [Google Scholar]
  • 7.Pui C-H, Relling MV, Downing JR. Acute lymphoblastic leukemia. N Engl J Med. 2004;350:1535–1548. doi: 10.1056/NEJMra023001. [DOI] [PubMed] [Google Scholar]
  • 8.Ross DD. Novel mechanisms of drug resistance in leukemia. Leukemia. 2000;14:467–473. doi: 10.1038/sj.leu.2401694. [DOI] [PubMed] [Google Scholar]
  • 9.Swerts K, De Moerloose B, Dhooge C, Laureys G, Benoit Y, Philippé J. Prognostic significance of multidrug resistance-related proteins in childhood acute lymphoblastic leukaemia. Eur J Cancer. 2006;42:295–309. doi: 10.1016/j.ejca.2005.09.017. [DOI] [PubMed] [Google Scholar]
  • 10.Tanner SM, Austin JL, Leone G, Rush LJ, Plass C, Heinonen K, Mrózek K, Sill H, Knuutila S, Kolitz JE, et al. BAALC, the human member of a novel mammalian neuroectoderm gene lineage, is implicated in hematopoiesis and acute leukemia. Proc Natl Acad Sci USA. 2001;98:13901–13906. doi: 10.1073/pnas.241525498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Baldus CD, Tanner SM, Kusewitt DF, Liyanarachchi S, Choi C, Caligiuri MA, Bloomfield CD, de la Chapelle A. BAALC, a novel marker of human hematopoietic progenitor cells. Exp Hematol. 2003;31:1051–1056. doi: 10.1016/S0301-472X(03)00263-7. [DOI] [PubMed] [Google Scholar]
  • 12.Guo X, Shi P, Chen F, Zha J, Liu B, Li R, Dong H, Zheng H, Xu B. Low MDR1 and BAALC expression identifies a new subgroup of intermediate cytogenetic risk acute myeloid leukemia with a favorable outcome. Blood Cells Mol Dis. 2014;53:144–148. doi: 10.1016/j.bcmd.2014.05.001. [DOI] [PubMed] [Google Scholar]
  • 13.Langer C, Radmacher MD, Ruppert AS, Whitman SP, Paschka P, Mrózek K, Baldus CD, Vukosavljevic T, Liu CG, Ross ME, et al. Cancer and Leukemia Group B (CALGB): High BAALC expression associates with other molecular prognostic markers, poor outcome and a distinct gene-expression signature in cytogenetically normal patients younger than 60 years with acute myeloid leukemia: A Cancer and Leukemia Group B (CALGB) study. Blood. 2008;111:5371–5379. doi: 10.1182/blood-2007-11-124958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kühnl A, Gökbuget N, Stroux A, Burmeister T, Neumann M, Heesch S, Haferlach T, Hoelzer D, Hofmann WK, Thiel E, et al. High BAALC expression predicts chemoresistance in adult B-precursor acute lymphoblastic leukemia. Blood. 2010;115:3737–3744. doi: 10.1182/blood-2009-09-241943. [DOI] [PubMed] [Google Scholar]
  • 15.Leonard GD, Fojo T, Bates SE. The role of ABC transporters in clinical practice. Oncologist. 2003;8:411–424. doi: 10.1634/theoncologist.8-5-411. [DOI] [PubMed] [Google Scholar]
  • 16.Gillet J-P, Gottesman MM. Mechanisms of multidrug resistance in cancer. Methods Mol Biol. 2010;596:47–76. doi: 10.1007/978-1-60761-416-6_4. [DOI] [PubMed] [Google Scholar]
  • 17.Marques DS, Sandrini JZ, Boyle RT, Marins LF, Trindade GS. Relationships between multidrug resistance (MDR) and stem cell markers in human chronic myeloid leukemia cell lines. Leuk Res. 2010;34:757–762. doi: 10.1016/j.leukres.2009.11.004. [DOI] [PubMed] [Google Scholar]
  • 18.Rahgozar S, Moafi A, Abedi M, Entezar-E-Ghaem M, Moshtaghian J, Ghaedi K, Esmaeili A, Montazeri F. mRNA expression profile of multidrug-resistant genes in acute lymphoblastic leukemia of children, a prognostic value for ABCA3 and ABCA2. Cancer Biol Ther. 2014;15:35–41. doi: 10.4161/cbt.26603. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Abedi M, Rahgozar S, Moafi A, et al. Evaluation of the expression profile of MDR1 gene and assessment of its prognostic value in childhood ALL. Sci J Iran Blood Transfus Organ. 2014;10:326–334. [Google Scholar]
  • 20.Baldus CD, Tanner SM, Ruppert AS, Whitman SP, Archer KJ, Marcucci G, Caligiuri MA, Carroll AJ, Vardiman JW, Powell BL, et al. BAALC expression predicts clinical outcome of de novo acute myeloid leukemia patients with normal cytogenetics: A Cancer and Leukemia Group B Study. Blood. 2003;102:1613–1618. doi: 10.1182/blood-2003-02-0359. [DOI] [PubMed] [Google Scholar]
  • 21.Baldus CD, Martus P, Burmeister T, Schwartz S, Gökbuget N, Bloomfield CD, Hoelzer D, Thiel E, Hofmann WK. Low ERG and BAALC expression identifies a new subgroup of adult acute T-lymphoblastic leukemia with a highly favorable outcome. J Clin Oncol. 2007;25:3739–3745. doi: 10.1200/JCO.2007.11.5253. [DOI] [PubMed] [Google Scholar]
  • 22.Gregory TK, Wald D, Chen Y, Vermaat JM, Xiong Y, Tse W. Molecular prognostic markers for adult acute myeloid leukemia with normal cytogenetics. J Hematol Oncol. 2009;2:23. doi: 10.1186/1756-8722-2-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Weber S, Alpermann T, Dicker F, Jeromin S, Nadarajah N, Eder C, Fasan A, Kohlmann A, Meggendorfer M, Haferlach C, et al. BAALC expression: A suitable marker for prognostic risk stratification and detection of residual disease in cytogenetically normal acute myeloid leukemia. Blood Cancer J. 2014;4:e173. doi: 10.1038/bcj.2013.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Mizushima Y, Taki T, Shimada A, Yui Y, Hiraumi Y, Matsubara H, Watanabe M, Watanabe K, Kamitsuji Y, Hayashi Y, et al. Prognostic significance of the BAALC isoform pattern and CEBPA mutations in pediatric acute myeloid leukemia with normal karyotype: A study by the Japanese Childhood AML Cooperative Study Group. Int J Hematol. 2010;91:831–837. doi: 10.1007/s12185-010-0585-x. [DOI] [PubMed] [Google Scholar]
  • 25.Xu B, Chen G, Shi P, Guo X, Xiao P, Wang W, Zhou S. shRNA-Mediated BAALC knockdown affects proliferation and apoptosis in human acute myeloid leukemia cells. Hematology. 2012;17:35–40. doi: 10.1179/102453312X13221316477499. [DOI] [PubMed] [Google Scholar]

Articles from Biomedical Reports are provided here courtesy of Spandidos Publications

RESOURCES