Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2015 Sep 18;59(10):6594–6596. doi: 10.1128/AAC.00400-15

Non-O1/Non-O139 Vibrio cholerae Avian Isolate from France Cocarrying the blaVIM-1 and blaVIM-4 Genes

Salim Aberkane a,b,c,, Fabrice Compain d,e, Olivier Barraud j, Abdoul-Salam Ouédraogo b,c, Nicolas Bouzinbi a,b,c,h, Marion Vittecoq g,h, Hélène Jean-Pierre a,i, Dominique Decré d,e,f, Sylvain Godreuil a,b,c
PMCID: PMC4576041  PMID: 26169421

Abstract

We describe here a non-O1/non-O139 Vibrio cholerae isolate producing both VIM-1 and VIM-4 carbapenemases. It was isolated from a yellow-legged gull in southern France. The blaVIM genes were part of a class 1 integron structure located in an IncA/C plasmid. This study emphasizes the presence of carbapenemase genes in wildlife microbiota.

TEXT

Multidrug-resistant Vibrio cholerae strains have been increasingly reported worldwide (1). However, data on resistance to third-generation cephalosporins, mostly via genes encoding extended-spectrum β-lactamase (ESBL) (2, 3) or cephalosporinase determinants (4) are limited. Carbapenemase-mediated resistance in Vibrio spp. has been reported only in India, where clinical and environmental V. cholerae isolates carrying the NDM-1 metalloenzyme were described in several studies (46). We describe here an avian strain of V. cholerae that was isolated in southern France and that coharbors the blaVIM-1 and blaVIM-4 carbapenemase genes.

In April 2013, 93 cloacal swab samples from juvenile unfledged yellow-legged gulls (Larus michahellis) breeding on the island of Carteau, Port-Saint-Louis, France, were screened for bacteria resistant to broad-spectrum β-lactam antibiotics. Briefly, swab samples were inoculated in Trypticase soy broth (Thermo Fisher Scientific) and grown at 37°C for 24 h. Samples were then subcultured in ESBL agar plates (bioMérieux, Marcy l'Etoile, France) and were examined after 24 and 48 h of incubation. Enterobacteriaceae resistant to multiple drugs via different resistance mechanisms (e.g., third-generation cephalosporin-resistant Escherichia coli and Proteus mirabilis harboring plasmid-mediated cephalosporinase genes or ESBL genes) were recovered (7; our unpublished data). In addition, a V. cholerae strain showing resistance to third-generation cephalosporins was detected. No other multidrug-resistant V. cholerae strain was recovered. Species identification was performed by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometry (Bruker Daltonics, Bremen, Germany). Moreover, PCR analysis of the rfb gene cluster (8), the cholera toxin ctxA gene (9), and the colonization factor tcpA gene (9) revealed a nontoxigenic, non-O1/non-O139 isolate.

Susceptibility testing was performed using the disk diffusion method on Mueller-Hinton agar and was interpreted according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) clinical breakpoints (version 5.0) (http://www.eucast.org/clinical_breakpoints/) (10). The strain was intermediate or resistant to most β-lactam antibiotics, except aztreonam. The MICs for amoxicillin, cefotaxime, ceftazidime, imipenem, ertapenem, doripenem, and meropenem were determined in the parental strain and the transconjugant with the Etest method (bioMérieux, Marcy l'Etoile, France) (Table 1). Metallo-β-lactamase production was observed by using the carbapenemase/metallo-β-lactamase confirmative identification pack (Rosco Diagnostica Neo-Sensitabs, Eurobio, Courtaboeuf, France). Specifically, reduced susceptibility to meropenem was corrected by the addition of dipicolinic acid, while the addition of cloxacillin and boronic acid had no effect. ESBL production was excluded with the double-disk synergy test (11), while culture in Mueller-Hinton agar impregnated with 2 ml of 5 × 10−3 M EDTA restored the activity of all β-lactam antibiotics, as previously described (12). Susceptibility testing using the disk diffusion method showed that fluoroquinolones, chloramphenicol, cotrimoxazole, and tetracycline remained active. Only tobramycin showed intermediate susceptibility among the aminoglycosides, while amikacin, isepamicin, netilmicin, and gentamicin remained active.

TABLE 1.

Susceptibility of parental and recipient strains

Antibiotic MIC (mg/liter) for:
Parental strain (V. cholerae) Recipient strain (J53 E. coli) J53 E. coli
Amoxicillin >256 >256 2
Cefotaxime 4 8 0.064
Ceftazidime 6 24 0.064
Aztreonam 0.38 0.032 0.064
Imipenem 3 4 0.25
Ertapenem 0.19 0.064 0.064
Meropenem 0.5 0.75 0.064
Doripenem 0.75 0.75 0.064
Amikacin 2 0.5 0.5
Gentamicin 1.5 0.25 0.25
Tobramycin 2 0.75 0.5

Detection of the most prevalent carbapenemase genes (including blaKPC, blaVIM, blaOXA-48, and blaIMP-1), assessed by multiplex PCR as previously described (13), and of the blaNDM gene (14), assessed by PCR assay, gave a positive result for the blaVIM gene. This was confirmed by simplex PCR assay using the primers VIM_F (5′-AGTGGTGAGTATCCGACAG-3′) and VIM_R (5′-TGCAACTTCATGTTATGCCG-3′). Bidirectional sequencing performed using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) and an Applied Biosystems 3730 XL capillary sequencer identified both blaVIM-1 and blaVIM-4 genes.

To characterize the genetic environment of the blaVIM genes, the amplicons of parental and recipient strains were analyzed by PCR mapping and sequencing using specific primers (Table 2) (GenBank accession number KR262557). Both blaVIM-1 and blaVIM-4 genes were part of the same class 1 integron (Fig. 1), located in the IncA/C plasmid. These two carbapenemase gene cassettes flanked an aac(6′)-IIc gene cassette that confers resistance to aminoglycosides. A PcS (strong) promoter variant, divergent to the integrase gene, was identified in the class 1 integron, with a functional P2 promoter located downstream of the PcS in the attI1 site. It resulted from the insertion of three G residues. The PcS-P2 association has rarely been described in class 1 integrons and might confer high-level gene cassette expression (15). A similar integron containing the blaVIM-1 and aac(6′)-IIc genes was previously described in an Enterobacter cloacae clinical isolate from Greece (GenBank accession number AY648125) (16), but this is the first description of a class 1 integron with two blaVIM variants. It may be hypothesized that the presence of two blaVIM genes in a single integron might enable better plasticity in the case of rearrangements of the cassette network under selective pressure caused, for instance, by antibiotics.

TABLE 2.

Primers used for PCR mapping of the cassette network

Primer name Primer sequence (5′ to 3′)
VIM-L1 TCATTGTCCGTGATGGTGATGA
VIM-L2 CCGGGCGGTCTAGACTTGCT
VIM-R1 CGATATGCGACCAAACACCATC
VIM-R2 GCCATTCAGCCAGATCG
attI1 GGCATCCAAGCAGCAAGCGCGTT
sul1 GTCCGACATCCACGACGTCTGATC

FIG 1.

FIG 1

Linear map of the class 1 integron harboring both blaVIM-1 and blaVIM-4 genes. Arrows, relative gene size and direction of transcription; black arrows, gene cassette promoters PcS and P2.

Mating experiments were performed on agar plates, as previously described (6), at 25°C and 37°C using the rifampin-resistant E. coli J53 strain as the recipient, with a donor-to-recipient ratio of 4:1. Transconjugants were selected on Drigalski agar (Bio-Rad) containing 250 mg/liter rifampin and 4 mg/liter cefotaxime. A transconjugant that coharbored the blaVIM-1 and blaVIM-4 genes was obtained from the V. cholerae isolate at 25°C, with a transfer frequency of 3 × 10−6 transconjugants per recipient. PCR mapping showed that the genetic structure that harbored both blaVIM genes was the same in the parental and recipient strains. No transfer was obtained at 37°C, despite repeated attempts. The plasmid relaxase gene typing (PRaseT) method, which allows detection of the major replicon groups, and a PCR-based replicon typing method revealed the presence of an IncA/C plasmid in the parental and recipient strains (17, 18). Conversely, the SXT integrative and conjugative element, which is a major resistance determinant in V. cholerae (1), was detected in only the parental strain by PRaseT. No other typeable mobile genetic element was found. Plasmid content analysis using the method of Kado and Liu (19) revealed only one plasmid of ∼150 kb in both the parental and recipient strains (see Fig. S1 in the supplemental material). These results suggest that the blaVIM-1 and blaVIM-4 genes were carried by the broad-host-range IncA/C transmissible plasmid, a widespread blaVIM-carrying genetic element (20) and a common resistance determinant in V. cholerae (21).

Although nonepidemic, non-O1/non-O139 V. cholerae isolates are human pathogens that may cause diarrhea and extraintestinal infections (21). Fluid resuscitation remains the first-line therapy, but the use of antibiotics allows decreased symptom duration and pathogen dissemination. This is, to our knowledge, the first description of a non-O1/non-O139 V. cholerae isolate harboring blaVIM carbapenemase genes worldwide and the first description of a carbapenemase-producing V. cholerae in Western countries.

Here, its identification in an animal microbiota brings new insights into the presence of such strains in wildlife ecosystems. Walsh et al. (6) previously described NDM-1–carrying V. cholerae in seepage and tap water samples collected in New Delhi, India, emphasizing the transfer frequency of this metalloenzyme in various recipient species at environmentally relevant temperatures. In their study, conjugative transfer of IncA/C plasmids harboring blaNDM-1 in V. cholerae did not happen at 37°C, and average transfer frequencies of 10−6 and 10−4 were observed at 25°C and 30°C, respectively. Similarly, our study found that the plasmid could transfer at 25°C with comparable frequencies, whereas conjugation attempts at 37°C were unsuccessful. This suggests that optimal transfer conditions would mainly occur in the environment rather than in the gut. The presence of metalloenzymes on different genetic locations (IncA/C and nontypeable plasmids [4, 6], chromosome [5, 6]) in V. cholerae is of concern because it indicates that they can spread easily on various mobile genetic elements.

Yellow-legged gulls inhabit mostly coastal regions across the Mediterranean, where they breed in dense colonies. As they can fly long distances across the European and northern African borders, especially during their first year of life, they could play a role in the dissemination of blaVIM-harboring V. cholerae. Based on the feeding habits of yellow-legged gulls (they mainly rely on anthropogenic resources) and their microbiota diversity (including E. coli), it is reasonable to think that they are an important zoonotic reservoir of multidrug-resistant organisms, including blaVIM-carrying bacteria. This is consistent with reports highlighting the increasing prevalence of carbapenemase-producing microorganisms in wildlife microbiota (22). Moreover, their direct exposure to human activities might play a role in the spread of antibiotic resistance, as previously illustrated by ESBL-positive E. coli isolates with similar genetic background recovered among gulls and humans in several countries, including southern France (23). Further studies are needed to assess the prevalence of carbapenemase genes and their genetic background in wildlife microbiota.

Nucleotide sequence accession number.

The sequence of the class 1 integron harboring both blaVIM-1 and blaVIM-4 genes has been submitted to GenBank under accession number KR262557.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

We thank Elisabetta Andermarcher for assistance in preparing and editing the manuscript, Margaux Gaschet for technical assistance in sequencing the integron, and the municipality of Port-Saint-Louis for allowing us to access the gull colony and collect samples.

This study was supported by the University Teaching Hospital of Montpellier (CHU Montpellier, “Equipe Performante Recherche” contract).

N.B. is the recipient of CHU grants included in this contract.

Footnotes

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AAC.00400-15.

REFERENCES

  • 1.Kitaoka M, Miyata ST, Unterweger D, Pukatzki S. 2011. Antibiotic resistance mechanisms of Vibrio cholerae. J Med Microbiol 60:397–407. doi: 10.1099/jmm.0.023051-0. [DOI] [PubMed] [Google Scholar]
  • 2.Ismail H, Smith AM, Tau NP, Sooka A, Keddy KH. 2013. Cholera outbreak in South Africa, 2008–2009: laboratory analysis of Vibrio cholerae O1 strains. J Infect Dis 208:S39–S45. doi: 10.1093/infdis/jit200. [DOI] [PubMed] [Google Scholar]
  • 3.Petroni A, Corso A, Melano R, Cacace ML, Bru AM, Rossi A, Galas M. 2002. Plasmidic extended-spectrum β-lactamases in Vibrio cholerae O1 El Tor isolates in Argentina. Antimicrob Agents Chemother 46:1462–1468. doi: 10.1128/AAC.46.5.1462-1468.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Mandal J, Sangeetha V, Ganesan V, Parveen M, Preethi V, Harish BN, Srinivasan S, Parija SC. 2012. Third-generation cephalosporin-resistant Vibrio cholerae, India. Emerg Infect Dis 18:1326–1328. doi: 10.3201/eid1808.111686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Darley E, Weeks J, Jones L, Daniels V, Wootton M, MacGowan A, Walsh T. 2012. NDM-1 polymicrobial infections including Vibrio cholerae. Lancet 380:1358. doi: 10.1016/S0140-6736(12)60911-8. [DOI] [PubMed] [Google Scholar]
  • 6.Walsh TR, Weeks J, Livermore DM, Toleman MA. 2011. Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. Lancet Infect Dis 11:355–362. doi: 10.1016/S1473-3099(11)70059-7. [DOI] [PubMed] [Google Scholar]
  • 7.Aberkane S, Compain F, Decré D, Laurens C, Vittecoq M, Gauthier-Clerc M, Renaud F, Pantel A, Brieu N, Arlet G, Lavigne JP, Van De Perre P, Jean-Pierre H, Godreuil S. 2015. Persistence of AmpC-producing Proteus mirabilis strains carrying the blaCMY-2 gene on the SXT/R391-like integrative and conjugative element in two populations of gulls, South of France. abstr O068 Abstr 25th Eur Congr Clin Microbiol Infect Dis. [Google Scholar]
  • 8.Hoshino K, Yamasaki S, Mukhopadhyay AK, Chakraborty S, Basu A, Bhattacharya SK, Nair GB, Shimada T, Takeda Y. 1998. Development and evaluation of a multiplex PCR assay for rapid detection of toxigenic Vibrio cholerae O1 and O139. FEMS Immunol Med Microbiol 20:201–207. doi: 10.1111/j.1574-695X.1998.tb01128.x. [DOI] [PubMed] [Google Scholar]
  • 9.Keasler SP, Hall RH. 1993. Detecting and biotyping Vibrio cholerae O1 with multiplex polymerase chain reaction. Lancet 341:1661. doi: 10.1016/0140-6736(93)90792-F. [DOI] [PubMed] [Google Scholar]
  • 10.Matuschek E, Brown DFJ, Kahlmeter G. 2014. Development of the EUCAST disk diffusion antimicrobial susceptibility testing method and its implementation in routine microbiology laboratories. Clin Microbiol Infect 20:O255–O266. doi: 10.1111/1469-0691.12373. [DOI] [PubMed] [Google Scholar]
  • 11.Jarlier V, Nicolas MH, Fournier G, Philippon A. 1988. Extended broad-spectrum beta-lactamases conferring transferable resistance to newer beta-lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns. Rev Infect Dis 10:867–878. doi: 10.1093/clinids/10.4.867. [DOI] [PubMed] [Google Scholar]
  • 12.Birgy A, Bidet P, Genel N, Doit C, Decré D, Arlet G, Bingen E. 2012. Phenotypic screening of carbapenemases and associated β-lactamases in carbapenem-resistant Enterobacteriaceae. J Clin Microbiol 50:1295–1302. doi: 10.1128/JCM.06131-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Dallenne C, Da Costa A, Decré D, Favier C, Arlet G. 2010. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J Antimicrob Chemother 65:490–495. doi: 10.1093/jac/dkp498. [DOI] [PubMed] [Google Scholar]
  • 14.Hornsey M, Phee L, Wareham DW. 2011. A novel variant, NDM-5, of the New Delhi metallo-β-lactamase in a multidrug-resistant Escherichia coli ST648 isolate recovered from a patient in the United Kingdom. Antimicrob Agents Chemother 55:5952–5954. doi: 10.1128/AAC.05108-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Jové T, Da Re S, Denis F, Mazel D, Ploy M-C. 2010. Inverse correlation between promoter strength and excision activity in class 1 integrons. PLoS Genet 6:e1000793. doi: 10.1371/journal.pgen.1000793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Galani I, Souli M, Chryssouli Z, Orlandou K, Giamarellou H. 2005. Characterization of a new integron containing bla(VIM-1) and aac(6′)-IIc in an Enterobacter cloacae clinical isolate from Greece. J Antimicrob Chemother 55:634–638. doi: 10.1093/jac/dki073. [DOI] [PubMed] [Google Scholar]
  • 17.Compain F, Poisson A, Le Hello S, Branger C, Weill F-X, Arlet G, Decré D. 2014. Targeting relaxase genes for classification of the predominant plasmids in Enterobacteriaceae. Int J Med Microbiol 304:236–242. doi: 10.1016/j.ijmm.2013.09.009. [DOI] [PubMed] [Google Scholar]
  • 18.Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ. 2005. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods 63:219–228. doi: 10.1016/j.mimet.2005.03.018. [DOI] [PubMed] [Google Scholar]
  • 19.Kado CI, Liu ST. 1981. Rapid procedure for detection and isolation of large and small plasmids. J Bacteriol 145:1365–1373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Peirano G, Lascols C, Hackel M, Hoban DJ, Pitout JDD. 2014. Molecular epidemiology of Enterobacteriaceae that produce VIMs and IMPs from the SMART surveillance program. Diagn Microbiol Infect Dis 78:277–281. doi: 10.1016/j.diagmicrobio.2013.11.024. [DOI] [PubMed] [Google Scholar]
  • 21.Kaper JB, Morris JG, Levine MM. 1995. Cholera. Clin Microbiol Rev 8:48–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Guerra B, Fischer J, Helmuth R. 2014. An emerging public health problem: acquired carbapenemase-producing microorganisms are present in food-producing animals, their environment, companion animals and wild birds. Vet Microbiol 171:290–297. doi: 10.1016/j.vetmic.2014.02.001. [DOI] [PubMed] [Google Scholar]
  • 23.Bonnedahl J, Drobni M, Gauthier-Clerc M, Hernandez J, Granholm S, Kayser Y, Melhus A, Kahlmeter G, Waldenström J, Johansson A, Olsen B. 2009. Dissemination of Escherichia coli with CTX-M type ESBL between humans and yellow-legged gulls in the south of France. PLoS One 4:e5958. doi: 10.1371/journal.pone.0005958. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES