Universal two‐dimensional labelled probe‐mediated melting curve analysis based on multiplex PCR for rapid typing of Plasmodium in a single closed tube

Abstract

Currently, malaria is still one of the major public health problems commonly caused by the four Plasmodium species. The similar symptoms of malaria and the COVID‐19 epidemic of fever or fatigue lead to frequent misdiagnosis. The disadvantages of existing detection methods, such as time‐consuming, costly, complicated operation, need for experienced technicians, and indistinguishable typing, lead to difficulties in meeting the clinical requirements of rapid, easy, and accurate typing of common Plasmodium species. In this study, we developed and optimized a universal two‐dimensional labelled probe‐mediated melting curve analysis (UP‐MCA) assay based on multiplex and asymmetric PCR for rapid and accurate typing of five Plasmodium species, including novel human Plasmodium, Plasmodium knowlesi (Pk), in a single closed tube following genome extraction. The assay showed a limit of detection (LOD) of 10 copies per reaction and could accurately distinguish Plasmodium species from intra‐plasmodium and other pathogens. Additionally, we proposed and validated different methods of fluorescence quenching and tag design for probes that are suitable for UP‐MCA assays. Moreover, the clinical performance of the Plasmodium UP‐MCA assay using a base‐quenched universal probe was evaluated using 226 samples and showed a sensitivity of 100% (164/164) and specificity of 100% (62/62) at a 99% confidence interval, with the microscopy method as the gold standard. In summary, the UP‐MCA assay showed excellent sensitivity, specificity, and accuracy for genotyping Plasmodium species spp. Additionally, it facilitates convenient and rapid Plasmodium detection in routine clinical practice and has great potential for clinical translation.

INTRODUCTION

Malaria is a life‐threatening disease caused by protozoan parasites belonging to the genus Plasmodium, which are transmitted to humans through the bites of infected female Anopheles mosquitoes. According to the World Malaria Report 2020, approximately 229 million cases of malaria have been reported worldwide, causing an estimated 409,000 deaths in 2019. Although the claim of local malaria elimination from some regions or countries has been authenticated by the World Health Organization (WHO), there is still a great risk of imported malaria due to economic globalization as well as the aggravation of population immigration and emigration across regions or countries.

Four species of Plasmodium parasites cause human malaria: Plasmodium vivax (Pv), Plasmodium falciparum (Pf), Plasmodium ovale (Po), and Plasmodium malariae (Pm). Additionally, Plasmodium knowlesi (Pk) derived from macaques was considered to be the fifth species of Plasmodium that caused human malaria, based on a large focus and description in 2004 (Singh et al., 2004; White, 2008). The characteristics of Plasmodium species vary among clinical treatments and surveillance methods (Organization, 2015). Additionally, clinically specific characterization cannot be ensured because blood samples from patients with Plasmodium are difficult to obtain and are infrequently tested. Therefore, timely, easy, and accurate typing of Plasmodium is very important for countries or coastal cities with frequent business transactions or population mobility worldwide, especially imported malaria from Plasmodium high‐burden regions.

Microscopy, the gold standard for the diagnosis of clinical malaria is time‐consuming and requires a skilled technician. However, this method cannot effectively support large‐scale applications. Furthermore, it is difficult to distinguish Pk from Pm because of their morphological similarities (Singh et al., 2004; Singh & Daneshvar, 2013), although Pk results in severe and deadly malaria. Rapid diagnostic tests (RDTs) based on immunochromatographic antigen detection have been implemented in diagnostic laboratories as supplements to microscopy (Wilson, 2012). Although they are rapid, simple, and easy to interpret, RDTs target proteins specific to Pf or Pv, or those common to all Plasmodium species cannot specifically differ among Pm, Po, and Pk (Erdman & Kain, 2008; Wilson, 2012). Moreover, diagnostic sensitivity (e.g., lack of sensitivity for some strains of Pf and up to 50% of Pk; Barber et al., 2013) and specificity (e.g., Pv in patients with co‐infections and high Pf parasitemia levels) are widely variable in commercially available RDTs.

Molecular detection methods offer an attractive alternative approach. Polymerase chain reaction (PCR) is a heat‐dependent cycle amplification reaction that achieves exponential amplification of the original genome and has been used as one of the most important nucleic acid test methods (Canier et al., 2013; Komaki‐Yasuda et al., 2018; Putaporntip et al., 2011). Conventional PCR assays are time‐consuming, require post‐handling, and carry a risk of cross‐contamination. Although some real‐time PCR assays have been described (Dos Santos et al., 2020; Rougemont et al., 2004), they cannot distinguish among multiple Plasmodium species in one‐pot reactions, mainly due to limited number of fluorescence channels and only can achieve limited detection of one or two Plasmodium species. Plasmodium species detection assays based on isothermal amplification, such as loop‐mediated isothermal amplification (LAMP; Hashimoto et al., 2018; Nolasco et al., 2021; Piera et al., 2017; Tambo et al., 2018), recombinase polymerase amplification (RPA; Lai et al., 2018; Lai & Lau, 2020; Lalremruata et al., 2020), showed great convenience for point‐of‐care diagnosis, especially for resource‐limited settings, but they lack detection throughput and sensitivity in diagnosis, especially for false‐positive or false‐negative results. The CRISPR‐based diagnostic platform (CRISPR‐Dx) is a new emerging nucleic acid detection technology used for point‐of‐care diagnosis, such as Cas12a‐mediated Plasmodium detection assay (Lee et al., 2020), showing great sensitivity and specificity. However, this requires expensive Cas proteins from commercial corporations. Moreover, it is difficult to achieve multiple‐target detection in a single closed tube.

Herein, we propose a universal two‐dimensional labelled probe‐mediated melting curve analysis (UP‐MCA) assay based on multiplex and asymmetric PCR under two fluorescent channels for malaria genotyping. It is a rapid, sensitive, specific, low‐cost, and high‐throughput detection method for the five Plasmodium species, including Pf, Pv, Pm, Po, and Pk, using the human ribonuclease P (RNase P) gene as an internal control in a closed one‐pot tube following genome extraction. The assay was validated by the detection of clinical malaria samples.

MATERIALS AND METHODS

Collection and genome extraction of clinical samples

Blood samples were collected from the Mengchao Hepatobiliary Hospital of Fujian Medical University from July 2016 to March 2020, with one sample from each patient, including those with symptoms of fever and fatigue, similar to malaria. The local Institutional Review Board of the Mengchao Hepatobiliary Hospital of Fujian Medical University approved the study and waived the requirement of informed consent. The experiments were conducted following the Declaration of Helsinki. Genomic extraction of whole blood (200 μL) was performed using an Ex‐DNA whole blood extraction kit with automated nucleic acid extraction equipment (NP968‐C, Xi'an Tianlong Science and Technology Co., Ltd). The nucleic acid extract was measured using a Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific) and stored at −20°C until further use.

Principle of species‐specific plasmodium detection assay

The Plasmodium UP‐MCA detection assay was performed in a single closed tube, combined with multiplex asymmetric PCR with probe‐mediated melting curve analysis (MCA). Asymmetric PCR, in which one of the primer pairs was added to the exogenous sequence tag at the 5′ end, was adopted to produce a massive single‐stranded DNA amplicon with a complementary sequence (cTag) that represented the given annealing temperature (Tm) value. The original sequence of homologous tags was fluorescently labelled for the universal two‐dimensional probe. The function of the probe was the same as that of a fluorescent probe in 2D PCR (Lu et al., 2021; Zhan et al., 2020). It can bind to homologous cTag, leading to production of different Tm in the MCA process. Different probes can be labelled with different fluorescence signals. It can detect more targets in a single closed tube. The species‐specific Plasmodium detection results were simultaneously analysed using fluorescence channel (s) and Tm value (s; Figure 1).

FIGURE 1.

Schematic diagram of universal two‐dimensional labelled probe‐mediated melting curve analysis (UP‐MCA) based on multiplex PCR assay for Plasmodium species genotyping. The genome of the clinical Plasmodium sample was used for multiplex PCR reaction for asymmetric amplification and universal fluorescence probe‐(base‐quenched universal probe used) mediated melting curve analysis. Asymmetric PCR generates rare double‐stranded products and massive single‐stranded oligonucleotide amplicon with Tag's complementary sequence (cTag). cTag 1, cTag 2, and cTag 3 are one group of homologous cTags used for hybridization with probe 1 (light green), and cTag 4, cTag 5, and cTag 6 are the other one used for probe 2 (dark blue). The detailed target was simultaneously ruled by fluorescence channel and specific Tm value, which was automatically analysed using the Bio‐Rad CFX Manager software.

Design of Plasmodium species‐specific primers and universal fluorescent probe

The nuclear small subunit (SSU) rRNA gene, with copy numbers ranging from four to eight, is a highly conserved region suitable for human malaria detection and was used as a gene target for genotyping Plasmodium species based on previous studies (Komaki‐Yasuda et al., 2018; Lee et al., 2015, 2020; Nuin et al., 2020; Reller et al., 2013; Rougemont et al., 2004). Sequences of the SSU rRNA gene in P. falciparum (GenBank accession No. M19172), P. vivax (GenBank accession No. X13926), P. ovale (GenBank accession No. L48987), P. malariae (GenBank accession No. M54897), and P. knowlesi (GenBank accession No. AY327550) were blasted using Clustal X. Specific fragments with huge differences in the five Plasmodium species for intra‐species discrimination and high homology of the Plasmodium genus were chosen for primer design. They were selected for the design of a limiting reverse primer (LR) and abundant forward primer (AF) of asymmetric PCR for species‐specific Plasmodium detection. Additionally, universal fluorescent probes and tags for species‐specific Plasmodium detection assays were chosen from a previous study (Zhan et al., 2020). Furthermore, detailed Tm values were determined by different degrees of hybridization between cTag and the universal fluorescent probe. Therefore, we inferred that the strategy of diverse lengths of effective hybridization can be used for UP‐MCA analysis, apart from that of point mutations in the tag. Six homologous tags of different hybridization lengths with a novel fluorescent probe for genotyping were designed and replaced for validation. All primers and fluorescent probes (Table 1) were synthesized by Sunya Biotech (Fuzhou) Co., Ltd. and Sangon Biotech (Shanghai) Co., Ltd., respectively. DNA plasmid standards of species‐specific Plasmodium fragments of the SSU rRNA gene and human RNase P gene fragment (Table S1) were constructed by General Biosystems (Anhui) Co., Ltd.

TABLE 1.

Probes and primer sequences of UP‐MCA assay for Plasmodium genotyping.

Species	Name	Sequence
Plasmodium genus	Forward primer	5′‐ACGATCAGATACCGTCGTAATCTT‐3′
P. falciparum	Reverse primer	5′‐ CCATTAGAACCCTTAAGCTACTCCAC GGTACTGAAGGAAGCAATCTAAAAGTCA‐3′
	Reverse primer a	5′‐ CCATTACAACCCAAAAAAAAAAAAAAAAA GGTACTGAAGGAAGCAATCTAAAAGTCA‐3′
P. vivax	Reverse primer	5’‐ CCATTACTTGCCTTATACTACTCCAC CAATCTAAGAATAAACTCCGAAGAGAAAATT‐3′
	Reverse primer a	5′‐ CCATTACAACCCTTATAAAAAAAAAAAAA CAATCTAAGAATAAACTCCGAAGAGAAAATT‐3′
P. malariae	Reverse primer	5′‐ CCATTACTACCCTTATACTACTCCAC GGAAGCTATCTAAAAGAAACACTCATATATAAGAAT‐3′
	Reverse primer a	5′‐ CCATTACAACCCTTATACTAAAAAAAAAA GGAAGCTATCTAAAAGAAACACTCATATATAAGAAT‐3′
P. ovale	Reverse primer	5′‐ CCTATCTCTTAACCTCCACTGCTTTCAC CAATCTAAGAAATTTCCCCRAAAGGAATT‐3′
	Reverse primer a	5′‐ CCATTACAACCCTTATACTACTCAAAAAA CAATCTAAGAAATTTCCCCRAAAGGAATT‐3′
P. knowlesi	Reverse primer	5′‐ CCTATCTCGTAACCTCCACCCCTTTCAC CTAAGAGTTCTAATCTCCGGAGAGAAAAGAA‐3′
	Reverse primer a	5′‐ CCATTACAACCCTTATACTACTCCACAAA CTAAGAGTTCTAATCTCCGGAGAGAAAAGAA‐3′
RNase P	Forward primer	5′‐CCATCAACCACGCCATCAACAT‐3′
	Reverse primer	5′‐ CCTATCTCTCAACCTCCACCCCTTTCAC TTGGGTGTGACCCTGAAGACTC‐3′
	Reverse primer a	5′‐ CCATTACAACCCTTATACTACTCCACCCA TTGGGTGTGACCCTGAAGACTC‐3′
‐	Universal probe 1	5′‐FAM‐CCATTACAACCCTTATACTACTCCAC‐P or ‐BHQ1‐3′
‐	Universal probe 2	5′‐HEX‐CCTATCTCTCAACCTCCACCCCTTTCAC‐P or ‐BHQ1‐3′
‐	Universal probea	5′‐FAM‐CCATTACAACCCTTATACTACTCCACCCA‐P‐3′

^a All primers and probes were used in the final Plasmodium UP‐MCA assay, except for those primers and probes labelled with asterisks. Reverse primers and probes were replaced by those labelled with asterisk marks in the assay, which was used to validate that different Tm values could be produced by the effective length of hybridization between the cTag and probe. The latter also achieved six different targets in the multiplex Plasmodium UP‐MCA detection assay. Underlined and bold parts represent homologous tag sequences. P represents the labelled phosphate group.

Establishment of the UP‐MCA for species‐specific plasmodium detection assay

To achieve Plasmodium detection, optimizations were implemented by the assay of polymerase enzymes (Taq DNA Polymerase, TaKaRa Taq HS, Vent® (exo‐) DNA Polymerase), Klenow fragment (3′ → 5′ exo‐), buffers (Taq buffer, Taq HS buffer, in‐lab‐prepared buffer – buffer 1, buffer 2, buffer 3, and buffer 4, initial concentrations of all were 10×), temperature (54–66°C), and concentration of Mg²⁺ (3–6 mM) and primers. Furthermore, Extreme Thermostable Single‐Stranded DNA Binding Protein (ET SSB, New England Biolabs) was also taken into consideration for the optimization of the assay.

For the single plex assay, a reaction volume of 25 μL including 1 × Taq HS buffer, 1.5 U TaKaRa Taq HS (5 U/μL), 4 mM MgCl₂, 200 μM dNTP (A/G/C/T), 0.2 μM universal fluorescence probe, 0.8 μM abundant forward primer, 0.04 μM limited reverse primer, 2 μL template was used. The assay was carried out using the standard two‐step PCR protocol with an initial denaturation at 95°C for 3 min, followed by 50 cycles of denaturation at 95°C for 15 s, annealing/extension at 60°C for 45 s, followed by fluorescence collection in the process of MCA from 35°C to 85°C after denaturation at 95°C for 1 min and hybridization at 30°C for 2 min. Annealing/extension temperature was replaced with 64°C and 4 ng/μL ET SSB was added for multiplex species‐specific Plasmodium detection assays. The reaction was performed on a CFX96 DeepWell Real‐Time PCR System (Bio‐Rad).

The detection result was determined using the fluorescence channel and preset Tm value. The positive result of the sample for the detailed target was refined as the –d(RFU)/dT value of melting peak height, which was 1.5 times more than that of the negative control, where RNase‐free water or non‐Plasmodium DNA or RNA served as the reaction template.

Performance evaluation of the UP‐MCA assay (including sensitivity, specificity, selectivity, and clinical performance) for Plasmodium detection

To evaluate the sensitivity of UP‐MCA for species‐specific Plasmodium detection assays, a template was used by a series of gradient dilutions of various Plasmodium plasmids from 10⁵ copies/μL to 10¹ copies/μL. They were run in triplicate. Pathogens with similar clinical symptoms or blood‐borne diseases, including Babesia, Borrelia burgdorferi, Chikungunya virus, human immunodeficiency virus, Hepatitis B virus, Hepatitis C virus, and SARS‐CoV‐2 virus, were used to assess the specificity of this UP‐MCA assay. To examine the selectivity and discriminability of species‐specific Plasmodium detection assays, two adjacent targets in the same fluorescence channel, Pf and Pv, were investigated for the detection accuracy of Plasmodium species. Furthermore, a negative control of RNase‐free water or non‐Plasmodium genome, which served as the template for the Plasmodium assay, was applied for the above three tests.

Practically, the performance evaluation of the species‐specific Plasmodium detection assay was carried out using a multiplex UP‐MCA fluorescence system using 226 clinical blood samples mentioned above, including 164 microscopy‐positive and 62 microscopy‐negative for malaria. All microscopy results of the clinical blood samples were blinded to the assay tester. Various plasmid standards at a concentration of 100 copies/μL served as the positive control for the assay, and RNase‐free water was used as the negative control.

Data analysis

To analyse the performance of our UP‐MCA assay, microscopy was used as the gold standard. All data were analysed using OriginLab version 8.0, GraphPad Prism, and SPSS version 2.2. Each experiment was repeated at least thrice for each sample.

RESULTS

Principle of universal two‐dimensional label system for species‐specific Plasmodium detection

Two‐dimensional labelled probe‐mediated melting curve analysis is a post‐PCR method, and the results were simultaneously analysed using fluorescence channel (s) and Tm value (s). To improve the ratio of signal to noise in the MCA, asymmetric PCR was performed to obtain a massive single‐stranded DNA amplicon for better hybridization between the fluorescent probe and homologous cTag, which was different from the symmetric PCR used in 2D PCR. Moreover, to further simplify primer design and minimize optimization of the assay for sensitivity improvement, we designed a forward primer for the Plasmodium genus as the abundant primer and one reverse primer with a tag at the 5′ end for each Plasmodium species as the limiting primer for multiplex and asymmetric PCR to genotype Plasmodium. Ultimately, six primers of Plasmodium, including one forward primer, five reverse primers, and one primer pair of RNase P, were designed and synthesized based on the SSU rRNA gene for use in the final species‐specific Plasmodium detection assay. For the universal fluorescent probe, we demonstrated that different probe‐quenching methods, namely base‐quenched and self‐quenching, could be used for UP‐MCA analysis (Figure 2A). They have the same sensitivity and specificity for the detection assay because they have the same sequence and differ in fluorescence labelling. Therefore, we randomly selected one probe, the base‐quenched probe, which was also cheaper than the self‐quenching probe for synthesis, for follow‐up studies. Furthermore, different oligonucleotide lengths for hybridization with a fluorescent probe can also produce diverse Tm values during MCA. We speculated and verified that the strategy of controlling the effective hybridization length of the tag, which is the diverse actual hybridization length of the cTag and probe, could also be used for genotyping five Plasmodium species via single plex and multiplex detection assays (Figure 2B).

FIGURE 2.

Performance of different kinds of quenching methods for probe and hybridization with different actual cTag lengths. Performance of base‐quenched probe and self‐quenching probe for UP‐MCA assay (A). Performance of only one universal probe (universal probe 3) depending on the effective length of hybridization with cTag for six targets detection using singleplex (Left) or multiplex (Right) UP‐MCA assay of a single fluorescence channel (B).

Optimization of UP‐MCA assay for species‐specific Plasmodium detection

To improve the detection efficiency, potential factors were optimized using different enzymes, buffers, reaction temperatures, and concentrations of Mg²⁺. We found that the enzyme and buffer were the most important factors for the detection efficiency of the species‐specific Plasmodium UP‐MCA assay. The hot‐start enzyme TaqHS and the corresponding buffer showed the best performance for the Plasmodium detection assay (Figure S1). Additionally, the assay displayed a higher ratio of signal to noise at the parameters of 4 mM Mg²⁺ and 63°C anneal/extension temperature (Figure S2A,B) using the same concentration of target for multiplex Plasmodium detection. Surprisingly, ET SSB, which served as an enhancer for amplification specificity, seldomly seemed to function in the multiplex species‐specific Plasmodium UP‐MCA assay (Figure S2C).

Performance of the Plasmodium UP‐MCA detection assay (including sensitivity, specificity, and selectivity)

To evaluate the sensitivity of the Plasmodium UP‐MCA assay, a series of gradient concentrations of diluted plasmids of Plasmodium species and human RNase P gene as a template were tested. The results showed that the signal of each target decreased gradually following a decrease in the plasmid concentration. The LOD for each target was 10 copies/μL, except for Pm (100 copies/μL; Figure 3A). This nearly achieved the LOD proposed by the WHO.

FIGURE 3.

Performance of Plasmodium UP‐MCA assay. The sensitivity of Plasmodium UP‐MCA assay, including targets of Pf, Pv, Pm, Po, and Pk and internal control of RNase P (A). The specificity of Plasmodium UP‐MCA assay. The pathogens used for specificity investigation include Babesia, Borrelia burgdorferi, Chikungunya virus, human immunodeficiency virus, Hepatitis B virus, Hepatitis C virus, SARS‐CoV‐2 virus, and Plasmodium species (B). The selectivity of Pf and Pv for the final Plasmodium UP‐MCA detection assay (C).

To assess the specificity of the Plasmodium UP‐MCA detection assay, the genomes of samples from some blood‐borne diseases, which have similar clinical symptoms or signs to malaria, were tested. Three duplicates were performed, and 100 copies of plasmid standards were used as the positive control for each test. Consequently, there were no Plasmodium‐positive results for the tested samples (Figure 3B), indicating that the species‐specific Plasmodium UP‐MCA assay had high specificity for detecting the five plasmodia.

To investigate the selectivity of the Plasmodium UP‐MCA detection assay, Pf and its adjacent Pv from the same fluorescent channel were selected to test the accuracy of this assay. Specifically, different ratios of Pf and Pv standards under the 100 copies concentration range from 0:100, 1:99, 3:97, 5:95, 10:90, 20:80, 50:50, 80:20, 90:10, 95:5, 97:3, 99:1, and 100:0 were prepared and analyzed using the multiplex Plasmodium detection assay. The result showed that the assay could accurately detect and discriminate between adjacent species of Plasmodium (Figure 3C). Therefore, the assay has an excellent discrimination ability for different Plasmodium species, including adjacent Plasmodium species.

Clinical performance using plasmodium UP‐MCA detection assay

To evaluate the clinical diagnostic performance of the Plasmodium UP‐MCA detection assay, 226 patient samples (164 positive and 62 negative for microscopy), which had been confirmed by microscopy as the gold standard method for malaria, were tested by a tester who was blinded to the microscopic results. The results were 164 Plasmodium‐positive and 62 Plasmodium‐negative using the Plasmodium UP‐MCA assay (examples shown in Figure 4), which were all consistent with the results of Plasmodium microscopy. Compared with the gold standard detection method, the Plasmodium UP‐MCA assay showed 100% of the sensitivity and specificity (Table 2).

FIGURE 4.

Example of clinical sample detection of Plasmodium UP‐MCA assay.

TABLE 2.

Results of UP‐MCA assay and microscopy for Plasmodium detection.

Reference method	Results	UP‐MCA assay		Total
		Positive	Negative
Microscopy	Positive	164	0	164
	Negative	0	62	62
	Total	164	62	226

DISCUSSION

Polymerase chain reaction is one of the most widely used molecular biology detection methods and has the advantages of high sensitivity, specificity, simplicity, rapidity, and low cost, particularly for real‐time quantitative PCR. It has been used in many fields, including pathogen detection, tumour marker detection, and genetic identification. We successfully constructed a Plasmodium UP‐MCA assay of two fluorescent channels, which were sensitive and specific for detecting five major Plasmodium species, as well as the internal control RNase P gene. The assay can be performed rapidly (nearly 2.5 h, consisting of half an hour for genome extraction and 2 h for amplification and melting curve analysis) in a single closed tube. The 384‐well and 96‐well formats both achieve high detection throughput, which meets the requirements of large‐scale clinical sample detection and epidemiologic studies of imported malaria.

Gene targets for genotyping Plasmodium species were rigorously investigated based on previously published studies. Specific regions of the SSU rRNA gene of Plasmodium were carefully applied to the primer design of multiplex PCR. Only six primers were designed for the detection of five Plasmodium species to reduce the primer number under the prerequisite of fully ensuring specificity, which leads to less optimization for the improvement of detection efficiency. Optimizations for the Plasmodium species‐specific detection assay were still carried out, including key factors of specific primers, enzymes, and the best‐matching buffer. For the UP‐MCA assay, engineered fluorescent probes are not directly specific to the sequence of the target gene. They strictly targeted the complementary sequences of homologous tags. It is helpful for the assay to improve the resistance to mutations or SNPs that potentially exist in the probe hybridization region of the target. Theoretically, this can increase the sensitivity of the Plasmodium detection assay. Moreover, except for the design strategy of point mutations in the tag, we also explored and verified that diverse actual lengths of hybridization between cTag and fluorescent probes, which also represent different Tm values, can be applied in a two‐dimensional labelling design. This strategy made the design of probes and homologous tags significantly easier, and the predicted Tm values were closer to reality. Additionally, the distribution of Tm values for detailed targets would be further homogenized within a limited temperature range, and the detection throughput would be further improved. It has the great advantages of cost‐saving and throughput improvement for the design of two‐dimensional label systems.

The limitations of the Plasmodium UP‐MCA detection assay were also demonstrated. First, there were only five Plasmodium species of the genotype in a single closed tube. It cannot entirely demonstrate the detection ability of the UP‐MCA detection assay, including using the strategy of diverse actual lengths of hybridization, especially with respect to detection throughput. In addition, the limited targets seem to be the reason why ET SSB did not significantly improve the specificity of the assay. More targets should be validated to determine the strength of the UP‐MCA method. Second, the specificity of the UP‐MCA assay for genotyping Plasmodium species relies entirely on reverse primers and tags. Any non‐specific amplification that occurs in the reverse primers, including primer dimers, may lead to false‐positive results. Therefore, it is important to carefully design the reverse primers with tag sequences. Thirdly, the UP‐MCA assay is a half‐quantitative multiplex detection method. The quantitative analysis of Plasmodium species cannot be achieved accurately. Furthermore, more clinical samples collected from multiple centres should be incorporated into the assay for validation of clinical performance.

In summary, we developed an easy, fast, and accurate species‐specific Plasmodium detection assay with high sensitivity, specificity, and selectivity as an alternative method to microscopy, which can genotype five Plasmodium species in a single closed tube after genome extraction. This is important and helpful to increase the ability to eliminate imported malaria derived from regions or cities with frequent communication due to economy or population emigration and immigration, especially under the malaria control plan proposed by the WHO.

AUTHOR CONTRIBUTIONS

Haipo Xu: Conceptualization; funding acquisition; investigation; methodology; data analysis; writing – original draft. Yupeng Sun: Data analysis. Xiaolong Zhang: Methodology; data analysis. Ronghua Chen: Methodology. Zhixiong Cai: Data analysis. Bixing Zhao: review and editing. Xiaolong Liu: Conceptualization; project administration; supervision; writing – review and editing. Jingfeng Liu: Funding acquisition; project administration; resources; supervision.

CONFLICT OF INTEREST

All authors confirm that there are no competing interests to declare.

Supporting information

Appendix S1

Xu, H. , Sun, Y. , Zhang, X. , Chen, R. , Cai, Z. , Zhao, B. et al. (2023) Universal two‐dimensional labelled probe‐mediated melting curve analysis based on multiplex PCR for rapid typing of Plasmodium in a single closed tube. Microbial Biotechnology, 16, 838–846. Available from: 10.1111/1751-7915.14232