Abstract
Douhua chicken is a unique local breed from Anhui Province, China. This study aimed to illustrate the Douhua chicken mitogenome and clarify its phylogenetic status by sequencing and annotating the complete mitochondrial genome using high-throughput sequencing and primer walking. Phylogenetic analysis through the Kimura 2-parameter model indicated the maternal origin of Douhua chicken. The results revealed that the mitochondrial genome is a closed circular molecule (16,785 bp) that consists of 13 protein-coding genes, 22 transfer RNA (tRNA) coding genes, two ribosomal RNA (rRNA) coding genes, and a control region. The base composition of the Douhua chicken mitogenome contains 30.3% A, 23.7% T, 32.5% C, and 13.5% G, and the haplotype and nucleotide diversity values are 0.829 (Hd) and 0.00441 (Pi), respectively. Furthermore, 10 haplotypes of D-loop sequences among 60 Douhua chickens were identified and distributed into four haplogroups (A, C, D, and E). Overall, the result of the present study indicates that Douhua chicken may have originated from Gallus gallus, and this process was influenced by Gallus gallus spadiceus, Gallus gallus murghi, and Gallus gallus bankiva. This study provides novel mitogenome data to support further phylogenetic and taxonomic studies on Douhua chicken. Additionally, the findings of this study will provide deeper insights for identifying the genetic relationships among populations and tracing maternal origins based on phylogenetic considerations for use in studies on the geographic conservation, utilization, and molecular genetics of poultry species.
Keywords: D-loop region, Douhua chicken, maternal origin, mitochondrial genome
High-throughput sequencing reveals the characteristics of Douhua chicken mitogenome. The D-loop region of Douhua chicken has different haplotypes.
Introduction
Mitochondrial DNA (mtDNA) represents inherited material in the cytoplasm and is characterized by a simple circular structure, higher mutation and evolution rates than nuclear DNA, almost no recombination, and strict maternal inheritance during generation transmission (Sacconea et al., 2000). It intuitively preserves occurrence states of most neutral mutations in the population and represents a powerful tool for phylogenetic analyses (Xu et al., 2006; Bernt et al., 2013a). The mitogenome length of the domestic chicken is approximately 16,700 bp, which contains 37 genes. There are 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes, and a control region, also called the D-loop region (Lan et al., 2017). The D-loop region is one of the fastest evolving regions in mitochondrial DNA molecules, where A and T bases are enriched (Huang et al., 2019). This region is genetically characterized by a high mutation and base replacement rate, and it controls the replication and transcription of mtDNA (Clayton, 2000). Presently, the D-loop region sequence has become an ideal molecular marker for studying the genetic evolution of animal populations, especially those closely related (Hoque et al., 2013; Guo et al., 2017).
Native varieties have become major resources in the modern poultry industry. Douhua chicken is a medium-sized, slow-growing, and white-feathered local variety, and it represents a popular local chicken breed in Anhui Province (Figure 1) and an important germplasm resource. In recent years, this local chicken has gained more attention owing to its superior meat quality, strong disease resistance, broad adaptation, and white plumage. At present, Douhua chicken has a population of approximately 5,000. The average body weight of an adult Douhua chicken is approximately 1.45 kg for males and 1.22 kg for females, while the mean egg production for 1 year is 150–160 eggs. In addition, this breed is well-known with customers and breeders for its special flavor, high nutrition value, and stable egg-laying performance. Thus, it is an important dual-purpose chicken breed in China because of its meat and egg resources.
Figure 1.
Physical characteristics and geographical distribution of Douhua chicken.
The present study aimed to provide a better understanding of the germplasm characteristics and phylogenetic relationship of Douhua chicken through analysis of its the complete mtDNA sequence with a description its genomic composition, nucleotide composition, and gene structure. Moreover, this study provides theoretical support for the protection, development, and utilization of various Douhua chicken resources and new mitochondrial genome data to support further phylogenetic and taxonomic studies on Douhua chicken.
Materials and Methods
Ethics statement
The study was performed according to the Regulations for the Administration of Affairs Concerning Experimental Animals (Ministry of Science and Technology, China) and approved by the Institutional Animal Care and Use Committee of Anhui Agricultural University (permit number: SYXK 2016-007). Animals had free access to water and feed for continuous survival.
Sample collection and DNA extraction
A total of 60 Douhua chickens were collected from Huangshan Xianghua Conservation and Breeding Co. Ltd., Anhui, China. Blood samples were collected from the brachial veins of chickens through standard venipuncture and stored at −80 °C. Total genomic DNA was extracted from blood tissue using the TianGen DNA extraction kit (TianGen, Beijing, China), according to the manufacturer’s instructions.
Afterward, the DNA quality and integrity were tested using 1.5% agarose gel. After measuring the DNA concentration using a spectrophotometer, it was used for high-throughput sequencing and PCR amplification.
Mitochondrial DNA amplification and sequencing
To amplify of the Douhua chicken partial mitogenome, the following primers were used to amplify the D-loop region as previously described (Zang et al., 2020): F: 5ʹ ACAAATCCCAAGAAAAATCA 3ʹ and R: 5ʹ AAGTCTTTTGCCCACAGGTA 3ʹ. The primers were synthesized and purified by TSINGKE Biological Technology Co., Ltd, Nanjing, China. The PCR was conducted using T 100Thermal Cycler (621BR30656) in reaction system containing template DNA (2 μL), upstream and downstream primers (2 μL each), 2× Taq of Master Mix (25 μL), and double-distilled water to a volume of 50 μL. The amplification conditions were as follows: 94°C for 5 min, 35 cycles at 94°C for 30 s, 50.3°C for 30 s, 72°C for 30 s, and a final extension step at 72°C for 10 min. The PCR products were purified using 1.5% agarose gel and sequenced using Sanger sequencing method by TSINGKE Biological Technology Co., Ltd, Nanjing, China.
Sequence assembly, annotation, analysis of the mitochondrial genome
The complete mitogenome was amplified using high-throughput sequencing (Figure 2). First, a 350 bp library was constructed from the DNA samples and double-end sequencing was performed using an Illumina Novaseq sequencer; the reads were 150 bp in length. The raw reads were filtered using SOAP nuke version 1.3.0. Altogether, approximately 4.4 G high quality base pairs of sequence data were obtained, and the mitogenome was assembled using the SPAdes3.13.0 software (Bankevich et al., 2012). The spliced results were compared with close reference genomes (GU261704.1) using BLAST version v2.2.30+. Based on the comparison results, the sequence assembly results were determined. Locations and boundaries of protein-coding genes, ribosomal RNA genes, and the D-loop region were identified manually through comparison with the reference genomes (GU261704.1), while intergenic spacers and overlapping regions between genes were estimated manually. Functional annotation of mitochondrial genome included coding gene prediction and noncoding RNA annotation. Gene structure annotation was carried out using Mitos2 (http://mitos2.bioinf.uni-leipzig.de/index.py) (Bernt et al., 2013b). Finally, the gene structure was deposited in GenBank under accession no. MZ922471. Visualization of the secondary structure of transfer RNA genes was accomplished using tRNA scan-SE version 2.0 (Chan and Lowe, 2019). A gene map of the mitogenome was visualized using CG view (http://cgview.ca/) (Stothard et al., 2019), and codon usage and nucleotide composition were calculated using Mega version 7.0 (Kumar et al., 2016). Codon composition skew was analyzed using formulas AT-skew = [A − T]/[A + T] and GC-skew = [G − C]/[G + C] (Perna and Kocher, 1995).
Figure 2.
Flow chart of biogenesis analysis of the mitochondrial genome of Douhua chicken.
Phylogenetic analysis
The raw D-loop sequences were edited manually and aligned against a reference sequence (GenBank accession no. GU261704.1) using Contig Express (Lu, 2004). Subsequently, sequence alignment was performed using DNAMAN version 8.0 software, while DNASP version 5.0 was used to calculate haplotype diversity, nucleotide diversity, polymorphic sites, and corresponding haplotypes of D-loop sequences (Rozas et al., 2003). All 22 sequences were selected as reference haplotypes from the 13 haplogroups defined by Miao (Miao et al., 2013) with serial numbers: GU261695, AB086102, GU261704, GU261705, GU261701, GU261681, NC-007237, GU261683, GU261677, GU261713, HQ857210, GU261708, GU261711, GU261702, GU261678, GU261719, GU261715, GU261698, GU261706, GU261692, GU261693, and GU261696. A median-joining (MJ) network was constructed using NETWORK version 10.1 software (Bandelt et al., 1999), comprising 22 reference sequences and 10 haplotypes. To further determine the evolutionary origin of Douhua chicken, 20 typical chicken sequences, with serial numbers AB007725, GU261690, GU261692, GU261674, GU261696, NC-007237, GU261707, NC-007238, NC-007240, GU261699.1, MT773644.1, MT762345.1, GU261688.1, KP269069.1, GU261714.1, MT705248.1, MT773643.1, KP681580.1, GU261684.1, and KM433666.1, were selected from NCBI for phylogenetic analysis. A neighbor-joining (NJ) tree was drawn using the MEGA version 7.0 software based on the Kimura 2-parameter model of genetic distance with 1,000 bootstrap iterations (Felsenstein, 1985).
Results and Discussion
Mitogenome characteristics and nucleotide composition
The mitochondrial genome of Douhua chicken was 16,785 bp in size. The length matched those of other chicken breeds, including the complete mitogenome of the Lueyang black-bone chicken (16,784 bp) and the Partridge Shank chicken (16,788 bp) (Zhang et al., 2018; Wang et al., 2019). The genome comprised 37 mitochondrial genes in total: 13 protein-coding genes, 22 transfer RNA (tRNA) coding genes, two ribosomal RNA (rRNA) coding genes and a control region (Table 1, Figure 3). Twenty-eight genes were situated on the L strand, while others were placed in the H strand. The nucleotide composition of the Douhua chicken mitogenome was biased towards A and T (53.99% A + T), similar to reported mitogenomes of other chicken breeds, including the Xuefeng black-boned chicken (54.05% A + T) (Liu et al., 2014) and the Luhua chicken (53.97% A + T) (Gu and Li, 2020). Additionally, an A and T nucleotide bias was observed in the control region of the Douhua chicken mitogenome with a 60.00% A + T content (Table 2). AT-skews and GC-skews were marginally positive (0.12) and negative (−0.41) in the entire mitogenome of Douhua chicken, respectively. An apparent T and G skew was discovered in all protein-coding genes (0.12, −0.49) and in the control region.
Table 1.
Structure of the Douhua chicken mitochondrial genome
| Gene | Potion | Size | Start codon | Stop codon | Anticodon | Space/overlap | Strand | C + G% |
|---|---|---|---|---|---|---|---|---|
| tRNA-Phe | 1–70 | 70 | GAA | / | H | 51 | ||
| 12s rRNA | 70–1,046 | 977 | −1 | H | 47 | |||
| tRNA-Val | 1,046–11,18 | 73 | UAC | −1 | H | 45 | ||
| 16s rRNA | 1,119–2,740 | 1,622 | 0 | H | 46 | |||
| tRNA-Leu | 2,742–2,815 | 74 | UAA | 1 | H | 51 | ||
| ND1 | 2,825–3,799 | 975 | ATG | TAA | 9 | H | 47 | |
| tRNA-Ile | 3,800–3,871 | 72 | GAU | 0 | H | 42 | ||
| tRNA-Gln | 3,877–3,947 | 71 | UUG | 5 | L | 34 | ||
| tRNA-Met | 3,947–4,015 | 69 | CAU | −1 | H | 48 | ||
| ND2 | 4,014–5,054 | 1,041 | ATG | TAG | −2 | H | 44 | |
| tRNA-Trp | 5,055–5,130 | 76 | UCA | 0 | H | 36 | ||
| tRNA-Ala | 5,137–5,205 | 69 | UGC | 6 | L | 41 | ||
| tRNA-Asn | 5,209–5,281 | 73 | GUU | 3 | L | 42 | ||
| tRNA-Cys | 5,283–5,348 | 66 | GCA | 1 | L | 44 | ||
| tRNA-Tyr | 5349–5418 | 70 | GUA | 0 | L | 43 | ||
| COX1 | 5,420–6,970 | 1,551 | GTG | AGG | 1 | H | 47 | |
| tRNA-Ser | 6,962–7,036 | 75 | UGA | −9 | L | 44 | ||
| tRNA-Asp | 7,039–7,107 | 69 | GUC | 2 | H | 41 | ||
| COX2 | 7,109–7,792 | 684 | ATG | TAA | 1 | H | 48 | |
| tRNA-Lys | 7,794–7,861 | 68 | UUU | 1 | H | 47 | ||
| ATP8 | 7,863–8,027 | 165 | ATG | TAA | 1 | H | 41 | |
| ATP6 | 8,018–8,701 | 684 | ATG | TAA | −10 | H | 49 | |
| COX3 | 8,701–9,484 | 784 | ATG | T - – | −1 | H | 49 | |
| tRNA-Gly | 9,485–9,553 | 69 | UCC | 0 | H | 38 | ||
| ND3 | 9,554–9,904 | 351 | ATG | TAA | 0 | H | 45 | |
| tRNA-Arg | 9,907–9,974 | 68 | UCG | 2 | H | 38 | ||
| ND4L | 9,975–10,271 | 297 | ATG | TAA | 0 | H | 47 | |
| ND4 | 10,265–11,642 | 1,378 | ATG | T - – | −7 | H | 46 | |
| tRNA-His | 11,643–11,711 | 69 | GUG | 0 | H | 36 | ||
| tRNA-Ser | 11,712–11,778 | 67 | GCU | 0 | H | 52 | ||
| tRNA-Leu | 11,779–11,849 | 71 | UAG | 0 | H | 38 | ||
| ND5 | 11,850–13,667 | 1,818 | ATG | TAA | 0 | H | 46 | |
| CYTB | 13,672–14,814 | 1,143 | ATG | TAA | 4 | H | 49 | |
| tRNA-Thr | 14,818–14,886 | 69 | UGU | 3 | H | 33 | ||
| tRNA-Pro | 14,887–14,956 | 70 | UGG | 0 | L | 43 | ||
| ND6 | 14,963–15,484 | 522 | ATG | TAA | 6 | L | 49 | |
| tRNA-Glu | 15,487–15,554 | 68 | UUC | 2 | L | 49 | ||
| Control region | 15,555–16,785 | 1,231 | 0 | H | 49 |
Figure 3.
Gene map of the Douhua chicken mitogenome.
Table 2.
Nucleotide compositions of each gene in the mitochondrial DNA
| Feature | T% | C% | A% | G% | A + T% | Total | AT-Skew | GC-Skew |
|---|---|---|---|---|---|---|---|---|
| ND6 | 9.8 | 39.1 | 41.4 | 9.8 | 51.2 | 522 | 0.62 | −0.60 |
| ND5 | 23.3 | 35.0 | 31.1 | 10.6 | 54.4 | 1,818 | 0.14 | −0.54 |
| ND4L | 24.6 | 35.0 | 27.9 | 12.5 | 52.5 | 297 | 0.06 | −0.47 |
| ND4 | 23.6 | 36.3 | 30.0 | 10.2 | 53.6 | 1,378 | 0.12 | −0.56 |
| ND3 | 26.7 | 32.4 | 27.8 | 13.1 | 54.5 | 351 | 0.02 | −0.42 |
| ND2 | 22.9 | 35.7 | 32.7 | 8.7 | 55.6 | 1,041 | 0.18 | −0.61 |
| ND1 | 25.3 | 34.8 | 27.2 | 12.7 | 52.5 | 975 | 0.04 | −0.47 |
| CYTB | 23.9 | 36.6 | 27.5 | 12.1 | 51.4 | 1,143 | 0.07 | −0.50 |
| COX3 | 22.7 | 33.4 | 27.9 | 15.9 | 50.6 | 784 | 0.10 | −0.35 |
| COX2 | 22.8 | 33.3 | 29.4 | 14.5 | 52.2 | 684 | 0.13 | −0.39 |
| COX1 | 25.7 | 31.1 | 27.3 | 15.9 | 53.0 | 1,551 | 0.03 | −0.32 |
| ATP8 | 24.2 | 36.4 | 34.5 | 4.8 | 58.7 | 165 | 0.18 | −0.77 |
| ATP6 | 22.5 | 38.6 | 28.9 | 9.9 | 51.4 | 684 | 0.12 | −0.59 |
| rRNA | 20.4 | 28.4 | 33.0 | 18.2 | 53.4 | 2,599 | 0.24 | −0.22 |
| tRNA | 24.3 | 25.1 | 32.5 | 18.0 | 56.8 | 1,615 | 0.14 | −0.16 |
| 13PCGs | 23.3 | 34.9 | 29.7 | 12.1 | 53.0 | 11,253 | 0.12 | −0.49 |
| Control region | 33.4 | 26.6 | 26.6 | 13.4 | 60.0 | 1,231 | −0.11 | −0.33 |
| mitogenome | 23.7 | 32.5 | 30.3 | 13.5 | 54.0 | 16,785 | 0.12 | −0.41 |
There were seven overlaps among the mitochondrial genes, with a total overlap of 30 bp, and the size of each overlap was between 1 and 10 bp. The longest overlap occurred in ATP8 and ATP6 genes, while the shortest overlap occurred in four different regions. Additionally, COXⅠ protein-coding genes overlapped with the adjacent tRNA-ser gene by nine nucleotides. This is a prevalent aspect of mitochondrial genes that are both reliable and economical (Gu and Li, 2020). Furthermore, there were 16 intergenic spacers in the Douhua chicken mitogenome, with a total number of spacers of 47 bp. Among those, the longest spacers were 6 bp and occurred in ND6 and tRNA-Pro (Table 1).
Protein‐coding genes and codon usage patterns
The total length of 13 protein-coding genes of was 11,392 bp in the Douhua chicken mitogenome, which accounted for 67.64% of the entire mitogenome sequence. The protein-coding genes regions of the Douhua chicken mitogenome comprised 3,750 codons in all. The initiation codon of COXI was GTG, and all other PCGs used ATG as the initiation codon (Table 1). TAA was the most common termination codon in the Douhua chicken mitogenome, which is similar to mitogenomes of other vertebrates. The termination codon of COXI and ND2 is AGG and TAG, respectively, possibly because the products were completed via posttranscriptional polyadenylation (Ojala et al., 1981). The total number of codons among 13 PCGs was 3797, among those amino acid codons, CUA (L; 2.19%), GCC(A; 1.97%), and CUC (L; 1.76%) were used frequently. The most frequently used amino acid in Douhua chicken was leucine. Conversely, codons UUG, UCG, GUG, and ACG, were barely used, accounting for only 0.6% of the amino acids (Table 3). Codons encoding Cys were the rarest, while those encoding Leu, Pro, and Thr occurred most frequently. Codons encoding Glu, Gln, Lys, Met, and Trp mainly contained T or A + T, while the Arg, Leu1, Pro, and Ser 2 codons had high G + C contents (Figure 5) . These codon compositions contribute to the A + T bias of the total Douhua chicken mitogenome in all probability (Figures 4 and 5).
Table 3.
Codon number and relative synonymous codon usage (RSCU) of the Douhua chicken mitochondrial protein-coding genes (PCGs)
| Codon | Count | RSCU | Codon | Count | RSCU | Codon | Count | RSCU | Codon | Count | RSCU |
|---|---|---|---|---|---|---|---|---|---|---|---|
| UUU(F) | 30 | 0.48 | UCU(S) | 45 | 0.97 | UAU(Y) | 37 | 0.72 | UGU(C) | 14 | 0.5 |
| UUC(F) | 95 | 1.52 | UCC(S) | 58 | 1.26 | UAC(Y) | 66 | 1.28 | UGC(C) | 42 | 1.5 |
| UUA(L) | 35 | 0.41 | UCA(S) | 59 | 1.28 | UAA(*) | 28 | 0.99 | UGA(W) | 60 | 1.45 |
| UUG(L) | 7 | 0.08 | UCG(S) | 4 | 0.09 | UAG(*) | 6 | 0.21 | UGG(W) | 23 | 0.55 |
| CUU(L) | 102 | 1.2 | CCU(P) | 195 | 1.63 | CAU(H) | 119 | 0.93 | CGU(R) | 8 | 0.29 |
| CUC(L) | 154 | 1.81 | CCC(P) | 149 | 1.24 | CAC(H) | 136 | 1.07 | CGC(R) | 44 | 1.61 |
| CUA(L) | 172 | 2.02 | CCA(P) | 115 | 0.96 | CAA(Q) | 102 | 1.59 | CGA(R) | 35 | 1.28 |
| CUG(L) | 41 | 0.48 | CCG(P) | 21 | 0.18 | CAG(Q) | 26 | 0.41 | CGG(R) | 22 | 0.81 |
| AUU(I) | 87 | 0.75 | ACU(T) | 106 | 1.28 | AAU(N) | 114 | 0.94 | AGU(S) | 23 | 0.5 |
| AUC(I) | 144 | 1.25 | ACC(T) | 102 | 1.23 | AAC(N) | 128 | 1.06 | AGC(S) | 88 | 1.91 |
| AUA(M) | 87 | 1.31 | ACA(T) | 105 | 1.27 | AAA(K) | 105 | 1.68 | AGA(*) | 40 | 1.42 |
| AUG(M) | 46 | 0.69 | ACG(T) | 18 | 0.22 | AAG(K) | 20 | 0.32 | AGG(*) | 39 | 1.38 |
| GUU(V) | 15 | 0.64 | GCU(A) | 22 | 0.56 | GAU(D) | 18 | 0.62 | GGU(G) | 12 | 0.39 |
| GUC(V) | 37 | 1.57 | GCC(A) | 80 | 2.04 | GAC(D) | 40 | 1.38 | GGC(G) | 45 | 1.45 |
| GUA(V) | 37 | 1.57 | GCA(A) | 51 | 1.3 | GAA(E) | 52 | 1.68 | GGA(G) | 51 | 1.65 |
| GUG(V) | 5 | 0.21 | GCG(A) | 4 | 0.1 | GAG(E) | 10 | 0.32 | GGG(G) | 16 | 0.52 |
Figure 5.
Relative synonymous codon usage (RSCU) of the Douhua chicken mitogenome displayed using amino acid classification. Codons are shown on the x-axis and RSCU values are shown on the y-axis.
Figure 4.
Codon distribution of the Douhua chicken mitogenome. The y-axis indicates the total number of codons and the x-axis Presents the codon families.
Transfer and ribosomal RNA genes
Altogether, the 22 tRNA genes with typical secondary structures were observed in the Douhua chicken mitogenome (Figure 3). The total length of the mitochondrial tRNA genes was 1,546 bp, and individual gene sizes were 66–76 bp (Table 1). Most of the tRNAs could convert to a canonical cloverleaf secondary structure, while the secondary structure of tRNA-Ser contained the TΨC arm and loop but lacked the DHU arm and loop (Figure 6). This is common in vertebrate mitogenomes and most of the anticodons were same as those observed in other chicken species (Jin et al., 2021).
Figure 6.
Secondary structure of 22 tRNAs. Most of the tRNAs could be folded into the canonical cloverleaf secondary structure, while the tRNA-Ser contains a predicted secondary structure with the TΨC arm and loop, but lacks the DHU arm and loop.
The ribosomal genes were identified in the Douhua chicken mitogenome, including location, length, and base composition. The 12S rRNA gene was located between tRNA-Phe and tRNA-Val, with a length of 977 bp. Additionally, the length of 16S RNA was 1,622 bp, and located between tRNA-Val and tRNA-Leu (Table 1, Figure 3). The rRNA base compositions were 20.4%T, 28.4%C, 33.0%A, and 18.2%G, with an A + T content of 53.4%.
Genetic variation and genetic diversity of complete D-loop region
The D-loop region was observed between tRNA-Glu and tRNA-Phe, with a sequence length of 1,231–1,232 bp in the entire genome (Table 1, Figure 3). The base composition in the D-loop region of Douhua chicken is 33.4% T, 26.6% C, 26.6%A, and 13.4% G. The variation is not randomly distributed in the chicken mtDNA genome. The D-loop region is the hot spot where mutation occurs most frequently (Huang et al., 2019). In total, the sample contained 60 complete D-loop fragments with 10 haplotypes and 27 mutations, including one site with alignment gaps or missing data and 26 polymorphic sites (Table 4). The haplotype and nucleotide diversity values were 0.829 (Hd) and 0.00441 (Pi), respectively. The genome was characterized by high haplotype diversity and low nucleotide diversities.
Table 4.
Variation loci of 10 haplotypes in Douhua chicken
| Haplotypes/sites | Hap-1 | Hap-2 | Hap-3 | Hap-4 | Hap-5 | Hap-6 | Hap-7 | Hap-8 | Hap-9 | Hap-10 |
|---|---|---|---|---|---|---|---|---|---|---|
| 167 | T | * | * | * | * | * | * | * | C | * |
| 193 | C | * | * | * | * | * | * | * | A | * |
| 212 | G | A | A | A | * | * | A | * | * | * |
| 217 | T | * | * | * | * | C | * | C | * | * |
| 220 | C | T | T | T | T | T | T | T | T | T |
| 225 | C | * | * | * | * | * | * | * | T | * |
| 238 | G | * | * | A | * | * | A | * | * | * |
| 239 | A | * | * | * | G | * | * | * | * | G |
| 242 | G | A | A | A | A | * | A | * | * | A |
| 243 | C | * | * | * | * | * | * | * | T | * |
| 256 | C | * | * | * | * | * | * | * | T | * |
| 261 | T | C | C | C | C | * | C | * | C | C |
| 281 | A | G | G | G | G | * | G | * | G | G |
| 302 | T | C | C | C | C | C | C | C | C | C |
| 306 | C | T | T | T | T | T | T | T | T | T |
| 310 | T | * | * | * | * | * | * | * | C | * |
| 342 | A | G | * | * | G | * | * | * | * | G |
| 361 | A | * | * | * | * | * | * | * | T | * |
| 363 | C | T | T | T | T | * | T | A | * | T |
| 367 | T | C | C | C | C | * | C | * | * | C |
| 391 | A | C | C | C | C | C | C | C | C | C |
| 446 | C | * | * | * | * | T | * | T | * | * |
| 852 | – | * | * | * | C | * | * | * | C | C |
| 946 | T | * | * | * | * | * | C | * | * | * |
| 960 | T | * | * | * | * | * | * | * | * | C |
| 964 | T | * | * | * | * | * | * | * | * | G |
| 1214 | C | * | * | * | * | T | * | T | * | * |
*Indicates identical nucleotides to the reference sequence (GU261704.1).
Phylogenetic relationships
Phylogenetic analyses were performed using the 1, 231 or 1, 232 nucleotide sites of the D-loop regions. The 22 sequences were selected as reference haplotypes from 13 haplogroups (A-I), and software was used to build an MJ-network with the 10 haplotypes found (Figure 7). The result revealed that the haplotypes were divided into four haplogroups (A,C,D, and E). Most of the haplotypes observed were classified into haplogroup C, while the other four haplotypes were distributed among haplogroup A, D, and E, suggesting that Douhua chicken may have four maternal origins and thus is less affected by foreign species. Haplogroup A may have originated in Yunnan and the surrounding areas, haplogroup C was mainly dispersed in Guangxi and Guangdong Provinces of China and Japan but vanished in south Asia, haplogroup D was mainly distributed from India, Indonesia, and Japanese and Chinese gamecocks, and the lineage of haplogroup E may have its roots in the Indian subcontinent (Liu et al., 2006; Liang et al., 2016).
Figure 7.
MJ-network of haplogroup. The black circles represent four haplotype group (A, C, D, E). Twenty-two reference sequences are presented (GU261695, AB086102, GU261704, GU261705, GU261701,GU261681, NC-007237, GU261683, GU261677, GU261713, HQ857210, GU261708, GU261711, GU261702, GU261678, GU261719, GU261715, GU261698, GU261706, GU261692, GU261693, and GU261696). The yellow circles indicate the Douhua chicken haplotypes. The red circles represent median vector.
The NJ-tree showed that all haplotypes are divided into two large branches (Figure 8). On the first branch, hap 6 and hap 8 were clustered with the Tengchongxue chicken and Gallus gallus spadiceus; hap 5, and hap10 clustered with the Nandan chicken, the Guangxi Partridge chicken, and the Huaibei native chicken; while hap 2, hap 3, hap 4, and hap 7 were clustered with the Huainan Partridge chicken. On the second branch, hap 1 and hap 9 were clustered with the Wanbei game chicken, Gallus gallus jabouillei, Gallus varius, and Gallus sonneratii.
Figure 8.
NJ-tree based on the D-loop region. Twenty typical chicken sequences and ten Douhua chicken haplotypes were used to construct the tree. The bootstrap value is 1,000.
Many studies now suggest that the domestic chicken may have originated from the Red junglefowl, which is consistent with Darwin's of origin hypothesis, and it is grouped in the Gallus genus together with the grey, green, and ceylonese junglefowls (Fumihito et al., 1996). The Red junglefowl also includes five subspecies: Gallus gallus gallus, Gallus gallus spadicius, Gallus gallus bankiva, Gallus gallus jabouillei, and Gallus gallus murgi. Other studies indicated that chickens likely originated from wild red junglefowl and genetic exchange with other junglefowl species (Nishibori et al., 2005; Eriksson et al., 2008).
According to the results of the MJ-network, the 10 haplotypes defined in this study can be divided into four haplogroups: A, C, D, and E, implying that Douhua chickens originated from four different maternal lineages. Meanwhile, the results of the NJ-tree matched those of other chicken species, indicating that Douhua chicken is closely related to the Red junglefowl, which is the direct ancestor of Douhua chicken. All chickens had a distant relationship with Grey and Green junglefowl. The results showed that Douhua chicken was closely related to Gallus gallus spadiceus, Gallus gallus murgha, and Gallus gallus bankiva which may have originated from Gallus gallus. The results indicated that there were at least four maternal origins, and the results of the phylogenetic tree cluster analysis were consistent with the results of the MJ-network.
Conclusion
In this study, the mitogenome sequences of Douhua chicken were identified and analyzed. The results indicated that the total length of the Douhua chicken mitogenome was 16,785 bp, and the organization and structures were identical to other breeds. According to the phylogenetic analysis, Douhua chickens displayed a high degree of polymorphism in the mitogenome D-loop region and possibly originated from four different maternal lineages. Meanwhile, it was observed that Douhua chicken is closely related to the Red junglefowl, which is its direct ancestor. This study provides reliable complete mitochondrial DNA genome information on Douhua chicken, which is of great significance for studying the genetic structure, evolution, and phylogeny of the population, protecting the genetic resources of Douhua chicken. In addition, this study provides an important theoretical basis for further studies on identifying the genetic relationships among the populations of poultry and tracing maternal origins using phylogenetic factors, which can be applied for geographic conservation, utilization, and molecular genetics.
Acknowledgments
We would like to thank Huangshan Xianghua Conservation and Breeding Co. Ltd., Anhui, China for providing assistance during the sample collection. We also kindly acknowledge anonymous reviewers for their fruitful and critical comments and editors for their editing support.
Glossary
Abbreviations
- bp
base pair(s)
- N
any nucleoside
- nt
nucleotide(s)
- rRNA
ribosomal RNA
- ʹ (prime)
denotes a truncated gene at the indicated side
Contributor Information
Sihua Jin, College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China; Anhui Provincial Key Laboratory of Local Animal Genetic Resources Conservation and Bio-breeding, Hefei 230036, China.
Yuqing Jia, College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China; Anhui Provincial Key Laboratory of Local Animal Genetic Resources Conservation and Bio-breeding, Hefei 230036, China.
Lijun Jiang, College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China.
Chengcheng Cao, College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China.
Yunfei Ding, College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China.
Taikang Zhang, College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China.
Xuling Liu, College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China.
Yongsheng Li, Huangshan Qiangying Duck Breeding Co. Ltd., Huanshan 245461, China.
Zhaoyu Geng, College of Animal Science and Technology, Anhui Agricultural University, Hefei 230036, China; Anhui Provincial Key Laboratory of Local Animal Genetic Resources Conservation and Bio-breeding, Hefei 230036, China.
Funding
This study was supported by the Program for Young Outstanding Scientists of University (gxyqZD2022017); Natural Science Foundation from Department of Anhui Provincial Education (2022AH050928); University-Industry Collaborative Education Program of Ministry of Education (221000488095409); Quality Project of Department of Education of Anhui Province (2021jxjy026); Jiangsu Provincial key Laboratory of Poultry Genetics and Breeding (JQLAB-KF-202101) and Guangdong Provincial key Laboratory of Animal Molecular Design and Precise Breeding (2019B01).
Conflict of Interest Statement
The authors declare that they have no conflicts of interest associated with for the present research.
Literature Cited
- Bandelt, H. J., Forster P., and Ro¨hl A.. . 1999. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 16:37–48. doi: 10.1093/oxfordjournals.molbev.a02603. [DOI] [PubMed] [Google Scholar]
- Bankevich, A., Nurk S., Antipov D., Gurevich A. A., Dvorkin M., Kulikov A. S., Lesin V. M., Nikolenko S. I., Pham S., Prjibelski A. D., . et al. 2012. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 19:455–477. doi: 10.1089/cmb.2012.0021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bernt, M., Bleidorn C., Braband A., Dambach J., Donath A., Fritzsch G., Golombek A., Hadrys H., Juhling F., Meusemann K., . et al. 2013a. A comprehensive analysis of bilaterian mitochondrial genomes and phylogeny. Mol. Phylogenet. Evol. 69:352–364. doi: 10.1016/j.ympev.2013.05.002. [DOI] [PubMed] [Google Scholar]
- Bernt, M., Donath A., Juhling F., Externbrink F., Florentz C., Fritzsch G., Putz J., Middendorf M., and Stadler P. F.. . 2013b. MITOS: improved de novo metazoan mitochondrial genome annotation. Mol. Biol. Evol. 69:313–319. doi: 10.1016/j.ympev.2012.08.023. [DOI] [PubMed] [Google Scholar]
- Chan, P. P., and Lowe T. M.. . 2019. tRNAscan-SE: searching for tRNA genes in genomic sequences. Methods Mol. Biol. 1962:1–14. doi: 10.1007/978-1-4939-9173-0_1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Clayton, D. A. 2000. Transcription and replication of mitochondrial DNA. Hum. Reprod. 15:11–17. doi: 10.1093/humrep/15.suppl_2.11. [DOI] [PubMed] [Google Scholar]
- Eriksson, J., Larson G., Gunnarsson U., Bed’hom B., Tixier-Boichard M., Stromstedt L., Wright D., Jungerius A., Vereijken A., Randi E., . et al. 2008. Identification of the yellow skin gene reveals a hybrid origin of the domestic chicken. PLoS Genet. 4:e1000010. doi: 10.1371/journal.pgen.1000010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. 39:783–791. doi: 10.1111/j.1558-5646.1985.tb00420.x. [DOI] [PubMed] [Google Scholar]
- Fumihito, A., MiyakeI T., Takada M., Shingu R., Endo T., Gojobor T., Kondo N., and Ohno S.. 1996. Monophyletic origin and unique dispersal patterns of domestic fowls. P Natl. Acad Sci. USA. 93:6792–6795. doi: 10.1073/pnas.93.13.6792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gu, J. J., and Li S.. . 2020. The complete mitochondrial genome of the Luhua chicken (Gallus gallus). Mitochondrial DNA B Resour. 5:2832–2834. doi: 10.1080/23802359.2020.1791021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guo, H. W., Li C., Wang X. N., Li Z. J., Sun G. R., Li G. X., Liu X. J., Kang X. T., and Han R. L.. . 2017. Genetic diversity of mtDNA D-loop sequences in four native Chinese chicken breeds. Brit. Poultry Sci. 58:490–497. doi: 10.1080/00071668.2017.1332403. [DOI] [PubMed] [Google Scholar]
- Hoque, M. R., Seo D. W., Jo C., Gotoh T., and Lee J. H.. . 2013. Reconstruction of phylogenetic relationships of Korean chickens using mitochondrial D‒loop sequences. J Fac. Agr. Kyushu Univ. 58:287–293. [Google Scholar]
- Huang, Y., Lu W., Ji J., Zhang X., Zhang P., and Chen W.. . 2019. Heteroplasmy in the complete chicken mitochondrial genome. PLoS One. 14:e0224677. doi: 10.1371/journal.pone.0224677. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jin, S. H., Zang H., He P. L., Jiang T. T., Pan S. Q., and Geng Z. Y.. . 2021. Complete mitochondrial genome and phylogenetic analysis of Huangshan Black chicken (Gallus gallus). Mitochondrial DNA B Resour. 6:243–244. doi: 10.1080/23802359.2020.1860694. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kumar, S., Stecher S., and Tamura K.. . 2016. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33:1870–1874. doi: 10.1093/molbev/msw054 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lan, D., Hu Y., Zhu Q., and Liu Y.. . 2017. Mitochondrial DNA study in domestic chicken. Mitochondrial DNA A DNA Mapp. Seq. Anal. 28:25–29. doi: 10.3109/19401736.2015.1106526. [DOI] [PubMed] [Google Scholar]
- Liang, Y., Kang L., Cui J. X., Lv X. M., Yang N., and Zhang X. Q.. . 2016. The Frequencies of chicken mtDNA D-loop haplotype clades and multiple maternal origins of Chinese domestic chicken. Chin. J. Anim. Vet. Sci. 47:2342–2353. [Google Scholar]
- Liu, Y. P., Wu G. S., Yao Y. G., Miao Y. W., Luikart G., Baig M., Beja-Pereira A., Ding Z. L., Palanichamy M. G., and Zhang Y. P.. . 2006. Multiple maternal origins of chickens: out of the Asian jungles. Mol. Biol. Evol. 38:12–19. doi: 10.1016/j.ympev.2005.09.014. [DOI] [PubMed] [Google Scholar]
- Liu, L. L., Xie H. B., Yang Y. S., Yu Q. F., and He J. H.. . 2014. The complete mitochondrial genome of the Xuefeng black-boned chicken. Mitochondrial DNA Part A. 27:30–31. doi: 10.3109/19401736.2013.869679. [DOI] [PubMed] [Google Scholar]
- Lu, G. Q. 2004. Vector NTI, a balanced all-in-one sequence analysis suite. Brief. Bioinform. 5:378–388. doi: 10.1093/bib/5.4.378. [DOI] [PubMed] [Google Scholar]
- Miao, Y. W., Peng M. S., Wu G. S., Ouyang Y. N., Yang Z. Y., Yu N., Liang J. P., Pianchou G., Beja-Pereira A., Mitra B., . et al. 2013. Chicken domestication: an updated perspective based on mitochondrial genomes. Heredity (Edinb). 110:277–282. doi: 10.1038/hdy.2012.83. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nishibori, M., Shimogiri T., Hayashi T., and Yasue H.. . 2005. Molecular evidence for hybridization of species in the genus Gallus except for Gallus varius. Anim. Genet. 36:367–375. doi: 10.1111/j.1365-2052.2005.01318.x. [DOI] [PubMed] [Google Scholar]
- Ojala, D., Montoya J., and Attardi G.. . 1981. tRNA punctuation model of RNA processing in human mitochondria. Nature. 290:470–474. doi: 10.1038/290470a0. [DOI] [PubMed] [Google Scholar]
- Perna, N. T., and Kocher T. D.. . 1995. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J. Mol. Evol. 41:353–358. doi: 10.1007/BF00186547. [DOI] [PubMed] [Google Scholar]
- Rozas, J., Sanchez-DelBarrio J. C., Messeguer X., and Rozas R.. . 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics. 19:2496–2497. doi: 10.1093/bioinformatics/btg359. [DOI] [PubMed] [Google Scholar]
- Sacconea, C., Gissid C., Lanavea C., Larizzab A., Pesoled G., and Reyesa A.. . 2000. Evolution of the mitochondrial genetic system: an overview. Genes. 261:150–159. doi: 10.1016/S0378-1119(00)00484-4. [DOI] [PubMed] [Google Scholar]
- Stothard, P., Grant J. R., and Van Domselaar G.. . 2019. Visualizing and comparing circular genomes using the CGView family of tools. Brief. Bioinform. 20:1576–1582. doi: 10.1093/bib/bbx081. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang, M., Wang L., Wang C. Q., Wan S. H., Wang H., Sun J. Y., Tang J. Q., Zhang X. C., Zhang H. J., Li J., . et al. 2019. Complete mitochondrial genome of the Partridge Shank chicken (Galliformes: Phasianidae). Mitochondrial DNA B Resour. 4:3298–3300. doi: 10.1080/23802359.2019.1673232. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu, W., Jameson D., Tang B., and Higgs P. G.. . 2006. The relationship between the rate of molecular evolution and the rate of genome rearrangement in animal mitochondrial genomes. J. Mol. Evol. 63:375–392. doi: 10.1007/s00239-005-0246-5. [DOI] [PubMed] [Google Scholar]
- Zang, H., Wang Y., Yang H. H., He P. L., Pan S. Q., Geng Z. Y., and Science S. H. J. B. P.. . 2020. Characterisation of the complete mitochondrial genome, genetic diversity and maternal origin of Huainan Partridge chicken. Brit Poultry Sci. 62:320–327. doi: 10.1080/00071668.2020.1855628. [DOI] [PubMed] [Google Scholar]
- Zhang, T., Liu H., Yang L. K., Yin Y. J., Lu H. Z., and Wang L.. . 2018. The complete mitochondrial genome and molecular phylogeny of Lueyang black-bone chicken. Brit Poultry Sci. 59:618–623. doi: 10.1080/00071668.2018.1514581. [DOI] [PubMed] [Google Scholar]








