Abstract
The cytosolic viral nucleic acid-sensing pathways converge on the protein kinase TANK-binding kinase 1 (TBK1) and the transcription factor interferon (IFN)-regulatory factor 3 (IRF3) to induce type I IFN production and antiviral immune responses. However, the mechanism that triggers the binding of TBK1 and IRF3 after virus infection remains not fully understood. Here, we identified that thousand and one kinase 1 (TAOK1), a Ste20-like kinase, positively regulated virus-induced antiviral immune responses by controlling the TBK1-IRF3 signaling axis. Virus invasion downregulated the expression of TAOK1. TAOK1 deficiency resulted in decreased nucleic acid-mediated type I IFN production and increased susceptibility to virus infection. TAOK1 was constitutively associated with TBK1 independently of the mitochondrial antiviral signaling protein MAVS. TAOK1 promoted IRF3 activation by enhancing TBK1-IRF3 complex formation. TAOK1 enhanced virus-induced type I IFN production in a kinase activity-dependent manner. Viral infection induced TAOK1 to bind with dynein instead of microtubule-associated protein 4 (MAP4), leading to the trafficking of TBK1 to the perinuclear region to bind IRF3. Thus, the depolymerization of microtubule impaired virus-mediated IRF3 activation. Our results revealed that TAOK1 functioned as a new interaction partner and regulated antiviral signaling via trafficking TBK1 along microtubules to bind IRF3. These findings provided novel insights into the function of TAOK1 in the antiviral innate immune response and its related clinical significance.
Keywords: Antiviral immune response, TAOK1, TBK1, Dynein, Type I interferon
Introduction
The host innate immune system serves as the first line of defense to protect the host against pathogens. The antiviral response starts with the recognition of pathogen-associated molecular patterns through germline-encoded pattern recognition receptors [1]. In the cytoplasm, viral RNAs are mainly sensed by the retinoic acid-inducible gene-I (RIG-I)-like receptors (RLRs) RIG-I and melanoma differentiation-associated gene 5 (MDA5), whereas viral DNAs are recognized by cyclic GMP-AMP synthase (cGAS) [2, 3, 4]. Upon viral infection, RNA or DNA sensors initiate type I interferon (IFN) signaling pathways, which converge on the mitochondrial antiviral signaling protein (MAVS) and stimulator of IFN genes (STING), respectively [5, 6]. Both MAVS and STING downstream signaling activate TANK-binding kinase 1 (TBK1) and inhibitor-kappa-b kinase epsilon (IKKε), which subsequently activate the transcriptional factor IFN regulatory factor 3 (IRF3) and regulate type I IFN production [7].
After sensing double-stranded DNA, STING is trafficked from the endoplasmic reticulum to the Golgi apparatus and finally to cytoplasmic punctate structures to assemble with TBK1 [8]. The binding of the microtubule-associated guanine nucleotide exchange factor GEF-H1 with microtubules is essential for virus-induced IRF3 phosphorylation and IFN-β induction in macrophages [9]. The microtubule motor proteins kinesin and dynein mediate the transport of vesicles and organelles through a dynamic and polarized cytoskeleton formed by microtubules. Kinesins form a 45-membered superfamily and are responsible for the trafficking of substances toward the cell periphery, whereas dynein is involved in shuttling proteins to the minus end of the microtubule (perinuclear region) [10]. Butyrophilin 3A1 (BTN3A1) functions as a positive regulator of nucleic acid-mediated signaling by the microtubule-associated protein 4 (MAP4)-regulated and dynein-dependent microtubule trafficking of the TBK1-IRF3 signaling axis [11]. Given the relation between trafficking and type I IFN signaling, microtubule-dependent transport of key signal components plays an important role in inducing antiviral immune responses. However, how the movement of antiviral signal molecules on microtubules is precisely regulated is far from clear.
Thousand and one kinase 1 (TAOK1; also known as thousand and one amino acid protein 1 [TAO1], prostate-derived Ste20-like kinase 2 [PSK2], or MARKK) is a MAPKKK and belongs to the GCK-like class of Ste20-like kinases [12, 13]. TAOK1 can regulate mitotic progression and microtubule dynamics by interacting with a spindle checkpoint component [14, 15]. The activity of TAOK1 enhances microtubule dynamics through the activation of MARK and leads to phosphorylation and detachment of MAPs from microtubules [16, 17]. Our previous studies revealed that TAOK1 negatively regulated interleukin-17 (IL-17)-mediated signal transduction and inflammation [18], and TAOK1 positively regulated TLR4-induced inflammatory responses [19]. However, the role of TAOK1 in the antiviral immune response and its relationship with microtubule transport need to be clarified.
Materials and Methods
Mice
TAOK1f/f mice were obtained from Cyagen Biosciences Inc. (Suzhou, China). TAOK1f/f mice were crossed with Lyz2-Cre transgenic mice to obtain TAOK1 conditional-knockout Lyz2-Cre+TAOK1f/f (Lyz2+TAOK1f/f) mice with myelomonocytic lineage-specific deletion of TAOK1. Eight-week-old male groups of littermate mice were used in the in vivo experiments. All mice were bred in the University Laboratory Animal Center. All animal experiments were reviewed and approved by the Laboratory Animal Welfare and Ethics Committee of Zhejiang University (No. ZJU20210080) and were in compliance with institutional guidelines.
Cells and Reagents
HEK293T cells, RAW264.7 macrophages, and HeLa cells were obtained from American Type Culture Collection. CRISPR/Cas9-based gene-edited human MAVS knockout HEK293T cells (MAVS-KO) were kindly provided by Dr. Chengjiang Gao, Shandong University. Mouse primary peritoneal macrophages were prepared from female C57BL/6 mice (6–8 weeks old) through intraperitoneal injection with thioglycolate (Sigma). Bone marrow-derived macrophages (BMDMs) were collected from femoral and tibial bone marrow of C57BL/6 mice (6–8 weeks old). The cells were differentiated in DMEM supplemented with 10% fetal bovine serum and recombinant mouse macrophage colony-stimulating factor (20 ng/mL) (PeproTech, 315-02). Poly(I:C), poly(dA:dT), and colchicine were bought from Sigma (Sigma-Aldrich, USA).
Plasmids and Transfection
The plasmid expressing mouse TAOK1 (MR218174) was purchased from Origene Technologies (Rockville, MD, USA). The vector of this plasmid is pCMV6 Entry with C-terminal Myc and Flag tags. Genes encoding Myc-tagged TAOK1 plasmid, TAOK1 K57A and TAOK1 C were amplified by PCR from full-length TAOK1 cDNA using a MutanBest kit (TaKaRa). Plasmids expressing HA-TBK1 and its mutants (TBK1N and TBK1C), Myc-TBK1, HA-IRF3, HA-MAVS, Flag-IKKε, Flag-IRF3, and Flag-RIG-I were constructed as described previously [20]. The reporter plasmids encoding IFN-β-luciferase, IL-6 luciferase, pTK-Renilla, and RIG-1 N (a constitutively active RIG-I mutant containing N-terminal CARD domains) were provided by Dr. Weilin Chen (Shenzhen University School of Medicine, Shenzhen). IRF3-5D (a constitutively active form of IRF3) was kindly provided by Dr. Changjiang Weng (Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences, Harbin) [21]. The plasmid was transfected into HEK293T cells and HeLa cells using jetPEI (Polyplus, Illkirch, France). The plasmid was transfected into RAW264.7 cells using jetOPTIMUS (Polyplus).
Antibodies
Antibodies specific for p-IKKε (Ser172) (#8766), IKKε (#3416), p-IRF3 (Ser396) (#4947), p-NF-κB p65 (#3033), NF-κB p65 (#8242), p-TBK1 (Ser172) (#5483), TBK1 (#3504), p-ERK (#4370), ERK (#4695), p-JNK (#4668), JNK (#9285), p-p38 (#9215), p38 (#8690), and MAVS (#4983) and HRP-conjugated secondary antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti-IRF3 (sc-15991) was obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-DDK (Flag) (TA50011-1), and anti-Myc (TA150121) were obtained from Origene (Rockville, MD, USA). Anti-TAOK1 (ab92601), anti-DYNC (ab23905), anti-α-tubulin (ab52866), and anti-β-actin (ab3280) were purchased from Abcam Biotechnology (Cambridge, UK). Anti-HA (51064-2-AP), anti-DDX58 (RIG-I) (20566-1-AP), and anti-MAP4 (11229-1-AP) were purchased from Proteintech (Wuhan, Hubei, China). Anti-p-MAP4 (Ser696) (#PA5-64526) was purchased from Invitrogen (Thermo Fisher Scientific, Scotts Valley, CA, USA).
Viral Infection
Mouse PMs were infected with VSV (multiplicity of infection [MOI] = 1); respiratory syncytial virus (RSV) (kindly provided by Dr. Qingqing Wang, Zhejiang University School of Medicine, MOI = 10); Sendai virus (SeV) (MOI = 1), herpes simplex virus (HSV) (MOI = 10), and VSV-GFP (kindly provided by Dr. Xiaojian Wang, Zhejiang University School of Medicine, MOI = 1). BMDMs were infected with VSV (MOI = 1). HEK293T cells and HeLa cells were infected with VSV (MOI = 0.1, and MOI = 1 separately). MOIs were selected as described previously [22]. For in vivo mouse survival assays, 8-week-old male littermate mice were infected with VSV (1 × 108 pfu/g, n = 10 per group) via intravenous injection. For in vivo studies, 8-week-old male littermate mice were infected with VSV (1 × 107 pfu/g, n = 6 per group) via intraperitoneal injection, and IFN-β, IL-6, and TNF-α levels in serum and organs were determined. All experiments using viruses were approved by the School of Basic Medical Sciences, Zhejiang University, and were conducted in a biosecurity level 2 laboratory.
RNA Isolation and Real-Time Quantitative PCR
Total RNA was extracted using TRIzol reagent (Life Technologies) according to the manufacturer's instructions. Single-stranded cDNA was generated from total RNA with reverse transcriptase (Takara, Shiga, Japan). The SYBR RT-PCR kit (Takara) was used for quantitative real-time PCR analysis as previously described [18]. The primers used are shown in Table 1. The data were normalized to the expression level of β-actin in each sample. All experiments were conducted in triplicate.
Table 1.
Primers for real-time PCR
| Gene name | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| mouse β-actin | AGTGTGACGTTGACATCCGT | GCAGCTCAGTAACAGTCCGC |
| mouse Il6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
| mouse Tnfa | AAGCCTGTAGCCCACGTCGTA | GGCACCACTAGTTGGTTGTCTTTG |
| mouse Ifnb | ATGAGTGGTGGTTGCAGGC | TGACCTTTCAAATGCAGTAGATTCA |
| mouse Ifna4 | TACTCAGCAGACCTTGAACCT | CAGTCTTGGCAGCAAGTTGAC |
| mouse Taok1 | AGCAGTCTACTGAGAAATGGC | TGCTGCTATTTCCACTTCTTGTAAT |
| mouse Taok2 | CTCAGTCAACAGCCTAGCAGATGC | TCCTCCTCCTCCTCCTCCTCTTC |
| mouse Taok3 | CATAGAGTTGGCGGAGCGGAAG | GGAGTCATTCTGAGCGATGTGGTAG |
| VSV-G | ACGGCGTACTTCCAGATGG | CTCGGTTCAAGATCCAGGT |
| human IFNB | GCACTGGCTGGAATGAGACTA | TCCTTGGCCTTCAGGTAATGC |
| human TNFA | AAGCCTGTAGCCCACGTCGTA | GGCACCACTAGTTGGTTGTCTTTG |
| human β-ACTIN | CTCAAGAATGGGCAGAAAGC | AAACACATTAGGCGCAATCC |
ELISA
Cell supernatants and mice serum were collected and assayed for mouse IL-6, TNF-α (eBioscience, Thermo Fisher Scientific), and IFN-β (BioLegend, San Diego, CA, USA), according to the manufacturer's instructions. The results were calculated as the difference between the absorbance at 570 nm and the absorbance at 450 nm. Quantification was performed according to the standard curve as described in the manufacturer's instructions.
Flow Cytometry
Myeloid cell subsets of TAOK1f/f and Lyz+TAOK1f/f spleen cells were stained with CD11b (FITC; eBioscience, 11-0112-81), Gr-1 (PE, eBioscience, 12-5931-82), and F4/80 (APC, Biolegend, 123,116) and analyzed by FACS. Primary PMs uninfected or infected with VSV-GFP (MOI = 1) for 8 h were analyzed by flow cytometry.
Lung Histology
Lungs from TAOK1f/f and Lyz+TAOK1f/f mice uninfected or infected with VSV were dissected, fixed in 10% phosphate-buffered formalin, embedded into paraffin, sectioned, stained with hematoxylin and eosin, and then observed by light microscopy to observe morphologic changes.
Assay of Luciferase Reporter Gene Expression
Luciferase activities were measured using with a Dual-Luciferase Reporter Assay System according to the manufacturer's instructions (Promega, Madison, WI, USA). Data were normalized for transfection efficiency by dividing firefly luciferase activity by Renilla luciferase activity.
Immunoprecipitation and Immunoblot Analysis
Cells were lysed using cell lysis buffer supplemented with a protease inhibitor cocktail (Cell Signaling Technology, Danvers, MA, USA). The protein concentration in the extract was measured by BCA assay (Thermo Fisher Scientific). For immunoprecipitation, whole cell extracts were collected and incubated with specific antibodies at 4°C overnight and then with protein A/G Sepharose (sc-2003, Santa Cruz Biotechnology) for another 2 h. The beads were washed three times with cold PBS containing Tween-20, and the immunoprecipitate was eluted with loading buffer. For immunoblotting, whole-cell lysates or immunoprecipitates were subjected to SDS-PAGE, transferred onto polyvinylidene fluoride membranes (Millipore, Burlington, MA, USA), and detected with indicated antibodies. β-Actin was used to visualize equal protein loads.
Immunofluorescence Staining
HEK293T and HeLa cells grown on glass coverslips were uninfected or infected with VSV for 4 h. The cells were washed with PBS, fixed with 2% paraformaldehyde, permeabilized with 0.1% Triton X-100, blocked with 5% BSA, stained with specific antibodies at 4°C overnight on a roller, and then stained with Alexa Fluor 488-conjugated anti-mouse and Alexa Fluor 594-conjugated anti-rabbit secondary antibody to detect the co-localization of specific proteins. The images were collected using an Olympus FV3000 fluorescence microscope (Olympus).
Statistical Analysis
The significance of differences between groups was determined using the two-tailed Student's t test and two-way ANOVA. For mouse survival analysis, Kaplan-Meier survival curves were generated and analyzed by the Gehan-Breslow-Wilcoxon test. Statistical significance was determined as p < 0.05 or p < 0.01.
Results
Viral Invasion Downregulates TAOK1 Expression
Dengue virus RNA is mainly recognized by RLRs and TLRs. The dengue virus targets RNA-triggered RLR-MAVS in infected cells to induce IFN production [23]. To investigate whether TAOK1 plays a possible role in the human antiviral innate immune response, we explored the correlation between TAOK1 expression and viral infection using a public available GEO dataset (GEO 51808). Comparing whole blood samples from the healthy control or convalescent group, TAOK1 mRNA was significantly downregulated in the dengue patients, who had suffered from dengue hemorrhagic fever or dengue fever (Fig. 1a). Moreover, both TAOK1 mRNA and protein expression was decreased after infection of VSV, SeV, and HSV in primary mouse peritoneal macrophages (PMs) (Fig. 1b, c), suggesting that TAOK1 may be involved in the antiviral immune responses.
Fig. 1.
Viral invasion downregulates TAOK1 expression. a Gene expression array analysis of TAOK1 mRNA (GEO profile GDS5093) in whole blood samples from healthy control (n = 9), patients with dengue virus infection (dengue hemorrhagic fever [DHF], n = 10; dengue fever [DF], n = 18), and patients at the convalescence (n = 19). b Q-PCR analysis of Taok1 mRNA expression in PMs infected with VSV, SeV, and HSV for 8 h. c Immunoblot analysis of TAOK1 expression in lysates of mouse PMs infected with VSV, SeV, and HSV for indicated time. Data are mean ± SD. *p < 0.05, **p < 0.01 (Student's t test). Data are representative of three experiments with similar results. ns, not significant.
TAOK1 Deficiency Downregulates Virus Induction of Type I IFN
To further investigate the role of TAOK1 in host antiviral immunity, we generated TAOK1f/f mice (online suppl. Fig. 1a, b; for all online suppl. material, see www.karger.com/doi/10.1159/000526324) and crossed these mice with Lyz2-Cre transgenic mice to delete TAOK1 in myeloid lineages. The proportion of macrophages and granulocytes in the spleen was comparable between control (TAOK1f/f) and TAOK1cko (Lyz2+TAOK1f/f) littermates (online suppl. Fig. 1c, d). The mRNA expression of Taok1 in macrophages from TAOK1cko decreased significantly but did not affect the expression of Taok2 and Taok3 (online suppl. Fig. 1e). Thus, deletion of TAOK1 in myeloid lineages did not affect the development of myeloid cell subsets. We used primary PMs from control (TAOK1f/f) and conditional TAOK1-deficient (TAOK1cko, Lyz2+TAOK1f/f) mice to assess the effects of TAOK1 deficiency on virus-induced type I IFN and proinflammatory cytokine production. As shown in Figure 2a and b, TAOK1 deficiency significantly inhibited VSV infection-induced Ifnb mRNA expression and IFN-β production. However, TAOK1 deficiency did not affect IL-6 and TNF-α production at the mRNA and protein levels in macrophages. We then detected RSV (another RNA virus), SeV (RNA virus), and HSV (a DNA virus) infection induced IFN-β expression in control and TAOK1cko macrophages. As shown in Figure 2c, all viruses triggered Ifnb mRNA expression to a much lower degree in TAOK1-deficient macrophages. Knockout of TAOK1 also inhibited Ifnb mRNA expression induced by the synthetic RNA duplex poly(I:C) and the DNA duplex poly(dA:dT), which demonstrated that TAOK1 contributed to dsRNA and double-stranded DNA-induced IFN-β expression. Furthermore, VSV infection induced Ifnb mRNA expression to a lower degree in TAOK1-deficient BMDMs (Fig. 2d). In addition, TAOK1-deficient PMs showed significantly increased VSV replication when infected by VSV (Fig. 2e) and an increased proportion of GFP+ cells when infected by VSV-GFP (Fig. 2f), suggesting that macrophages from TAOK1-deficient mice were more susceptible to viral infection than those from control mice, resulting in higher virus replication. Taken together, these data suggested that TAOK1 played an important role in the host defense against virus infection by positively regulating the production of type I IFN.
Fig. 2.
Conditional TAOK1 deficiency inhibits antiviral innate immunity in macrophages. a Q-PCR analysis of Ifnb, Il6, and Tnfa mRNA expression in TAOK1f/f and Lyz2+TAOK1f/f PMs infected with VSV. b ELISA assay of IFN-β, IL-6, and TNF-α protein levels in supernatants in TAOK1f/f and Lyz2+TAOK1f/f PMs infected with VSV. c Q-PCR analysis of Ifnb mRNA expression in TAOK1f/f and Lyz2+TAOK1f/f PMs infected with RSV, SeV, and HSV and transfected with poly(I:C) (1 μg/mL), poly(dA:dT) (5 μg/mL) for 8 h. d Q-PCR analysis of Ifnb mRNA expression in BMDMs from TAOK1f/f and Lyz2+TAOK1f/f mice infected with VSV. e Q-PCR analysis of VSV-G mRNA expression in TAOK1f/f and Lyz2+TAOK1f/f PMs infected with VSV. f Flow cytometry analysis of GFP fluorescence intensity in TAOK1f/f and Lyz2+TAOK1f/f PMs infected with VSV-GFP. Data are mean ± SD. *p < 0.05, **p < 0.01 (Student's t test). Data are representative of three experiments with similar results. ns, not significant.
TAOK1 Deficiency Negatively Regulates Type I IFN Production in vivo
To further unveil the physiological function of TAOK1 in host defense against virus infection, we injected VSV into the tail vain of control and TAOK1cko mice. Viral infection resulted in rapid death of TAOK1cko mice, while control mice exhibited a higher resistance to virus infection as more than half of the mice survived longer than 60 h (Fig. 3a). Furthermore, after intraperitoneal injection of VSV, the lung tissue in TAOK1cko mice showed more severe damage along with more inflammatory cell infiltration compared with control mice (Fig. 3b). Consistent with this, TAOK1cko mice had lower IFN-β serum levels than their control counterparts following virus infection. However, control and TAOK1cko mice had comparable serum levels of IL-6 and TNF-α (Fig. 3c). In addition, we detected decreased Ifnb and Ifna4 levels in the liver, spleen, and lungs from TAOK1cko mice compared with those from control mice infected with VSV, but the expression of Il6 did not change significantly (Fig. 3d). These results demonstrated a critical role of TAOK1 in protecting the host against virus infection by promoting type-I IFN production in vivo.
Fig. 3.
TAOK1 deficiency negatively regulates type I IFN production in vivo. a Survival assay of 8-week-old TAOK1f/f and Lyz2+TAOK1f/f mice injected with VSV (1 × 108 pfu/g) via the tail vein. n = 10 per group. p < 0.05, Gehan-Breslow-Wilcoxon test. b HE staining of lung tissues of TAOK1f/f and Lyz2+TAOK1f/f mice which were intraperitoneally injected with VSV (1 × 107 pfu/g) (n = 6 per group) for 12 h. Scale bar, 100 μm. c ELISA assay of IFN-β, IL-6, and TNF-α cytokines in sera from mice as in (b). d Q-PCR analysis of Ifnb, Ifna4, and Il6 mRNA expression in the liver, spleen, and lungs from mice as in (b). Data are mean ± SD. **p < 0.01 (Student's t test). Data are representative of three experiments with similar results. ns, not significant.
TAOK1 Promotes the Virus-Triggered Activation of IKKε and IRF3
Upon virus infection, type I IFN production is initiated by sensors and downstream MAPK pathways and transcription factors such as IRF3 and NF-κB [24], which can bind the Ifnb1 promoter and promote Ifnb1 gene transcription. We examined the effects of TAOK1 deficiency on VSV infection-induced activation of the IRF3, NF-κB, and MAPK pathways. As shown in Figure 4a and b, TAOK1 deficiency inhibited VSV-induced IRF3 phosphorylation without affecting the phosphorylation of ERK1/2, P38, JNK1/2, and NF-κB p65 in mouse primary PMs. Notably, TAOK1 deficiency inhibited IKKε phosphorylation but did not affect TBK1 phosphorylation. IKKε and TBK1 are the upstream molecules that activate IRF3 (Fig. 4a). Consistently, TAOK1 overexpression promoted VSV-induced IKKε and IRF3 phosphorylation without affecting TBK1 phosphorylation in RAW264.7 macrophages (Fig. 4c). To investigate how TAOK1 exerts its function in virus-induced type I IFN production, the effects of TAOK1 on Ifnb and Il6 promoter activation mediated by various effectors were examined. The results showed that ectopically expressed TAOK1 promoted Ifnb reporter gene expression induced by RIG-I N (a constitutively active RIG-I mutant containing N-terminal CARD domains), TBK1, and IKKε but did not affect IRF3 5D (a constitutively active form of IRF3)-induced Ifnb reporter gene expression (Fig. 4d). In agreement with previous in vitro and in vivo results, TAOK1 did not affect the capacity of RIG-I N to induce Il6-luc reporter gene expression (online suppl. Fig. 2). Taken together, these data indicated that TAOK1 positively regulated type I IFN production by activating IKKε and IRF3 synergistically with RIG-I, TBK1/IKKε in antiviral immune responses.
Fig. 4.
TAOK1 deficiency inhibits VSV-induced IKKε and IRF3 phosphorylation. a, b Immunoblot analysis of phosphorylated and total proteins in lysates of PMs obtained from WT (TAOK1f/f) and TAOK1cko (Lyz2+TAOK1f/f) mice infected with VSV for indicated time. c Immunoblot analysis of phosphorylated and total proteins in lysates of Myc-TAOK1 overexpressing RAW264.7 macrophages infected with VSV for indicated time. d Luciferase activity in HEK293T cells transfected with Ifnb luciferase reporter, a Renilla-TK reporter, and an expression vector for TAOK1, along with plasmids encoding RIG-I N, TBK1, IKKε, and IRF3 5D. Data are representative of three independent experiments. Data are mean ± SD. *p < 0.05, **p < 0.01 (Student's t test). ns, not significant.
TAOK1 Interacts with TBK1
To further illuminate the underlying mechanisms by which TAOK1 positively regulates type I IFN signaling, we investigated potential TAOK1 target proteins in the RIG-I signal pathway in primary PMs. Primary PMs were not infected or infected with VSV. Cell lysates were immunoprecipitated with anti-TAOK1 and analyzed by immunoblotting. We found that TAOK1 interacted with TBK1 in both resting and activated macrophages. The interaction of TAOK1 with IRF3 was undetectable in resting macrophages, but their association was detected following VSV infection. No detectable levels of IKKε and MAVS co-precipitated with TAOK1. An association between TAOK1 and RIG-I was also detected (Fig. 5a). Consistent with the data in macrophages, exogenously expressed TAOK1 interacted with TBK1 in HEK293T cells but did not interact with IRF3 (Fig. 5b). The binding of TAOK1 to exogenous RIG-I was also detected (Fig. 5c). Neither the binding to MAVS nor the binding to IKKε was detected in HEK293T cells (Fig. 5d) (online suppl. Fig. 3a). Upon binding to viral RNA, RIG-I triggered a signaling cascade through the adapter protein MAVS, leading to the activation of IRF3 and transcriptional induction of IFN [7]. To determine whether TAOK1 still bound to TBK1 and RIG-I in MAVS-deficient cells, we detected the complex formation between TAOK1 and TBK1 or RIG-I by using MAVS knockout HEK293T (MAVS-KO) cells. As expected, TAOK1 still had the ability to bind with TBK1 and RIG-I in both resting and activated MAVS-KO HEK293T cells (Fig. 5e), but the binding between TAOK1 and IRF3 was undetectable in HEK293T cells regardless of whether the cells were rest or activated (data not shown). It may be that the binding of TAOK1 and IRF3 in these cells was too weak to be detected by Western blots. Furthermore, consistent with Figure 2, overexpression of TAOK1 enhanced VSV infection-induced IFN-β expression but did not affect TNF-α expression in these cells (Fig. 5f). Altogether, these results indicated that the antiviral activity of TAOK1 was independent of and operated in parallel with MAVS during RNA virus infection.
Fig. 5.
TAOK1 interacts with TBK1. a Mouse PMs (from wild-type [WT] C57BL/6 mice, 6–8 weeks old) were infected with VSV for indicated hours. Immunoblot analysis of endogenous signal adapters immunoprecipitated with antibody to TAOK1. b Immunoblot analysis of HEK293T cells that co-transfected with Myc-TAOK1 plus HA-TBK1 or HA-IRF3 plasmids, then immunoprecipitated with antibody to HA tag. c Immunoblot analysis of HEK293T cells that co-transfected with Myc-TAOK1 plus Flag-RIG-I plasmids, then immunoprecipitated with the antibody to Flag tag. d Immunoblot analysis of HEK293T cells that co-transfected with Myc-TAOK1 plus HA-MAVS plasmids, then immunoprecipitated with the antibody to HA tag. e WT and MAVS-deficient HEK293T (MAVS-KO) cells were infected with VSV for indicated time, followed by immunoprecipitation (IP) with anti-TAOK1 and immunoblot analysis with indicated antibodies. f Q-PCR analysis of IFNB1 and TNFA mRNA expression in MAVS-deficient HEK293T (MAVS-KO) cells transfected with TAOK1 expressing plasmid and infected with VSV for indicated time. Data are from one experiment of three similar results. Data are mean ± SD. *p < 0.05, **p < 0.01 (Student's t test). WCL, whole-cell lysates; nd, not detected.
TAOK1 Promotes TBK1-IRF3 Complex Formation
Upon binding to viral nucleic acids, nucleic acid sensors trigger antiviral signal transduction and induce the formation of the TBK1-IRF3 complex to activate the transcription factor IRF3 [25]. TBK1 is a critical kinase in regulating IKKε and IRF3 activation and type I IFN production. Many molecules are involved in the regulation of type I IFN production by targeting TBK1 [21, 26]. Considering that TAOK1 interacts with TBK1 and IRF3 in VSV-infected primary macrophages, we investigated whether TAOK1 positively regulates antiviral immune signaling via affecting TBK1-IRF3 complex formation. Co-immunoprecipitation analysis showed that TAOK1 not only promoted the combination of exogenously expressed TBK1 and IRF3 (Fig. 6a) but also promoted the combination of TBK1 and IKKε in a dose-dependent manner in resting HEK293T cells (online suppl. Fig. 3b). However, TAOK1 did not affect the binding between IKKε and IRF3 (Fig. 6b) nor did it affect the binding between RIG-I and MAVS (online suppl. Fig. 3c). Further Western blot experiments showed the endogenous binding between TBK1 and IRF3 that was detected 4 h after VSV infection, which was inhibited in TAOK1-deficient macrophages (Fig. 6c). Taken together, these results suggested that TAOK1 positively regulated antiviral signaling by promoting the interaction between TBK1 and IRF3.
Fig. 6.
TAOK1 promotes TBK1-IRF3 complex formation. a HEK293T cells were transfected with plasmids encoding HA-TBK1, Flag-IRF3, and varying doses of a plasmid encoding Myc-TAOK1 (0.5, 1.0, and 1.5 μg). Cells were harvested 24 h after transfection for immunoblot analysis as indicated with the antibody to Flag tag. b HEK293T cells were transfected with plasmids encoding Flag-IKKε, HA-IRF3, and varying doses of a plasmid encoding Myc-TAOK1 (0.5, 1.0, and 1.5 μg). Cells were harvested 24 h after transfection for immunoblot analysis as indicated with antibody to HA tag. c Mouse PMs from WT (TAOK1f/f) and TAOK1cko (Lyz2+TAOK1f/f) mice were infected with VSV for indicated hours. Immunoblot analysis of endogenous IRF3 immunoprecipitated with antibody to TBK1. Data are from one experiment of three similar results. *p < 0.05, **p < 0.01. WCL, whole-cell lysates; ns, not significant.
TAOK1 Requires Its Kinase Activity to Promote Virus-Triggered Immune Responses
TAOK1 was originally identified as a serine/threonine kinase [12] containing an N-terminal catalytic domain (CAT), a central substrate-binding domain, a spacer, and a tail domain. To determine which domain of TAOK1 and whether catalytic activity was required for the binding with TBK1, we constructed the kinase-inactive TAOK1 K57A mutant, truncated TAOK1, and TBK1 mutants. We mapped the interacting domains of TAOK1 and TBK1 using co-immunoprecipitation analysis. We found that the CAT of TAOK1 was important for the interaction with TBK1 (Fig. 7a). On the other hand, the binding interface of TAOK1 was mapped to the C-terminal domain of TBK1 (TBK1C) (Fig. 7b). Immunofluorescence analysis also showed that wild-type TAOK1, TAOK1 K57A, and N-terminal CAT (TAOK1 N) co-localized with TBK1 in both resting and VSV-infected HEK293T cells, while the CAT-deleted TAOK1 C did not co-localize with TBK1 (online suppl. Fig. 4). Furthermore, the antiviral function depending on the induced expression of IFN-β by TAOK1 was abolished in TAOK1 K57A- and TAOK1 C-overexpressing RAW264.7 and HEK293T cells. However, virus infection induced IFN-β expression was only partly abolished in RAW264.7 and HEK293T cells overexpressing TAOK1 N (Fig. 7c). In conclusion, these data suggested that TAOK1 needed its kinase activity to regulate virus-induced TBK1 signaling.
Fig. 7.
TAOK1 requires its kinase activity to promote virus-triggered immune responses. a Schematic structures of TAOK1 and the derivatives used were shown. HEK293T cells were transfected with HA-TBK1 expressing plasmid together with Myc-TAOK1, Myc-TAOK1 K57A, Myc-TAOK1C, and Myc-TAOK1N plasmids. Cells were harvested 24 h after transfection for immunoblot analysis of HA immunoprecipitated with antibody to Myc tag. b Schematic structures of TBK1 and its deletion mutants were shown. HEK293T cells were transfected with Myc-TAOK1-expressing plasmid together with HA-TBK1, HA-TBK1N, and HA-TBK1C plasmids. Cells were harvested 24 h after transfection for immunoblot analysis of Myc immunoprecipitated with the antibody to HA tag. c Q-PCR analysis of IFN-β mRNA expression in RAW264.7 cells and HEK293T transfected with TAOK1 variants and infected with VSV for 12 h. Data are mean ± SD. *p < 0.05, **p < 0.01(Student's t test). Data are representative of three independent experiments with similar results. ns, not significant; WCL, whole-cell lysates.
TAOK1 Promotes the Interaction between TBK1 and IRF3 by Trafficking TBK1 along Microtubules
The activity of TAOK1 enhances the activation of MARK and leads to phosphorylation and detachment of MAPs from microtubules [16, 17]. The phosphorylation of MAP4 occurs upon nucleic acid stimulation and induces the release of MAP4 from microtubules, thereby ensuring the binding of motor protein dynein to the microtubule and promoting the movement of TBK1 along the microtubule to phosphorylate IRF3 [11]. We speculated whether TAOK1 promotes the binding of TBK1 and IRF3 after virus infection by promoting the movement of TBK1 on microtubules. We first confirmed that the TAOK1 mutants in HeLa cells had the similar antiviral function as macrophages and HEK293T cells (online suppl. Fig. 5). Then we analyzed the effect of TAOK1 on the co-localization of TBK1 and IRF3 by confocal microscopy in HeLa cells that were uninfected or infected by VSV. To exclude the activation of IRF3 by exogenous TBK1 overexpression, we co-transfected Flag-IRF3 and Myc-TAOK1 into HeLa cells and detected the co-localization of Flag-IRF3 and endogenous TBK1. In TAOK1-overexpressing cells, the aggregation and binding of TBK1 and IRF3 in the perinuclear region were enhanced, which was more obvious in VSV-infected cells. After colchicine treatment, which results in microtubule depolymerization, this enhancement disappeared (Fig. 8a). Further experiments showed the co-localization of TAOK1 and microtubules in both uninfected and VSV-infected HeLa cells. TAOK1 K57A and TAOK1 N also bound with microtubules, but TAOK1 C did not. Moreover, most of TAOK1 K57A and TAOK1 C were located in the peripheral region of the cells, regardless of virus infection (Fig. 8b). In addition, we also confirmed the phosphorylation of MAP4 after VSV infection in macrophages, and its phosphorylation level was downregulated in TAOK1-deficient macrophages (Fig. 8c). Colchicine pretreatment significantly inhibited VSV-induced phosphorylation of IRF3 and MAP4 (Fig. 8d), suggesting that the VSV-induced phosphorylation of IRF3 and MAP4 depended on the integrity of microtubules. Then, we examined the effects of microtubule depolymerization on the TAOK1-TBK1-IRF3 binding by immunoprecipitation. The TAOK1-IRF3 interaction was reduced upon disrupting microtubule integrity by colchicine treatment. Intriguingly, TAOK1 appears to interact constitutively with TBK1, regardless of virus infection or microtubule integrity. Interestingly, we found that dynein intermediate chain (DYNC) interacted with TAOK1, and their interaction increased upon virus infection, whereas the binding of MAP4 to TAOK1 decreased after virus infection. In addition, the depolymerization of microtubule did not affect the binding of TAOK1 to dynein, but the binding of TAOK1 to MAP4 decreased significantly (Fig. 8e). These results suggested that TAOK1 promoted TBK1-IRF3 complex formation by binding the motor protein dynein and trafficking TBK1 to the perinuclear region.
Fig. 8.
TAOK1 promotes the interaction between TBK1 and IRF3 by trafficking TBK1 along microtubules. a HeLa cells co-transfected with Flag-IRF3 and Myc-TAOK1 plasmids, then pretreated with DMSO or colchicine (10 μm) for 1 h, followed by infection with or without VSV for 4 h. Confocal microscopy of co-localization between Flag-IRF3 (green) and endogeneous TBK1 (red). DAPI served as a marker of nuclei (blue). Scale bar, 10 μm. b Confocal microscopy of HeLa cells transfected with Myc-TAOK1, Myc-TAOK1 K57A, Myc-TAOK1C, and Myc-TAOK1N plasmids (green) followed by VSV infection for 4 h α-tubulin (red) was used to probe the microtubules. DAPI served as a marker of nuclei (blue). Scale bar, 10 μm. c Immunoblot analysis of phosphorylated and total MAP4 proteins in lysates of PMs obtained from WT (TAOK1f/f) and TAOK1cko (Lyz2+TAOK1f/f) mice infected with VSV for indicated time. d Mouse PMs were pretreated with DMSO or colchicine (10 μm) for 1 h and then infected with VSV for 4 h. Immunoblot analysis of phosphorylated and total IRF3 and MAP4 proteins in cell lysates. e Mouse PMs were pretreated with DMSO or colchicine (10 μM) for 1 h and then infected with VSV for 4 h. Immunoblot analysis of endogenous signal adapters immunoprecipitated with antibody to TAOK1. *p < 0.05, **p < 0.01. Data are representative of three independent experiments with similar results. ns, not significant; WCL, whole-cell lysates.
Discussion
After viral infection, viral nucleic acids are sensed by different pattern recognition receptors. Viral RNAs in the cytoplasm are recognized by RLRs RIG-I and MDA5, whereas viral DNAs in the cytosol are detected by cGAS, IFI16, and DDX41 [1, 27, 28, 29]. Extensive studies have shown that the innate antiviral immune response was modulated by various intracellular molecules, including ubiquitylases, deubiquitylases, phosphatases, and kinases [30]. In the current study, we showed that the protein kinase TAOK1 was an endogenous partner of TBK1 and governed antiviral defense through promoting the TBK1-IRF3 complex formation and IRF3 phosphorylation. In accordance, TAOK1 deficiency blocked cytosolic nucleic acid-induced IFN production and weakened host antiviral resistance of host cells and animals.
In this study, TAOK1 was found to have an effect on both the RNA viruses VSV, RSV, and SeV and the DNA virus HSV, as well as on synthetic RNA duplex poly(I:C)- and DNA duplex poly(dA:dT)-induced IFN-β production, suggesting TAOK1 played an important role in cytoplasmic nucleic acids-triggered innate immune responses. The RNA- and DNA-sensing pathways converge on the activation of the protein kinase TBK1 and the transcription factor IRF3, leading to translocation of IRF3 from the cytoplasm to the nucleus [5, 6, 11].
The formation of functional TBK1-IRF3 complexes is required for the subsequent IRF3 phosphorylation and nuclear translocation upon viral infection [31]. Some regulators have been shown to regulate TBK1-IRF3 complex formation. The helicase DDX19 impedes formation of the TBK1-IRF3 and IKKε-IRF3 complexes by promoting TBK1 and IKKε degradation, leading to decreased IRF3 phosphorylation and IFN production [21]. BTN3A1 has been reported to alter the MAP4-dynein-regulated spatial arrangement of TBK1 to the perinuclear region upon viral infection, leading to the phosphorylation of IRF3 [11]. It has been reported that microtubules are related to innate immunity [9, 32]. Our current results showed that TAOK1 promoted the TBK1-IRF3 interaction by regulating dynein-based transport along microtubules to the perinuclear region upon viral infection. In the resting state, TAOK1 bound TBK1, and the TAOK1-TBK1 complex bound to MAP4 and dynein on microtubules. After virus infection, TAOK1 promoted MAP4 phosphorylation, and phosphorylated MAP4 was detached from microtubules, allowing more dynein to bind to TAOK1 and microtubules. Then, the TAOK1-TBK1 complex moved along microtubules to the perinuclear region with the help of dynein to phosphorylate IRF3, leading to the translocation of IRF3 and the induction of type I IFN (Fig. 9). TAOK1 bridged the interaction between TBK1 and microtubule-associated proteins, such as MAP4 or dynein. Through this interaction, TAOK1 promoted the movement of TBK1 along microtubules to the perinuclear region after virus infection, bound and activated IRF3, and promoted the production of type I IFN. Whether TBK1 directly bound to MAP4 or dynein and whether TAOK1 affected its binding need to be further studied.
Fig. 9.
A schematic diagram revealing the proposed mechanism by which TAOK1 positively regulates antiviral immune responses. (1) TAOK1 promoted virus-induced MAP4 phosphorylation and microtubule detachment; (2) TAOK1 bound more dynein instead of MAP4 upon virus infection and promoted the perinuclear transport of TBK1 along microtubules; (3) TAOK1 positively regulated antiviral signaling by promoting the TBK1-IRF3 interaction and IRF3 phosphorylation.
TAOK1 deficiency inhibited virus-triggered type I IFN but did not affect proinflammatory cytokine IL-6 and TNF-α production in vitro and in vivo. Western blot showed that TAOK1 affected virus-triggered IKKε and IRF3 phosphorylation but did not affect the phosphorylation of NF-κB and MAPK. While our manuscript was in preparation, a recent study reported that the family of TAO kinases (TAOK1, −2, and −3) serves as dsRNA-interacting antiviral proteins, which would regulate type I IFN induction. However, the underlying mechanisms and in vivo evidence for TAOK1 in cytosolic antiviral immune responses, as well as whether and how TAOK1 is involved in IRF3 activation remains lacking. In addition, the study reported that loss of TAOK2 impacted Semliki Forest virus-induced IFN-α/β expression but has little effect on proinflammatory cytokines [33]. These data suggest that TAO kinases differentially regulated virus-induced IFN and proinflammatory cytokine production so that the host could resist the virus infection and avoid the damage caused by proinflammatory cytokines.
TAOK1 bound TBK1 through its CAT, and the TAOK1 kinase activity-depleted mutant TAOK1 K57A lacked the ability to promote virus-induced type I IFN production. This is consistent with the observation that TAOK1 needs its catalytic activity to affect the microtubule-associated substrates [16, 34]. We also found different distribution of wild-type TAOK1 and its mutants. Unlike TAOK1 and TAOK1 N, which were located in the cytoplasm and perinuclear region, TAOK1 K57A and TAOK1 C were located in the peripheral region of the cell whether it was infected by virus or not, suggesting that kinase activity of TAOK1 affected its distribution in the cell and its movement along microtubules as well. We showed that TAOK1 deficiency inhibited virus-induced MAP4 phosphorylation. TBK1 knockdown did not affect the MAP4 phosphorylation level induced by nucleic acid stimulation [11]. These data suggested that MAP4 was a substrate for TAOK1-mediated phosphorylation. In this study, we detected the co-localization of TAOK1 and microtubules by immunofluorescence. Compared to TAOK2, TAOK1 lacked some microtubule binding sites, so TAOK1 may bind microtubules indirectly through other microtubule-binding proteins such as dynein and MAP4 [35].
In this study, we found that TAOK1 affected IKKε phosphorylation upon virus infection but did not affect TBK1 phosphorylation. TBK1 and IKKε share greater than 70% amino acid sequence identity in the kinase domain but are widely divergent at their C-terminus, resulting in an overall homology of less than 50% [36]. We found that TAOK1 selectively bound TBK1 rather than IKKε, and the binding surface of TAOK1 was mapped to the C-terminal domain of TBK1. Therefore, we found that TAOK1 can promote the binding of TBK1 to IRF3 by binding microtubule binding proteins, but it does not affect IKKε combination with IRF3. However, TAOK1 can promote the combination of TBK1 and IKKε. We speculate that TAOK1 enhances the activity of IKKε by promoting the binding of TBK1 and IKKε after viral infection. In this study, we focused on TAOK1 promoting the combination of TBK1 and IRF3 and then promoting the antiviral immune responses. The regulatory mechanisms of TAOK1 on IKKε phosphorylation and antiviral immune responses need to be further studied.
Overall, our data have revealed that TAOK1 functioned as a new interaction partner and positively regulated antiviral signaling via trafficking TBK1 along microtubules to bind IRF3. These findings provided novel insight into the function of TAOK1 in antiviral immunity and its related clinical significance.
Statement of Ethics
This study protocol was reviewed and approved by the Laboratory Animal Welfare and Ethics Committee of Zhejiang University (No. ZJU20210080) and were in compliance with institutional guidelines.
Conflict of Interest Statement
The authors have no conflicts of interest to declare.
Funding Sources
This work was supported by the National Natural Science Foundation of China (32170926, 31870865, 31970850, 81771698); the Zhejiang Provincial Natural Science Foundation (LY18H100001); and the Guangdong Provincial Science and Technology Program (2019B030301009-008).
Author Contributions
Xiaogang Luo, Ruihua Ji, Qianru Liu, and Jun Zhou designed the study and performed the experiments; Xiaoxue Xiao, Wengang Song, and Huazhang An performed the experiments and analyzed the data; Jun Zhou and Yinke Li conceived the project, supervised the research, and wrote the manuscript.
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon request.
Supplementary Material
Supplementary data
Acknowledgments
We thank Dr. Weilin Chen for providing Ifnb-luciferase, IL6-luciferase, pTK-Renilla, and RIG-I N plasmids. We thank Dr. Changjiang Weng for providing us the IRF3-5D plasmid. We thank Dr. Qingqing Wang for providing RSV and Dr. Xiaojian Wang for providing SeV, HSV, and VSV-GFP. We thank Dr. Chengjiang Gao for providing MAVS-KO 293T cells.
Funding Statement
This work was supported by the National Natural Science Foundation of China (32170926, 31870865, 31970850, 81771698); the Zhejiang Provincial Natural Science Foundation (LY18H100001); and the Guangdong Provincial Science and Technology Program (2019B030301009-008).
References
- 1.Broz P, Monack DM. Newly described pattern recognition receptors team up against intracellular pathogens. Nat Rev Immunol. 2013 Aug;13((8)):551–565. doi: 10.1038/nri3479. [DOI] [PubMed] [Google Scholar]
- 2.Hertzog J, Rehwinkel J. Regulation and inhibition of the DNA sensor cGAS. EMBO Rep. 2020 Dec 3;21((12)):e51345. doi: 10.15252/embr.202051345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Kato H, Takahasi K, Fujita T. RIG-I-like receptors: cytoplasmic sensors for non-self RNA. Immunol Rev. 2011 Sep;243((1)):91–98. doi: 10.1111/j.1600-065X.2011.01052.x. [DOI] [PubMed] [Google Scholar]
- 4.Sun L, Wu J, Du F, Chen X, Chen ZJ. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science. 2013 Feb 15;339((6121)):786–791. doi: 10.1126/science.1232458. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Seth RB, Sun L, Ea CK, Chen ZJ. Identification and characterization of MAVS a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell. 2005 Sep 9;122((5)):669–682. doi: 10.1016/j.cell.2005.08.012. [DOI] [PubMed] [Google Scholar]
- 6.Ishikawa H, Ma Z, Barber GN. STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature. 2009 Oct 8;461((7265)):788–792. doi: 10.1038/nature08476. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Barbalat R, Ewald SE, Mouchess ML, Barton GM. Nucleic acid recognition by the innate immune system. Annu Rev Immunol. 2011;29:185–214. doi: 10.1146/annurev-immunol-031210-101340. [DOI] [PubMed] [Google Scholar]
- 8.Saitoh T, Fujita N, Hayashi T, Takahara K, Satoh T, Lee H, et al. Atg9a controls dsDNA-driven dynamic translocation of STING and the innate immune response. Proc Natl Acad Sci U S A. 2009 Dec 8;106((49)):20842–20846. doi: 10.1073/pnas.0911267106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Chiang HS, Zhao Y, Song JH, Liu S, Wang N, Terhorst C, et al. GEF-H1 controls microtubule-dependent sensing of nucleic acids for antiviral host defenses. Nat Immunol. 2014 Jan;15((1)):63–71. doi: 10.1038/ni.2766. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Caviston JP, Holzbaur ELF. Microtubule motors at the intersection of trafficking and transport. Trends Cell Biol. 2006 Oct;16((10)):530–537. doi: 10.1016/j.tcb.2006.08.002. [DOI] [PubMed] [Google Scholar]
- 11.Seo M, Lee SO, Kim JH, Hong Y, Kim S, Kim Y, et al. MAP4-regulated dynein-dependent trafficking of BTN3A1 controls the TBK1-IRF3 signaling axis. Proc Natl Acad Sci U S A. 2016 Dec 13;113((50)):14390–14395. doi: 10.1073/pnas.1615287113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Hutchison M, Berman KS, Cobb MH. Isolation of TAO1, a protein kinase that activates MEKs in stress-activated protein kinase cascades. J Biol Chem. 1998 Oct 30;273((44)):28625–32. doi: 10.1074/jbc.273.44.28625. [DOI] [PubMed] [Google Scholar]
- 13.Schlesinger TK, Fanger GR, Yujiri T, Johnson GL. The TAO of MEKK. Front Biosci. 1998 Nov 15;3:D1181–D1186. doi: 10.2741/a354. [DOI] [PubMed] [Google Scholar]
- 14.Thies E, Mandelkow EM. Missorting of tau in neurons causes degeneration of synapses that can be rescued by the kinase MARK2/Par-1. J Neurosci. 2007 Mar 14;27((11)):2896–2907. doi: 10.1523/JNEUROSCI.4674-06.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Draviam VM, Stegmeier F, Nalepa G, Sowa ME, Chen J, Liang A, et al. A functional genomic screen identifies a role for TAO1 kinase in spindle-checkpoint signalling. Nat Cell Biol. 2007 May;9((5)):556–564. doi: 10.1038/ncb1569. [DOI] [PubMed] [Google Scholar]
- 16.Timm T, Li XY, Biernat J, Jiao J, Mandelkow E, Vandekerckhove J, et al. MARKK, a Ste20-like kinase, activates the polarity-inducing kinase MARK/PAR-1. EMBO J. 2003 Oct 1;22((19)):5090–5101. doi: 10.1093/emboj/cdg447. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Drewes G, Ebneth A, Mandelkow EM. MAPs, MARKs and microtubule dynamics. Trends Biochem Sci. 1998 Aug;23((8)):307–311. doi: 10.1016/s0968-0004(98)01245-6. [DOI] [PubMed] [Google Scholar]
- 18.Zhang Z, Tang Z, Ma X, Sun K, Fan L, Fang J, et al. TAOK1 negatively regulates IL-17-mediated signaling and inflammation. Cell Mol Immunol. 2018 Feb 5;15((8)):794–802. doi: 10.1038/cmi.2017.158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Zhu L, Yu Q, Gao P, Liu Q, Luo X, Jiang G, et al. TAOK1 positively regulates TLR4-induced inflammatory responses by promoting ERK1/2 activation in macrophages. Mol Immunol. 2020 Apr 25;122:124–131. doi: 10.1016/j.molimm.2020.04.006. [DOI] [PubMed] [Google Scholar]
- 20.An H, Zhao W, Hou J, Zhang Y, Xie Y, Zheng Y, et al. SHP-2 phosphatase negatively regulates the TRIF adaptor protein-dependent type I interferon and proinflammatory cytokine production. Immunity. 2006 Dec;25((6)):919–928. doi: 10.1016/j.immuni.2006.10.014. [DOI] [PubMed] [Google Scholar]
- 21.Zhang K, Zhang Y, Xue J, Meng Q, Liu H, Bi C, et al. DDX19 inhibits type I interferon production by disrupting TBK1-IKKε-IRF3 interactions and promoting TBK1 and IKKε degradation. Cell Rep. 2019 Jan 29;26((5)):1258.e4–1272.e10. doi: 10.1016/j.celrep.2019.01.029. [DOI] [PubMed] [Google Scholar]
- 22.Song Y, Lai L, Chong Z, He J, Zhang Y, Xue Y, et al. E3 ligase FBXW7 is critical for RIG-I stabilization during antiviral responses. Nat Commun. 2017 Mar 13;8:14654. doi: 10.1038/ncomms14654. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kao YT, Lai MMC, Yu CY. How dengue virus circumvents innate immunity. Front Immunol. 2018;9:2860. doi: 10.3389/fimmu.2018.02860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Takeuchi O, Akira S. Pattern recognition receptors and inflammation. Cell. 2010 Mar 19;140((6)):805–820. doi: 10.1016/j.cell.2010.01.022. [DOI] [PubMed] [Google Scholar]
- 25.Fitzgerald KA, McWhirter SM, Faia KL, Rowe DC, Latz E, Golenbock DT, et al. IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway. Nat Immunol. 2003 May;4((5)):491–496. doi: 10.1038/ni921. [DOI] [PubMed] [Google Scholar]
- 26.Gu M, Liu Z, Lai R, Liu S, Lin W, Ouyang C, et al. RKIP and TBK1 form a positive feedback loop to promote type I interferon production in innate immunity. EMBO J. 2016 Dec 1;35((23)):2553–2565. doi: 10.15252/embj.201694060. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Zhang X, Bai XC, Chen ZJ. Structures and mechanisms in the cGAS-STING innate immunity pathway. Immunity. 2020 Jul 14;53((1)):43–53. doi: 10.1016/j.immuni.2020.05.013. [DOI] [PubMed] [Google Scholar]
- 28.Jin T, Perry A, Jiang J, Smith P, Curry JA, Unterholzner L, et al. Structures of the HIN domain:DNA complexes reveal ligand binding and activation mechanisms of the AIM2 inflammasome and IFI16 receptor. Immunity. 2012 Apr 20;36((4)):561–571. doi: 10.1016/j.immuni.2012.02.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Zhang Z, Yuan B, Bao M, Lu N, Kim T, Liu YJ. The helicase DDX41 senses intracellular DNA mediated by the adaptor STING in dendritic cells. Nat Immunol. 2011 Sep 4;12((10)):959–965. doi: 10.1038/ni.2091. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Ablasser A, Hur S. Regulation of cGAS- and RLR-mediated immunity to nucleic acids. Nat Immunol. 2020 Jan;21((1)):17–29. doi: 10.1038/s41590-019-0556-1. [DOI] [PubMed] [Google Scholar]
- 31.Zhao C, Zhao W. TANK-binding kinase 1 as a novel therapeutic target for viral diseases. Expert Opin Ther Targets. 2019 May;23((5)):437–446. doi: 10.1080/14728222.2019.1601702. [DOI] [PubMed] [Google Scholar]
- 32.Misawa T, Takahama M, Kozaki T, Lee H, Zou J, Saitoh T, et al. Microtubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome. Nat Immunol. 2013 May;14((5)):454–460. doi: 10.1038/ni.2550. [DOI] [PubMed] [Google Scholar]
- 33.Pennemann FL, Mussabekova A, Urban C, Stukalov A, Andersen LL, Grass V, et al. Cross-species analysis of viral nucleic acid interacting proteins identifies TAOKs as innate immune regulators. Nat Commun. 2021 Dec 1;12((1)):7009. doi: 10.1038/s41467-021-27192-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Mitsopoulos C, Zihni C, Garg R, Ridley AJ, Morris JDH. The prostate-derived sterile 20-like kinase (PSK) regulates microtubule organization and stability. J Biol Chem. 2003 May 16;278((20)):18085–91. doi: 10.1074/jbc.M213064200. [DOI] [PubMed] [Google Scholar]
- 35.Zihni C, Mitsopoulos C, Tavares IA, Ridley AJ, Morris JD. Prostate-derived sterile 20-like kinase 2 (PSK2) regulates apoptotic morphology via C-Jun N-terminal kinase and Rho kinase-1. J Biol Chem. 2006 Mar 17;281((11)):7317–7323. doi: 10.1074/jbc.M513769200. [DOI] [PubMed] [Google Scholar]
- 36.Pham AM, Tenoever BR. The IKK kinases: operators of antiviral signaling. Viruses. 2010 Jan;2((1)):55–72. doi: 10.3390/v2010055. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary data
Data Availability Statement
The data that support the findings of this study are available from the corresponding author upon request.









