KEY RESOURCES TABLE.

REAGENT or RESOURCE	SOURCE	IDENTIFIER

Antibodies

Mouse monoclonal anti-NeuN, clone A60	Millipore	Cat# MAB377; RRID:AB_2298772
Rabbit polyclonal anti-IBA1	FUJIFILM Wako Shibayagi	Cat# 016-26721; RRID:AB_2811160
Guinea pig polyclonal anti-GFAP	Synaptic Systems	Cat# 173 004; RRID:AB_10641162
Mouse monoclonal anti-MAP2	Sigma Aldrich	Cat# M1406; RRID:AB_477171
Rabbit polyclonal TurboGFP	Thermo Fisher	Cat# PA5-22688; RRID:AB_2540616
Mouse monoclonal anti-NeuN-AlexaFluor488, clone A60	Millipore	Cat# MAB377X; RRID:AB_2149209
Rabbit polyclonal anti-5hmC	Active Motif	Cat# 39769; RRID:AB_10013602

Chemicals, peptides, and recombinant proteins

TSA Plus Cyanine 3	Akoya Biosciences	SKU NEL744001KT
Superscript II	Thermo Fisher	18064-014
KAPA HiFi Hotstart	Kapa Biosystems	KK2601
Ampure XP Beads	Beckman Coulter	A63881
Tamoxifen	Sigma Aldrich	T5648
Poly-L-lysine hydrobromide	Sigma Aldrich	P6282
Protein A magnetic beads	NEB	S1425S
Proteinase K	Sigma Aldrich	03115879001

Critical commercial assays

RNAScope Multiplex Fluorescent Reagent Kit V2	ACD Bio	323100
RNA-Protein Co-Detection Ancillary Kit	ACD Bio	323180
Papain dissociation system	Worthington	LK003153
RNeasy Kit	Qiagen	74104
High-Capacity cDNA Reverse Transcription kit	Thermo Fisher	4374966
KAPA Sybr Fast qPCR Kit	Kapa Biosystems	KK4601
Nextera Kit	Illumina	FC-131-1096
qPCR Library Quantification Kit	Kapa Biosystems	KK4824
End-It DNA End-Repair Kit	Lucigen	ER0720
NEB Ultra DNA Library Kit	NEB	E7805S

Deposited data

RNA-Seq Data	This paper	GEO: GSE171295
Tet2 OE hMeDIP-Seq	This paper	GEO: GSE198910
Tet2 cKO hMeDIP-Seq	This paper	GEO: GSE199597

Experimental models: Organisms/strains

Mouse: C57BL/6J	The Jackson Laboratory	RRID:IMSR_JAX:000664
Mouse: Tet2^flox/flox (B6;129S-Tet2tm1.1Iaai/J)	The Jackson Laboratory	RRID:IMSR_JAX:017573
Mouse: CamKIIa-CreERT2 (B6;129S6-Tg(Camk2a-cre/ERT2)1Aibs/J)	The Jackson Laboratory	RRID:IMSR_JAX:012362

Oligonucleotides

Tet2 RNAScope probe	ACD Bio	511591
shTet2-C targeting sequence: GAATGTAACCTTGATTGTTAT	This paper	N/A
shTet2-D targeting sequence: ACCACACTCGATGCGGTATTTC	This paper	N/A
shLuc targeting sequence: GCCATTCTATCCTCTAGAGGA	This paper	N/A
Nextera Index Kit Set A	Illumina	FC-131-1002
Smart-Seq2 poly-dT anchored oligonucleotide: AAGCAGTGGTATCAACGCAGAGTACT(30)VN	Picelli et al. (2014)	N/A
TSO primer: AAGCAGTGGTATCAACGCAGAGT ACATrGrG + G	Picelli et al. (2014)	N/A
Smart-Seq2 PCR Primer: AAGCAGTGGTATCA ACGCAGAGT	Picelli et al. (2014)	N/A
NEBNext Multiplex Oligos for Illumina (Set 1)	NEB	E7335L
qPCR primer sequences	Gontier et al. (2018); This paper	Table S4

Recombinant DNA

pGreenPuro shRNA expression lentivector (CMV)	System Biosciences	SI505A-1
pGreenPuro-shTet2-C	This paper	N/A
pGreenPuro-shTet2-D	This paper	N/A
pGreenPuro-shLuc	This paper	N/A
pENTR-D-TOPO	Thermo Fisher	K240020
Synapsin-GFP lentivirus		N/A
psPax2	Addgene	Addgene plasmid # 12260; RRID:Addgene_12260
pCMV-VSV-G	Addgene; Stewart et al. (2003)	Addgene plasmid # 8454; RRID:Addgene_8454

Software and algorithms

STAR v2.7.3a	Dobin et al. (2013)	https://github.com/alexdobin/STAR
RSEM v1.3.1	Li and Dewey, 2011	https://github.com/deweylab/RSEM
R v4.0.2	R Core Team, 2022	https://www.r-project.org/
DESeq2 v1.28.1	Love et al. (2014)	https://bioconductor.org/packages/release/bioc/html/DESeq2.html
Galaxy	Afgan et al. (2018)	www.usegalaxy.org
Bowtie 2	Langmead and Salzberg, 2012	https://github.com/BenLangmead/bowtie2
MACS2	Feng et al., 2012	https://github.com/macs3-project/MACS
PANTHER	The Gene Ontology Consortium	http://geneontology.org
Graphpad Prism 6.0	Graphpad Software	https://www.graphpad.com