Skip to main content
NCBI home page
Ecology and Evolution logoLink to Ecology and Evolution
. 2023 Mar 23;13(3):e9913. doi: 10.1002/ece3.9913

Callicarpa stoloniformis (Lamiaceae), a new species from Southeast China based on morphological characters and phylogenetic evidence

Zhonghui Ma 1, Xiangxiu Su 2, Huimin Cai 1, Zhiwei Su 3,✉, Bin Chen 4,✉
PMCID: PMC10034482  PMID: 36969937

Abstract

Callicarpa stoloniformis sp. nov. (Lamiaceae) is described as a new species from Fujian Province of China on the basis of both morphological and molecular data. The new species is morphologically most close to C. hainanensis. However, it can be distinguished from the latter by its unique procumbent life form, adventitious roots at nodes, papery leaves, cup‐shaped or campanulate calyx, truncate or shallow fissure calyx lobes, and smaller fruits. In addition, the new species is also similar with C. basitruncata, a species only known from the original description and the photograph of holotype, but it can differ from the latter by its procumbent shrub, purple terete branchlets with apparent linear lenticels, adventitious roots at nodes, and papery larger leaves with prominently cordate leaf base. Original photographs, illustration, distribution map, and a comparative morphological table, as well as an identification key of the related taxa are provided.

Keywords: Callicarpa, Lamiaceae, morphology, phylogenetic analysis

Callicarpa stoloniformis sp. nov. (Lamiaceae) is described as a new species from Fujian Province of China on the basis of both morphological and molecular data. Unique procumbent life form and adventitious roots at nodes make it distinctly different from other species in Callicarpa.

graphic file with name ECE3-13-e9913-g001.jpg

1. INTRODUCTION

Callicarpa L. (Linnaeus, 1753: 111, Lamiaceae) with her nickname “beauty berry” is mainly distributed in tropical, subtropical, and temperate Asia, America, Australia, and some Pacific Islands (Bramley, 2009, 2013; Harley et al., 2004). There are about 140 species of Callicarpa recorded around the world, with 33 species recognized in the New World, particularly in the Caribbean Islands (24 species in Cuba). Obviously, the genus is more species‐rich in the Old World, which was inferred as the origin center by the newest molecular phylogeny (Liu et al., 2022). Specifically, ca. 48 species were recognized in Temperate Asia, particularly in China (45 species and 12 varieties, Bramley, 2009, 2013; Ma, 2013). In addition, there were ca. 51 species recorded in Malesia, seven species in Australia (Munir, 1982), three species in the Pacific, and one species in Madagascar (Moldenke, 1950). Callicarpa has a long history as a member of Verbenaceae after being assigned by Robert Brown (1810). Based on numerous morphological and molecular phylogenetic studies, Callicarpa was transferred to Lamiaceae, along with several other genera, such as Premna L. (Linnaeus, 1771: 154) and Tectona L. (Linnaeus, 1753: 151) (Harley et al., 2004). Recently, evidences from palynology (Ma et al., 2016) and molecular phylogeny (Li et al., 2016; Zhao et al., 2021) further corroborated the sister relationship between Callicarpa and the Australian endemic subfamily Prostantheroideae, and then, a new subfamily Callicarpoideae was established (Li et al., 2016; Zhao et al., 2021).

Attempts to make a more scientific infrageneric classification for Callicarpa have been based on various morphological characters. According to calyx characters, Briquet (1895) divided the genus into two different groups: section Tubulosae, defined by tubular calyx with deeply 4‐fid rim, and long, generally foliaceous lobes; section Cyathimorphae, characterized by campanulate or cyathiform calyx with a subtruncate and entire or only shortly 4‐(or 5‐) toothed rim. Subsequently, Chang (1951) found some examples that fell between Briquet's groups during his investigation of Chinese species. Then, he divided Callicarpa into two sections based on stamen features: section Eucallicarpa and section Verticirima. The former was characterized by small, ovate, longitudinally dehiscent anthers, with filaments twice or more than twice as long as the corolla. The latter was defined by its larger oblong anthers and filaments that are not longer than the corolla. Afterward, when compiling Flora Reipublicae Popularis Sinicae, Fang (1982) divided Callicarpa into two subgenera based on hair types: Subgen. Peiantha, composed of a single taxon, C. peichieniana (1982: 78), which was characterized by strongly curved stem hair; while other species with various hair types were assigned to Subgen. Callicarpa. In recent years, evidences from morphology, palynology, and molecular phylogeny have proved that there was a sister relationship between Callicarpa and subfamily Prostantheroideae endemic in Australia and both formed a basal clade in Lamiaceae (Cai et al., 2021; Li et al., 2016; Ma, 2013; Ma et al., 2015; Ma & Su, 2015; Ma & Zhang, 2012; Zhao et al., 2021). Recently, more comprehensive phylogenic studies on the framework of Lamiaceae suggested establishing a new monotypic subfamily Callicarpoideae (Zhao et al., 2021). Liu et al. (2022) combined the analysis of phylogeny, biogeography, and statistics, and revealed that the fruit color of Callicarpa was strongly associated with geographical distribution. Besides, they also suggested all fruit colors of the genus were involved in dispersal events, and inferred violet fruit promoted diversification in Callicarpa and drove the evolution and diversity of different fruit colors between regions. In Asia, a number of Callicarpa are valued traditional medicinal plants and several of them, such as C. formosana (Trimen et al. 1882: 358), C. macrophylla (Vahl & Forssk, 1794: 13), C. kwangtungensis (Chun, 1934: 302), and C. nudiflora (Hooker et al. 1841: 206) have been intensively studied and included in Chinese Pharmacopoeia (2020 edition). Furthermore, drug products of them are widely used in clinical (eg. Luo Hua Zi Zhu Pian, Kang Gong Yan Pian, Fu Yan Ning Jiao Nang, Wu et al., 2018). Chinese Pharmacopoeia Commission, (2020).

As part of our ongoing taxonomic revision of Callicarpa in China, some interesting specimens were collected from Neikengkou, Nanjing County (Fujian Province, China). After examination of the floras or monographs from China and the adjacent Asian regions (Bramley, 2009, 2013; Chen & Gilbert, 1994; Fang, 1982; Leeratiwong et al., 2009; Ma, 2013), as well as analysis of herbarium specimens, our discovered plants cannot be placed in none of the current known species of Callicarpa. Based on morphological and molecular phylogenetic data, we decided to propose the newly collected plants as a new species.

2. MATERIALS AND METHODS

2.1. Morphology

Field surveys of the putative new species were carried out in Neikengkou, Nanjing County, Zhangzhou City, Fujian Province, during the period of June–December 2021. Syndromes of the habitat, life form, hairs, leaves, cyme, and fruit were surveyed with naked eyes or a hand magnifier and photographs were taken in the field. Detailed characters of glandular, hair, floral anatomy, ovary, and seed were observed with stereomicroscope (NIKON SMZ25) in the laboratory. Examination of specimens was also made for morphological comparison with the related species (herbaria visited: GAUA, IBSC, PE, CSH, IBK, NY, G, E, A, P, TI, and K; acronyms according to Thiers, 2022). The size of leaves, cymes, flowers, and fruits was measured with a vernier caliper in the laboratory. All voucher photos of the putative new species were deposited in the “Chinese Field Herbarium” (https://www.cfh.ac.cn/album/ShowSpAlbum.aspx?spid=94377).

2.2. Molecular phylogeny

A total of 14 species representing the main sections, subsections, and series of Chinese Callicarpa were selected for molecular phylogenetic analyses with two species from Prostantheroideae: Dasymalla teckiana (Conn et al. 2011: 6) and Dicrastylis parvifolia (Mueller, 1861: 160) as the outgroups. Total DNA was extracted from fresh leaves dried with silica gel using a modified CTAB method (Doyle & Doyle, 1987). Two nuclear [internal transcribed spacer (ITS) and external transcribed spacer (ETS)] and five chloroplast (matK, rpl32‐trnL, trnH‐psbA, psbJ‐petA, and trnS‐trnG intergenic spacer) regions were chosen for phylogenetic analyses. PCR amplification, sequencing, sequence editing, and sequence assembly were performed according to Katoh and Standley (2013) and Kumar et al. (2016). The primer pairs used for PCR were shown in Table 1. Detailed information on the DNA regions and GenBank accession numbers of the species investigated in this study were shown in Table 2.

TABLE 1.

Primers used for phylogenetic analyses.

Marker Primer Sequence (5′ to 3′) References
ITS 17SE ACGAATTCATGGTCCGGTGAAGTGTTCG Sun et al. (1994)
26SE TAGAATTCCCCGGTTCGCTCGCCGTTAC
ETS 18S‐IGS GAGACAAGCATATGACTACTGGCAGGATCAACCAG Baldwin and Markos (1998)
ETS‐B ATAGAGCGCGTGAGTGGTG Beardsley and Olmstead (2002)
matK 323f ATTNTCAAATCNTAKCAGAGGGG Andersson (2006)
1189r CGGCTTACTAATRGGATGCCC
rpl32‐trnL trnL(UAG) CTGCTTCCTAAGAGCAGCGT Shaw et al. (2007)
rpL32‐F CAGTTCCAAAAAAACGTACTTC
trnH‐psbA psbA F GTTATGCATGAACGTAATGCTC Sang et al. (1997)
trnH2 CGCGCATGGTGGATTCACAATCC Tate and Simpson (2003)
psbJ‐petA psbJ ATAGGTACTGTARCYGGTATT Shaw et al. (2007)
petA AACARTTYGARAAGGTTCAATT
trnS‐trnG trnS (GCU) AGATAGGGATTCGAACCCTCGGT Shaw et al. (2005)
5′trnG2S TTTTACCACTAAACTATACCCGC
Open in a new tab

TABLE 2.

Information of voucher and GenBank accession numbers for sequence data.

Taxon Coll. No. Collector(s) Location ETS ITS matK psbJ‐petA rpl32‐trnL trnG(UCC)‐trnS (GCU) trnH‐psbA
C. japonica 14294 K‐LCD_1934‐12904 Bramley et al. Thailand ON931539 ON820162 OP032150 OP032157 OP081587 OP032168 OP032163
C. brevipes MZH44 ZHM0130 Zhonghui Ma Dalin mountain, Guangdong, China ON931491 ON820123 OP032115 OM460815 OP081586 OP032173 OP032167
C. hainanensis MZH22 ZHM079 Zhonghui Ma South China Botanical Garden, China OM307542 OM333849 OM630173 OM460810 OM501619 OM403845 OM473350
C. longipes MZH9 ZHM085 Zhonghui Ma Nankun mountain, Guangdong, China OM307549 OM333856 OM630178 OM460805 OM501625 OM403851 OM473340
C. integerrima var. chinensis MZH19 8887 X.X. Huang Jiulian mountain, Jiangxi, China OM307530 OM333838 OM630183 OM460802 OM501631 OM403857 OM473347
C. rubella MZH6 ZHM089 Zhonghui Ma Wutong mountain, Guangdong, China OM307557 OM333864 ON964474 OP032159 OM530212 OM403906 OM473339
C. stoloniformis 02816 02816 Xiangxiu Su Nanjing County, Fujian, China OP032174 OP030615 OP032175 OP032176 OP032177 OP032178 OP032179
C. poilanei 23,191 2596 Suddee et al. Ubon Ratchathani, Nam Yuen dist, Thailand OM307603 OP135611 OM530154 OM439786 OM501603 OM403827 OM439784
C. arborea MZH42 ZHM099 Zhonghui Ma Xishuangbanna, Yunnan, China ON931488 ON820119 OP032112 OP032161 OP081584 OP032171 OM489764
C. candicans MZH20 LB0162 Bo Li Hainan, China OM307537 OM333844 OM630169 OM460814 OM501614 OM403840 OM473348
C. giraldii MZH12 LB0233 Bo Li Yunnan, China ON931499 ON820130 OP032121 OP032160 OP081585 OP032170 OP032165
C. nudiflora MZH69 ZHM0155 Zhonghui Ma Bawanglin, Hainan, China OM307553 OM333860 OM630181 OM460801 OM501629 OM403855 OM489771
C. longifolia MZH43 ZHM0117 Zhonghui Ma Xishuangbanna, Yunnan, China ON931514 OM333855 OP032131 OP032162 OP081583 OP032172 OP032166
C. pentandra 25,527 SAN147213 Bramley et al. Bombalai Hill, Malaysia ON931526 ON820150 OP032141 OP032158 OP081588 OP032169 OP032164
Dasymalla teckiana

Australian National Botanic

Gardens (ANBG), Australia

 # # NC_058334 NC_058334 NC_058334 NC_058334 NC_058334
Dicrastylis parvifolia Australian National Botanic Gardens (ANBG), Australia # GQ381162 NC_058335 NC_058335 NC_058335 NC_058335 NC_058335
Open in a new tab

Maximum likelihood (ML) and Bayesian inference (BI) were conducted for the phylogenetic analyses by IQ‐TREE (Nguyen et al., 2015) and MrBayes (Ronquist et al., 2012) in Phylosuite v1.2.2 (Zhang et al., 2020) and MrBayes on XSEDE3.2.7a as implemented in CIPRES (http://www.phylo.org/) (Miller et al., 2010) respectively. The bootstrap (BS) percentage for each branch was estimated by running 1000 bootstrap replicates. For BI analysis, ModelFinder (Kalyaanamoorthy et al., 2017) was used for the selection of the most appropriate evolutionary model (nucleotide substitution model) (Edge‐linked) using BIC criterion. The best partition models with BIC criterion were as follows: for ETS and ITS, HKY + F + G4; for matK, psbJ‐petA, rpl32‐trnL and trnG‐trnS intergenic spacer, GTR + F + G4; for trnH‐psbA intergenic spacer, F81 + F. The run with 1,000,000 generations was conducted. Four Markov chains with two runs were implemented and sampled every 100 generations, and the first 25% of all trees were regarded as “burn‐in”. The majority consensus of the remaining trees was generated to show posterior probability (PP) support for clades. Stationarity was determined in Tracer v1.7.1 (Rambaut et al., 2018) and was considered to be attained when ESS > 200 or when the average standard deviation of the split frequencies was <0.01.

3. RESULTS

3.1. Morphology

The putative new species is similar to Callicarpa hainanensis Ma & Zhang (2012: 573) and C. basitruncata Merrill ex Moldenke (1951: 406), and their detailed morphological comparison from life form, stem, leaves, cymes, calyx, corolla, and fruit were list in Table 3. The new species is most similar to C. hainanensis, and both share lots of common characteristics in branchlets, indumentum, leaf base, filament length, and the way of anther opening. Even so, it can be distinguished from C. hainanensis by its unique life form, adventitious roots at nodes, the morphology of calyx, calyx lobes, and the size of fruits (Table 3, Figures 1, 2, 3). In addition, the putative new species also resembles C. basitruncata, and they all have similar leaf shapes, cymes, and calyx, but it can differ from the latter by its procumbent life form, terete branchlets with adventitious roots at nodes, apparent linear lenticels, and leaf morphology (Table 3, Figures 1, 2, 3). In terms of leaf blade base, the putative new species is slightly similar to C. rubella and C. longipes, which all have cordate leaf bases. Obviously, it has filaments slightly shorter or as long as corolla, with larger oblong anthers, while the latter two species all have filaments twice or more than twice as long as the corolla, with small, ovate anthers.

TABLE 3.

Morphological comparison of Callicarpa stoloniformis with two related species.

Character C. stoloniformis C. hainanensis C. basitruncata
Life form Procumbent shrub Erect shrub Erect shrub
Stem Terete branchlets, purple, with stellate tomentose (when young) and linear lenticels, with adventitious roots at nodes Terete branchlets with stellate tomentose and linear lenticels, no adventitious roots at nodes Obtusely tetragonal branchlets, light‐colored, lenticels unconspicuous, no adventitious roots at nodes
Leaves Leaves petiole ca. 2–5 mm long, wrinkled, papery, oblong lanceolate, 11.5–14.5 × 3.5–4.5 cm, apex acuminate, base cordate Leaves subsessile, subcoriaceous, obovate‐lanceolate, 15–20 × 3–5 cm, apex acuminate, base subcordate or auriculate‐semiamplexicaul Petiole 1–2 mm, membranous, oblong, or slightly oblanceolate, 6–9 × 1–2 cm, apex acute or subacuminate, base truncate
Cymes 3–4 branched 3–4 branched Usually 2–3 branched
Calyx Cup‐shaped or campanulate, glabrous, with densely yellow glandular, do not dehisce as fruits mature, calyx lobes truncate or rare shallow fissure Long cup‐shaped or subtubular, tube sparsely stellate pubescent, yellow glandular, dehisced as fruits mature, calyx lobes sharply triangular, ca. 2 mm Cup‐shaped, very sparsely stellate puberulent to glabrescent, very sparsely glandular, calyx lobes obscurely 4‐toothed to almost truncate
Corolla White to pink, ca. 4‐mm‐long White, ca. 5‐mm‐long White, ca. 2‐mm‐long
Fruit ca. 1.5–2 mm in diameter ca. 4 mm in diameter ca. 2 mm in diameter
Open in a new tab

FIGURE 1.

FIGURE 1

Open in a new tab

Callicarpa stoloniformis. (a) Habit; (b) branchlet with adventitious roots at nodes; (c) branchlet with stellate tomentose; (d) adaxially and abaxially of blade; (e) stem with leaves and cymes; (f, g) inflorescence; (h) fruit; (i) pyrenes.

FIGURE 2.

FIGURE 2

Open in a new tab

Inflorescence of Callicarpa stoloniformis. (a, b) Influorescence; (c, d) peduncle and pedicel with stellate tomentose and yellow glandular; (e) corolla (split open); (f) ovary.

FIGURE 3.

FIGURE 3

Open in a new tab

Illustration of Callicarpa stoloniformis. (a) Plant with flowers; (b) branchlet with adventitious roots at nodes; (c) detail of stem; (d) cross‐ and longitudinal section of stem showing the pith; (e) stellate tomentose on the branchlet; (f) cyme; (g) flower; (h) calyx; (i) ovary with style; (j) corolla (split open) with stamens; (k) infructescence; (l) pyrenes with seed inside.

3.2. Molecular phylogeny

The cpDNA dataset comprised an aligned matrix of 3958 base pairs (bp) with 814 bp for matk, 1046 bp for psbJ‐petA intergenic spacer, 791 bp for rpl32‐trnL intergenic spacer, 742 bp for trnG‐trnS intergenic spacer, 565 bp for trnH‐psbA intergenic spacer, and the nrDNA dataset comprised an aligned matrix of 1165 base pairs, with 461 bp for ETS and 704 bp for ITS. The topologies of Callicarpa phylogeny generated on the base of combined nrDNA (two loci) and cpDNA (five regions) separately from the ML and BI analyses are not obviously conflict with each other. Here, we present the analysis results based on the combined nrDNA + cpDNA dataset for a better‐solved relationship among the related species investigated. The phylogenetic analysis indicates that the genus Callicarpa is monophyletic (posterior probability, PP = 1.00; bootstrap percentage, BP = 100%) with two outgroups from Prostantheroideae. The putative new species forms a clade with C. rubella Lindl. (Lindley, 1825: 883), C. longipes Dunn (1908: 363), and C. japonica Thunb. (Thunberg, 1784: 153), and they form a sister clade with the remaining species of Callicarpa (Figure 4).

FIGURE 4.

FIGURE 4

Open in a new tab

Phylogenetic relationships among Callicarpa stoloniformis and representative species of Callicarpa based on the combined DNA data (two nuclear and five chloroplast regions). The numbers under the nodes are Bayesian posterior probabilities and maximum likelihood bootstrap percentages, respectively.

3.3. Taxonomic treatment

Callicarpa stoloniformis X.X. Su, Z.H. Ma & B. Chen, sp. nov. (Figures 1, 2, 3).

Type: CHINA. Fujian Province: Zhangzhou City, Nanjing County, growing in a mountain valley, elev. ca. 200 m, E117.3643, N24.4886, 14 Dec. 2021, Xiangxiu Su GBJ09119 (holotype CSH!).

Diagnosis: Callicarpa stoloniformis is similar to C. hainanensis and C. basitruncata in stellate indumentum, cordate leaf blade base, filament slightly shorter or as long as corolla and anther opening by an apical pore, but significantly differs from the latter two species by its unique procumbent life form and adventitious roots at nodes (Table 3).

Description: Procumbent shrubs, ca. 1 to 2 m tall. Branchlets are slender, purple, terete, with linear lenticels, medullose, yellow glandular, stellate hairs (especially densely on the young branches and nodes) when young, becoming grayish brown and glabrous later with adventitious roots at nodes. Leaves decussate‐opposite, wrinkled, papery; oblong lanceolate, approximately 11.5–14.5 × 3.5–4.5 cm; apex acuminate, base cordate; margin serrate along upper‐middle part; veins abaxially prominent, purple; leaves blade subglabrous, adaxially stellate tomentose on mid‐veins, sparsely yellow glandular, abaxially occasionally stellate tomentose near veins, densely yellow glandular, secondary veins 6–9 pairs, sparsely hairy on lateral veins; petiole short, ca. 2–5 mm long, with densely stellate hairs. Cymes ca. 1.2–1.5 cm across, 3–4 branched; peduncle purple, with densely stellate tomentose, longer than petioles, ca. 5–7 mm long, yellow glandular, bracts linear‐lanceolate; pedicel subglabrous, ca. 1–2 mm long. Calyx cup‐shaped or campanulate, glabrous, with densely yellow glandular, calyx lobes truncate or rare shallow fissure. Corolla white to pink, ca. 4 mm long, glabrous, with yellow glandular; Staments 4, filaments slightly shorter or as long as corolla, anthers oblong, ca. 2.5 mm, opening by an apical pore. Ovary glabrous with yellow glandular. Fruits globose, purple, ca. 1.5–2 mm in diameter, and glabrous (Figures 1, 2, 3).

Etymology: The specific epithet is derived from the stoloniform stem.

Vernacular name: Simplified Chinese: 匍茎紫珠; Chinese pinyin: Pú Jīng Zǐ Zhū.

Phenology: Flowering time August–September; fruiting time September–December.

Distribution and ecology: Callicarpa stoloniformis is currently known only from locus classicus (Neikengkou in Nanjing County, Zhangzhou City, Fujian Province, China) growing in a mountain valley at altitude of 195 m (Figure 5). The new species grows along with Pinus massoniana (Don, 1803: 17), Phyllostachys edulis (Houzeau de Lehaie, 1906: 39), Morella rubra (de Loureiro, 1790: 548), Alfaropsis roxburghiana (Iljinskaja, 1993: 82), Saurauia tristyla (de Candolle, 1822: 423), Ficus variolosa (Hooker, 1842: 492), Syzygium hancei (Merrill & Perry, 1938: 242), Adinandra millettii (Trimen et al. 1878: 9), Ternstroemia gymnanthera (Beddome, 1871: 91), Alpinia japonica (1867: 140), Tetrastigma hemsleyanum (Diels & Gilg, 1900: 463), Pellionia radicans (de Candolle, 1869: 167), Lophatherum gracile (Duperrey, 1829: 50), and Setaria palmifolia (Stapf, 1914: 186).

FIGURE 5.

FIGURE 5

Open in a new tab

Distribution map of Callicarpa stoloniformis.

3.3.1. Identification key to Callicarpa stoloniformis and related taxa

1. Filaments twice or more than twice as long as the corolla, with small, ovate anthers……………………………………………………………………………....2.

1a. Filaments not longer than the corolla, with larger oblong anthers……..………….4.

2. Leaf blade base cuneate, narrowing above the middle………………....… C. giraldii .

2a. Leaf blade base cordate or auriculate‐semiamplexicaul, widest above the middle, obovate oblong or oblanceolate……………………………………………..…..…..3.

3. Calyx teeth acute, 1–2 mm; Petiole 5–10 mm…………………….……… C. longipes .

3a. Calyx teeth obtusely triangular, 0.5 mm; Petiole very short to subsessile………………………………………………………………….. C. rubella .

4. Procumbent branchlets with adventitious roots at nodes………..…. C. stoloniformis .

4a. Upright branchlets without adventitious roots at nodes……………………………5.

5. Branchlets, leaf blade abaxially, peduncle glabrous…………………..… C. japonica .

5a. Branchlets, Leaf blade abaxially veins, peduncle stellate pubescent………………6.

6. Long cup‐shaped or subtubular calyx which dehisces as fruits mature, with sharply triangular calyx lobes………………………………………………… C. hainanensis .

6a. Cup‐shaped calyx which does not dehisces as fruits mature, with subtruncate to minutely 4‐dentate calyx lobes……………………………………..……………….7.

7. Leaf blade base truncate to shallowly cordate………..……..……… C. basitruncata .

7a. Leaf blade base obtuse, cuneate, or shallowly cordate……………….…. C. brevipes.

3.3.2. Additional specimens examined

CHINA. Shanghai: Shanghai Chenshan Botanical Garden, Collected from cultivated living plant, 8 Oct. 2022, Bin Chen CB04591 (paratypes GAUA!, CSH!).

3.3.3. Specimens of related species examined

Callicarpa hainanensis. CHINA. Hainan: Ledong County, Jianfengling Mountain, alt. 650 m 26 May 2010, Z. H. Ma 079 (holotype, IBSC!); at the edge of a secondary forest, alt. 500–700 m, 1 June 2010, Z. H. Ma 090 (IBSC!); on a mountain slope, alt. 520–650 m, 15 September 2010, Z. H. Ma 113 (IBSC!).

Callicarpa brevipes. CHINA. Guangdong: Boluo County, Xiaojinsha, alt. 740 m, 15 Oct. 1992, Y. Q. Wang 173 (IBSC!); Zhuhai, Dangan, 8 Sept. 1990, B. H. Chen 678 (IBSC!); Dalin mountain, 12 Aug. 2009, ZHM0130 (GAUA!); South China Botanical Garden, 12 May 2012, ZHM082 (GAUA!); Conghua County, Sanjiao Mountain, 29 May 1932, W. T. Tsang 20606 (PE!); Heping County, alt. 600 m, 13 Oct. 1984, G. C. Zhang 630 (IBSC!); Jiangxi: Jiulian mountain, 18 Sept. 2009, ZHM057 (GAUA!); Hainan: Jianfengling, 16 June 2011, L. X. Zhou 5476 (IBSC!); Jianfengling, Tianchi, 15 Apr. 1982, Q. Huang 820153 (IBSC!); Fujian: Shunchang County, 7 July 1956, M. S. Li & Z. Y. Li 5144 (PE!); Guangxi: Longsheng County, 23 Sept. 1956, S. L. Xu & H. F. Qin 700608 (IBK!); Rongxian, Tiantangshan, 26 June 1956, S. Q. Chen 9581 (IBK!); Wuzhou, 9 June 1935, S. G. Li 81075 (IBSC!); Bobai County, alt. 820 m, 26 Sept. 1959, S. Q. Zhong A63177 (IBSC!); HongKong: J. G. Champion 12 (K!); G. Bentham 442 (K!).

Callicarpa basitruncata. CHINA. Hainan: 1 Aug. 1935, J. L. Gressitt 1168 (Type, A!, NY!, G!, E!).

Callicarpa japonica. CHINA. Tsinghan: 1 Jan. 1901, R. Zimmermann 210 (Holotype photo P!); Jiangxi: Yichun, alt. 1400 m, 14 Aug. 1963, Junsan Yue 3380 (IBSC!); Jiujiang County, alt. 280 m, 28 Sept. 1992, C. M. Tan 92100‐A (PE!); Guangchang, 17 Oct. 1962, Junsan Yue 2544 (PE!); Wuning County, alt. 300 m, 18 June 1963, S. S. Lai 02688 (PE!); Lushan, alt. 400 m, 27 Oct. 1995, C. M. Tan 95918 (PE!); Anhui: Huangshan, 12 July 1975, K. J. Guan 75141 (PE!); Shanxi: Jingcheng, 26 July 1959, S. Y. Bao 424 (PE!); Zhejiang: 6 June 1958, Hangzhou 414 (PE!); JAPAN. Minami‐yama, 7 Nov. 2007, T. Miyazaki 0711004 (TI!); 30 Oct. 2007, T. Miyazaki 0710534 (PE!).

4. DISCUSSION

4.1. Morphology

The new species is morphologically similar to Callicarpa hainanensis Ma & Zhang by sharing a series of similar features. Specifically, both have terete branchlets with stellate tomentum when young (becoming glabrous when old), and obvious linear lenticels. They have cordate leaf blade bases, slender cymes, with filaments slightly shorter than or as long as corolla, and oblong anthers, opening by an apical pore. However, C. stoloniformis can be easily distinguished from C. hainanensis due to its procumbent shrub (vs. erect shrub), which make it distinctive from the whole genus. Furthermore, C. stoloniformis has adventitious roots at nodes (vs. no adventitious roots at nodes), papery leaves (vs. subcoriaceous), cup‐shaped or campanulate calyx (vs. long cup‐shaped or subtubular), and truncate or shallow fissure calyx lobes (vs. sharply triangular, dehisced as fruits mature) and smaller fruits (1.5–2 mm vs. 4 mm in diameter; Table 3). In addition, the new species is also likely to be confused with C. basitruncata Merrill ex Moldenke, a species only known from the original description and a photograph of the holotype. Both species have oblong lanceolate leaf blades, abbreviated cymes, glabrous calyx, truncate or rare shallow fissure calyx lobes. However, it can be distinguished from C. basitruncata by its procumbent shrub (vs. erect shrub), terete branchlets (vs. obtusely tetragonal), with adventitious roots at nodes (vs. no adventitious roots at nodes), apparent linear lenticels on stem (vs. lenticels inconspicuous), and papery larger leaves (vs. membranous) with prominently cordate leaf base (vs. truncate) (Table 3). C. stoloniformis has a cordate leaf base, which to some extent makes it slightly similar to C. rubella and C. longipes, but its shorter filaments (as long as corolla) and larger oblong anthers differ it from the latter two species which have filaments twice or more than twice as long as the corolla, with small, ovate anthers.

4.2. Molecular phylogeny

The combined analysis indicated that Callicarpa is monophyletic (PP = 1.00, BP = 100%, Figure 4) with respect to the groups considered. Two main clades are formed and our phylogenetic result seems not being consistent with Chang's (1951) traditional classification system based on the length of filament, and morphology of anther, which is widely recognized (Bramley, 2009, 2013; Fang, 1982). The putative new species forms a well‐supported sister clade with the clade composed by members of section Eucallicarpa: C. rubella and C. longipes (PP = 1.00, BP = 98%), and then, these three species form a weakly supported sister clade with C. japonica (section Verticirima) (PP = 0.63, BP = 48%, Figure 4). Although it forms a sister clade with C. rubella and C. longipes and shares few common characteristics in morphology, such as cordate leaf base, it can be obviously distinguished from the latter two species by its unique procumbent life form, adventitious roots at nodes, and shorter filaments or as long as corolla (typical characters of section Verticirima). Moreover, it also can be easily identified from C. japonica by its procumbent life form, adventitious roots at nodes, stellate hairs on the young branchlets and inflorescence, and cordate leaf base. It is strange that C. hainanensis which we think the most morphologically similar species with C. stoloniformis (mentioned above), firstly forms a clade with C. brevipes (Benth.) Hance (1886: 233) and C. giraldii Hesse ex Rehd. (Rehder, 1914: 629), subsequently form a moderately supported sister clade with the clade including C. stoloniformis, C. japonica, C. rubella, and C. longipes (Figure 4).

AUTHOR CONTRIBUTIONS

Zhonghui Ma: Conceptualization (equal); funding acquisition (equal); writing – original draft (lead); writing – review and editing (equal). Xiangxiu Su: Conceptualization (equal); investigation (lead). Huiming Cai: Investigation (equal); methodology (equal). Zhiwei Su: Conceptualization (equal); funding acquisition (equal); writing – review and editing (equal). Bin Chen: Conceptualization (equal); funding acquisition (equal); writing – review and editing (equal).

CONFLICT OF INTEREST STATEMENT

The authors declare no conflicts of interest.

ACKNOWLEDGMENTS

We thank Dr. Jie Cai of the Chinese National Wild Plant Germplasm Resource Center and Mr. Binjie Ge of Shanghai Chenshan Botanical Garden for their kind help in the preparation of plate images. We are indebted to Mr. Yingbao Sun for the illustrations. This work is supported by the National Natural Science Foundation of China (Grant No. 31760045, 31970220, and 32060098), the Natural Science Foundation of Guangxi Province (Grant No. 2018GXNSFAA281132), the Foundation of Guangxi Key Laboratory of Sugarcane Biology (Grant No. GXKLSCB‐202004), grants from Shanghai Municipal Administration of Forestation and City Appearances (Grant No. G212416), and the National Wild Plant Germplasm Resource Center for Shanghai Chenshan Botanical Garden (Grant No. ZWGX2202).

Ma, Z. , Su, X. , Cai, H. , Su, Z. , & Chen, B. (2023). Callicarpa stoloniformis (Lamiaceae), a new species from Southeast China based on morphological characters and phylogenetic evidence. Ecology and Evolution, 13, e9913. 10.1002/ece3.9913

Contributor Information

Zhiwei Su, Email: suzw1454@126.com.

Bin Chen, Email: chenbin@csnbgsh.cn.

DATA AVAILABILITY STATEMENT

The sequences of this study have been deposited in The National Center for Biotechnology Information (NCBI) database. GenBank accession numbers of the sequencing data can be found in Table 2.

REFERENCES

  1. Andersson, S. (2006). On the phylogeny of the genus Calceolaria (Calceolariaceae) as inferred from ITS and plastid matK sequences. Taxon, 55(1), 125–137. 10.2307/25065534 [DOI] [Google Scholar]
  2. Baldwin, B. G. , & Markos, S. (1998). Phylogenetic utility of the external transcribed spacer (ETS) of 18S‐26S rDNA: Congruence of ETS and ITS trees of Calycadenia (Compositae). Molecular Phylogenetics and Evolution, 10(3), 449–463. 10.1006/mpev.1998.0545 [DOI] [PubMed] [Google Scholar]
  3. Beardsley, P. M. , & Olmstead, R. (2002). Redefining Phrymaceae: The placement of Mimulus, tribe Mimuleae, and Phryma . American Journal of Botany, 89(7), 1093–1102. 10.3732/ajb.89.7.1093 [DOI] [PubMed] [Google Scholar]
  4. Beddome, R. H. (1871). The Flora Sylvatica for Southern India (Vol. 19, p. 91). Gantz Brothers. [Google Scholar]
  5. Bramley, G. L. C. (2009). The genus Callicarpa (Lamiaceae) on Borneo. Botanical Journal of Linnean Society, 159, 416–455. 10.1111/j.1095-8339.2009.00907.x [DOI] [Google Scholar]
  6. Bramley, G. L. C. (2013). The genus Callicarpa (Lamiaceae) in The Philippines. Kew Bulletin, 68, 1–50. 10.1007/s12225-013-9456-y [DOI] [Google Scholar]
  7. Briquet, J. (1895). Verbenaceae. In Engler A. & Prantl K. (Eds.), Die natürlichen Pflanzenfamilien, IV, 3a (pp. 132–182). Wilhelm Engelmann. [Google Scholar]
  8. Brown, R. (1810). Verbenaceae. In Brown R. & Esenbeck C. G. N. V. (Eds.), Prodromus Florae Novae Hollandiae et Insulae Van‐Diemen (pp. 510–514). Richard Taylor & Co. [Google Scholar]
  9. Cai, H. M. , Liu, X. , Su, Z. W. , & Ma, Z. H. (2021). The complete chloroplast genome of Callicarpa rubella Lindl. (Lamiaceae) from Guangxi, China: Genome structure and phylogenetic analysis. Mitochondrial DNA B Resources, 6, 3280–3282. 10.1080/23802359.2021.1993106 [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Chang, H. (1951). A review of the Chinese species of Callicarpa . Journal of Systematics Evolution, 1, 269–312. [Google Scholar]
  11. Chen, S. L. , & Gilbert, M. G. (1994). Verbenaceae. In Wu Z. Y. & Raven P. H. (Eds.), Flora of China (Vol. 17, pp. 1–49). Science Press & Missouri Botanical Garden Press. [Google Scholar]
  12. Chinese Pharmacopoeia Commission . (2020). Pharmacopoeia of the People's Republic of China. China Medical Science Press. [Google Scholar]
  13. Chun, W. Y. (1934). Contributions to the Flora of Kwangtung and South‐Eastern China. Sunyatsenia, 1(4), 302–303. www.tropicos.org/name/33702120 [Google Scholar]
  14. Conn, B. J. , Henwood, M. J. , & Streiber, N. (2011). Synopsis of the tribe Chloantheae and new nomenclatural combinations in Pityrodia s.lat. (Lamiaceae). Australian Systematic Botany, 24(1), 6. 10.1071/SB10039 [DOI] [Google Scholar]
  15. de Candolle, A. P. (1822). Memoires de la Société de physique et d'histoire naturelle de Genève (Vol. 1, p. 423). Georg. [Google Scholar]
  16. de Candolle, A. P. (1869). Prodromus systematis naturalis regni vegetabilis, sive, Enumeratio contracta ordinum generum specierumque plantarum huc usque cognitarium, juxta methodi naturalis, normas digesta (Vol. 16, p. 167). Sumptibus Sociorum Treuttel et Würtz. [Google Scholar]
  17. de Loureiro, J. (1790). Flora cochinchinensis: sistens plantas in regno Cochinchina nascentes. Quibus accedunt aliae observatae in Sinensi imperio, Africa Orientali, Indiaeque locis variis. Omnes dispositae secundum systema sexuale Linnaeanum (Vol. 2, p. 548). Labore. Ulyssipone, Typis, et Expensis Academicis. [Google Scholar]
  18. Diels, F. L. E. , & Gilg, E. F. (1900). Botanische Jahrbücher fur Systematik, Pflanzengeschichte und Pflanzengeographie, 29(3–4), 463. [Google Scholar]
  19. Don, D. (1803). A description of the genus Pinus: Illustrated with figures, directions relative to the cultivation, and remarks on the uses of the several species (Vol. 1, p. 17). J. White. [Google Scholar]
  20. Doyle, J. J. , & Doyle, J. L. (1987). A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry Bulletin, 19, 11–15. [Google Scholar]
  21. Dunn, S. T. (1908). A botanical expedition to central Fokien Verbenaceae. The Journal of the Linnean Society, Botany, 38(267), 363. [Google Scholar]
  22. Duperrey, L. I. (1829). Voyage autour du monde: exécuté par ordre du roi, sur la corvette de Sa Majesté, la Coquille, pendant les années 1822, 1823, 1824, et 1825 (Vol. 2, p. 50). Arthus Bertrand. [Google Scholar]
  23. Fang, W. Z. (1982). Callicarpa L. (Verbenaceae). In Pei C. & Chen S. L. (Eds.), Flora Reipublicae Popularis Sinicae (pp. 24–79). Science Press. [Google Scholar]
  24. Hance, H. F. (1886). Callicarpa brevipes. In Tieghem M. P. V. (Ed.), Annales des Sciences Naturelles; Botanique, sér. 7 (Vol. 5, p. 233). Boulevard Saint‐Germain et rue de Reperon. [Google Scholar]
  25. Harley, R. M. , Atkins, S. , Budantsey, A. L. , Cantino, P. D. , Conn, B. J. , Grayer, R. , Harley, M. M. , Kok, R. , de Krestovskaja, T. , Morales, R. , Paton, A. J. , Ryding, O. , & Upson, T. (2004). Labiatae. In Kubitzki K. & Kadereit J. W. (Eds.), Families and genera of vascular plants. Flowering plants. Dicotyledons ~ Lamiales (except Acanthaceae including Avicenniaceae) (Vol. 7, pp. 167–275). Springer. [Google Scholar]
  26. Hooker, W. J. (1842). The London journal of botany: Containing figures and descriptions of such plants as recommend themselves by their novelty, rarity, history, or uses: Together with botanical notices and information and and occasional portraits and memoirs of eminent botanists, 1, 492. [Google Scholar]
  27. Hooker, W. J. , Beechey, F. W. , & Walker‐Arnott, G. A. (1841). The botany of captain Beechey's voyage; comprising an acount of the plants collected by Messrs. lay and collie, and other officers of the expedition, during the voyage to the Pacific and Behring's strait, performed in his Majesty's ship blossom, under the command of captain F. W. Beechey … in the years 1825, 26, 27, and 28 (p. 206). H. G. Bohn. [Google Scholar]
  28. Houzeau de Lehaie, J. (1906). Le Bambou, son etude, sa culture, son emploi (Vol. 1, p. 39). Kessinger Publishing, LLC. [Google Scholar]
  29. Iljinskaja, I. A. (1993). СИСТЕМАТИЧЕСКИЕ ОБЗОРЫ И НОВЫЕ ТАКСОНЫ. Botanicheskii Zhurnal (Moscow & Leningrad), 78(10), 81. [Google Scholar]
  30. Kalyaanamoorthy, S. , Minh, B. Q. , Wong, T. K. F. , von Haeseler, A. , & Jermiin, L. S. (2017). ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods, 14, 587. 10.1038/nmeth.4285 [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Katoh, K. , & Standley, D. M. (2013). MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution, 30, 772–780. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kumar, S. , Stecher, G. , & Tamura, K. (2016). MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33, 1870–1874. 10.1093/molbev/msw054 [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Leeratiwong, C. , Chantaranothai, P. , & Paton, A. J. (2009). A synopsis of the genus Callicarpa L. (Lamiaceae) in Thailand. Thai Forest Bulletin (Botany), 37, 36–58. [Google Scholar]
  34. Li, B. , Cantino, P. D. , Olmstead, R. G. , Bramley, G. L. C. , Xiang, C. L. , Ma, Z. H. , Tan, Y. H. , & Zhang, D. X. (2016). A large‐scale chloroplast phylogeny of the Lamiaceae sheds new light on its subfamilial classification. Scientific Reports, 6, 18. 10.1038/srep34343 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Lindley, J. (1825). Callicarpa rubella. In Edwards S., et al. (Ed.), The botanical register: Consisting of coloured figures of exotic plants, cultivated in British gardens with their history and mode of treatment (p. 883). James Ridgway, 169 Piccadilly 11. [Google Scholar]
  36. Linnaeus, C. (1753). Species plantarum (Vol. 1). Impensis Laurentii Salvii, Holmiae. [Google Scholar]
  37. Linnaeus, C. (1771). Car. a Linné Mantissa plantarum: Generum editionis VI. et specierum editionis II (Vol. 2). Holmiæ, Impensis Direct. Laurentii Salvii; 154–155, 252–253. [Google Scholar]
  38. Linnaeus, C. (1781). Supplementum plantarum Systematis vegetabilium editionis decimae tertiae, Generum plantarum editionis sextae, et Specierum plantarum editionis secunda. Brunsvigae, Impensis Orphanotrophei, 20, 151. [Google Scholar]
  39. Liu, X. , Cai, H. M. , Wang, W. Q. , Lin, W. , Su, Z. W. , & Ma, Z. H. (2022). Why is the beautyberry so colourful? Evolution, biogeography, and diversification of fruit colours in Callicarpa (Lamiaceae). Plant Diversity, 45, 6–19. 10.1016/j.pld.2022.10.002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Ma, Z. H. (2013). Taxonomic revision of Callicarpa L. (Lamiaceae) in China. Doctor, The Chinese Academy of Sciences .
  41. Ma, Z. H. , Bramley, G. L. C. , & Zhang, D. X. (2016). Pollen morphology of Callicarpa L. (Lamiaceae) from China and its systematic implications. Plant Systematics and Evolution, 302, 67–88. 10.1007/s00606-015-1244-8 [DOI] [Google Scholar]
  42. Ma, Z. H. , Huang, R. S. , & Su, Z. W. (2015). Lectotypification of Callicarpa integerrima (Lamiaceae). Phytotaxa, 234(3), 299–300. 10.11646/phytotaxa.234.3.12 [DOI] [Google Scholar]
  43. Ma, Z. H. , & Su, Z. W. (2015). Lectotypification of Callicarpa nudiflora (Lamiaceae). Phytotaxa, 224(1), 100. 10.11646/phytotaxa.224.1.8 [DOI] [Google Scholar]
  44. Ma, Z. H. , & Zhang, D. X. (2012). Callicarpa hainanensis: A new species of Callicarpa from Hainan, China. Journal of Systematics and Evolution, 50(6), 573–579. 10.1111/j.1759-6831.2012.00229_1.x [DOI] [Google Scholar]
  45. Merrill, E. D. , & Perry, L. M. (1938). The Myrtaceae of China. Journal of the Arnold Arboretum, 19(3), 242. [Google Scholar]
  46. Miller, M. , Pfeiffer, W. , & Schwartz, T. (2010). Creating the CIPRES science gateway for inference of large phylogenetic trees. In Proceedings of the gateway. Computing Environments Workshop (GCE). [Google Scholar]
  47. Miquel, F. A. G. , & Friedrich, A. W. (1867). Prolusio Florae Iaponicae. In Miquel F. A. G. (Ed.), Annales Musei botanici lugduno‐batavi (Vol. 3, p. 140). Apud C. G. van der Post. [Google Scholar]
  48. Moldenke, H. N. (1950). Novelties in the Eriocaulaceae and Verbenaceae II. Bulletin of the Torrey Botanical Club, 77, 389–405. [Google Scholar]
  49. Moldenke, H. N. (1951). Notes on new and noteworthy plants. XII. Phytologia, 3(8), 406–448. 10.5962/bhl.part.10094 [DOI] [Google Scholar]
  50. Mueller, F. (1860. –1861). Fragmenta phytographiae australiae. Melbourne, Auctoritate Gubern. Colonlae Victoriae. Ex Officina Joannis Ferres, 2, 160. [Google Scholar]
  51. Munir, J. (1982). A taxonomic revision of the genus Callicarpa in Australia. Journal of the Adelaide Botanic Gardens, 6, 5–39. [Google Scholar]
  52. Nguyen, L. T. , Schmidt, H. A. , von Haeseler, A. , & Minh, B. Q. (2015). IQ‐TREE: A fast and effective stochastic algorithm for estimating maximum‐likelihood phylogenies. Molecular Biology and Evolution, 32, 268–274. 10.1093/molbev/msu300 [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Rambaut, A. , Drummond, A. J. , Xie, D. , Baele, G. , & Suchard, M. A. J. S.b. (2018). Posterior summarization in Bayesian phylogenetics using tracer 1.7. Systematic Biology, 67, 901–904. 10.1093/sysbio/syy032 [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Rehder, A. (1914). Callicarpa giraldii. In Bailey L. H. (Ed.), The standard cyclopedia of horticulture (p. 629). Macmillan & Co., Ltd. [Google Scholar]
  55. Ronquist, F. , Teslenko, M. , van der Mark, P. , Ayres, D. L. , Darling, A. , Hohna, S. , Larget, B. , Liu, L. , Suchard, M. A. , & Huelsenbeck, J. P. (2012). MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology, 61, 539–542. 10.1093/sysbio/sys029 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Sang, T. , Crawford, D. J. , & Stuessy, T. F. (1997). Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae). American Journal of Botany, 84, 1120–1136. 10.2307/2446155 [DOI] [PubMed] [Google Scholar]
  57. Shaw, J. , Lickey, E. , Beck, J. T. , Farmer, S. B. , Liu, W. , Miller, J. , Siripun, K. C. , Winder, C. T. , Schilling, E. E. , & Small, R. L. (2005). The tortoise and the hare II: Relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis. American Journal of Botany, 92, 142–166. 10.3732/ajb.92.1.142 [DOI] [PubMed] [Google Scholar]
  58. Shaw, J. , Lickey, E. , Schilling, E. E. , & Small, R. L. (2007). Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: The tortoise and the hare III. American Journal of Botany, 94(3), 275–288. 10.3732/ajb.94.3.275 [DOI] [PubMed] [Google Scholar]
  59. Stapf, O. (1914). Miss L. S. Gibbs on the Flora and Plant Formations. Journal of the Linnean Society, Botany, 42, 186. [Google Scholar]
  60. Sun, Y. , Skinner, D. , Liang, G. , & Hulbert, S. H. (1994). Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics, 89(1), 26–32. 10.1007/BF00226978 [DOI] [PubMed] [Google Scholar]
  61. Tate, J. A. , & Simpson, B. B. (2003). Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species. Systematic Botany, 28(4), 723–737. [Google Scholar]
  62. Thiers, B. (2022. [continuously updated]). Index Herbariorum: a global directory of public 22 herbaria and associated staff. New York Botanical Garden's Virtual Herbarium. http://sweetgum.nybg.org/science/ih/ (accessed 13 July 2022).
  63. Thunberg, C. P. (1784). Caroli a Linné equitis Systema vegetabilium: Secundum classes ordines genera species cum characteribus et differentiis. In Systema Vegetabilium. Editio Decima Quarta (p. 153). Typis et impensis Jo. Christ. Dieterich. [Google Scholar]
  64. Trimen, H. , Britten, J. , Ramsbottom, J. , Seemann, B. , & Rendle, A. B. (1878). Spicilegia Florae Sinensis: Diagnoses of New, and Habitats of Rare or Hitherto Unrecorded, Chinese Plants. Journal of botany, British and foreign, 16, 9. [Google Scholar]
  65. Trimen, H. , Britten, J. , Ramsbottom, J. , Seemann, B. , & Rendle, A. B. (1882). New Formosan Plants. Journal of botany, British and foreign, 20(240), 358–359. [Google Scholar]
  66. Vahl, M. , & Forsskål, P. (1794). Symbolae botanicae, sive plantarum, tam earum, quas in itinere, imprimis orientali. Hauniae, imprensis auctoris, excudebant N (Vol. 3, p. 13). Möller et Filius. [Google Scholar]
  67. Wu, Z. , Chen, J. , Xu, F. , & Wang, H. (2018). Research progress on Callicarpa plants. Journal of Guangdong Pharmaceutical University, 34, 808–813. 10.16809/j.cnki.2096-3653.2018102101 [DOI] [Google Scholar]
  68. Zhang, D. , Gao, F. L. , Jakovlic, I. , Zou, H. , Zhang, J. , Li, W. X. , & Wang, G. T. (2020). PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources, 20, 348–355. 10.1111/1755-0998.13096 [DOI] [PubMed] [Google Scholar]
  69. Zhao, F. , Chen, Y. P. , Salmaki, Y. , Drew, B. T. , Wilson, T. C. , Scheen, A. C. , Celep, F. , Brauchler, C. , Bendiksby, M. , Wang, Q. , Min, D. Z. , Peng, H. , Olmstead, R. G. , Li, B. , & Xiang, C. L. (2021). An updated tribal classification of Lamiaceae based on plastome phylogenomics. BMC Biology, 19, 27. 10.1186/s12915-020-00931-z [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The sequences of this study have been deposited in The National Center for Biotechnology Information (NCBI) database. GenBank accession numbers of the sequencing data can be found in Table 2.

Articles from Ecology and Evolution are provided here courtesy of Wiley

RESOURCES