KEY RESOURCES TABLE.
REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
| ||
Antibodies | ||
| ||
Mouse anti-LAMPI (H4A3) | Santa Cruz Biotechnology | Cat#sc-20011; RRID:AB_626853 |
Rat anti-LAMPI (1D4B) | Santa Cruz Biotechnology | Cat#sc-19992; RRID:AB_2134495 |
Mouse anti-cathepsin D (C-5) | Santa Cruz Biotechnology | Cat#sc-377124 |
Mouse anti-Vps41 (D-12) | Santa Cruz Biotechnology | Cat#sc-377118; RRID:AB_2687987 |
Mouse anti-Arl8a/b (H-8) | Santa Cruz Biotechnology | Cat#sc-398635 |
Mouse anti-Vps39 (C-5) | Santa Cruz Biotechnology | Cat#sc-514762; RRID:AB_2687985 |
Mouse anti-CD71 (H68.4) | Santa Cruz Biotechnology | Cat#sc-65882; RRID:AB_1120670 |
Rabbit anti-cathepsin D | Sigma Aldrich | Cat#219361; RRID:AB_10683361 |
Rabbit anti-lyspersin | Abcam | Cat#ab247064 |
Rabbit anti-Rab7a | Abcam | Cat#ab137029; RRID:AB_2629474 |
Rabbit anti-myrlysin | Proteintech | Cat#17169-1-AP; RRID:AB_2137150 |
Rabbit anti-Rab2 | Proteintech | Cat#15420-1-AP; RRID:AB_2176874 |
Rabbit anti-Arl8b | Proteintech | Cat#13049-1-AP; RRID:AB_2059000 |
Rabbit anti-Vps39 | Proteintech | Cat#16219-1-AP; RRID:AB_11043179 |
Rabbit anti-Vps33a | Proteintech | Cat#16896-1-AP; RRID:AB_2214916 |
Rabbit anti-EEA1 | Thermo Scientific | Cat#MA5-14794; RRID:AB_10985824 |
Mouse anti-Histidine tag | Biorad | Cat#MCA 1396; RRID:AB_322084 |
Rabbit anti-Rab7a | T. Watts (University of Toronto, Toronto, ON, Canada), Bertram et al.58 | N/A |
| ||
Chemicals, peptides, and recombinant proteins | ||
| ||
Ferrofluid (EMG508) | Ferrotec | N/A |
Polybead Carboxylate 1.0 micron microspheres | Polysciences | Cat#08226-15 |
Polybead Carboxylate 2.0 micron microspheres | Polysciences | Cat#18327 |
ATTO488 NHS-ester | ATTO-TEC | Cat#AD488-35 |
Brefeldin A | Santa Cruz Biotechnology | Cat#sc-200861 |
N-ethylmaleimide | Sigma Aldrich | Cat#E3876 |
Nocodazole | Sigma Aldrich | Cat#M1404 |
Dynarrestin | Sigma Aldrich | Cat#SML2332 |
Hoechst 33342 | Immunochemistry technologies LLC | Cat#639 |
Amino dextran 10 kDa | Invitrogen | Cat#D1860 |
Syto13 | Invitrogen | Cat#S7575 |
Lysotracker Red DND-99 | Invitrogen | Cat#L7528 |
Opti-mem I Reduced Serum Medium | Gibco | Cat#31985070 |
Dulbecco’s modified Eagle medium (DMEM) | Gibco | Cat#31053-028 |
Sodium pyruvate | Gibco | Cat#11360-070 |
Penicillin-Streptomycin 10000 U/mL (PenStrep) | Gibco | Cat#15140-122 |
Fetal bovine serum Standard (FBS) | Pan Biotech | Cat#P30-3306 |
| ||
Experimental models: Cell lines | ||
| ||
HeLa WT cells | Pu et al.14 | N/A |
HeLa Arl8b KO cells | Guardia et al.19 | N/A |
HeLa Arl8a Arl8b KO cells | Keren-Kaplan et al.18 | N/A |
HeLa Vps41 KO cells | Anderson et al.59 | N/A |
HeLa myrlysin KO cells | Pu et al.14 | N/A |
HeLa diaskedin KO cells | Jia et al.20 | N/A |
HeLa Rab7a KO cells | This paper | N/A |
J774E macrophage-like cells | P.D. Stahl (Washington University, St. Louis, USA), Fiani et al.60 | N/A |
| ||
Oligonucleotides | ||
| ||
Mission siRNA universal negative control #1 | Sigma Aldrich | Cat#SICO01-10NMOL |
Custom siRNA, human Rab2a (5′–3′): GAAGGAGUCUUUGACAUUA[dT][dT]–3′ |
This paper, sequence derived from Lörincz et al.27 | N/A |
Custom siRNA, mouse Vps41 (5′–3′): UUGGCUUAUUUAGUUAGCAAA[dT][dT] | This paper | N/A |
Custom siRNA, mouse Rab7a (5′–3′): CCAUCAAACUGGACAAGAA[dT][dT]–3′ | This paper | N/A |
Primer Arl8b forward (5′–3′) TAAGCACTCGAGATGCTGGCGCTC ATCTCC–3′ |
This paper | N/A |
Primer Arl8b reverse (5′–3′) TGCTTACCGCGGGCTTCTTCTAGAT TTTGAATGCTGA |
This paper | N/A |
SgRNA human Rab7a: UGAAUUUCUUAUUCACAUAC |
Synthego | N/A |
| ||
Recombinant DNA | ||
| ||
pET45b(+)-hArl8b T34N | M. Sharma (Department of Biological Sciences, Indian Institute of Science Education and Research | N/A |
Mohali, Punjab, India), Khatter et al.7 | ||
pET45b(+)-hArl8b Q75L | M. Sharma, Khatter et al.7 | N/A |
pGEX4T3-hArl8b | M. Sharma, Khatter et al.7 | N/A |
pmCherry-N1-hArl8b | This paper | N/A |
pmCherry-N1 | D. Fürst (Cell Biology Institute, University of Bonn, Germany) | N/A |
peGFP-C1-Rab7a T22N | B. van Deurs (University of Copenhagen, Copenhagen, Denmark). Bucci et al.8 | N/A |
| ||
Software and algorithms | ||
| ||
ImageJ | Schneider et al.61 | https://imagej.nih.gov/ij/ |
Image J plugin JACoP | Bolte and Cordelieres62 |
https://imagej.nih.gov/ij/plugins/
track/jacop.html |
Image J plugin oval profile | Bill O’Connell |
https://imagej.nih.gov/ij/plugins/
oval-profile.html |
GraphPad Prism 9 | GraphPad Software |
https://www.graphpad.com/
scientific-software/prism/ |
MathCad 14 | PTC | N/A |