Table 3.
Primers used for amplification of sequences.
| S. No. | Oligo Name | Sequence (5`à 3`) | Tm (°C) | GC Content |
|---|---|---|---|---|
| 1. | ITS Forward | TCCGTAGGTGAACCTGCGG | 57 | 63.15% |
| 2. | ITS Reverse | TCCTCCGCTTATTGATATGC | 53 | 45% |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.