LAMP‐2A ablation in hippocampal CA1 astrocytes confers cerebroprotection and ameliorates neuronal injury after global brain ischemia

Abstract

Reactive astrogliosis and neuronal death are major features of brain tissue damage after transient global cerebral ischemia/reperfusion (I/R). The CA1 subfield in the hippocampus is particularly susceptible to cell death after I/R. Recently, attention has focused on the relationship between the autophagy–lysosomal pathway and cerebral ischemia. Lysosomal‐associated membrane protein type‐2A (LAMP‐2A) is a key protein in chaperone‐mediated autophagy (CMA). However, LAMP‐2A expression in astrocytes of the hippocampus and its influence on brain injury following I/R remain unknown. Here, we show that LAMP‐2A is elevated in astrocytes of the CA1 hippocampal subfield after I/R and in primary cultured astrocytes after transient oxygen–glucose deprivation (OGD). Conditional LAMP‐2A knockdown in CA1 astrocytes inhibited astrocyte activation and prevented neuronal death by inhibiting the mitochondrial pathway of apoptosis after I/R, suggesting that elevated astrocytic LAMP‐2A contributes to regional ischemic vulnerability. Furthermore, astrocytic LAMP‐2A ablation ameliorated the spatial learning and memory deficits caused by I/R. Conditional astrocytic LAMP‐2A knockdown also prevented the loss of hippocampal synapses and dendritic spines, improved the synaptic ultrastructure, and inhibited the reduced expression of synaptic proteins after ischemia. Thus, our findings demonstrate that astrocytic LAMP‐2A expression increases upon I/R and that LAMP‐2A ablation specifically in hippocampal astrocytes contributes to cerebroprotection, suggesting a novel neuroprotective strategy for patients with global ischemia.

Hippocampal astrocytic LAMP‐2A knockdown inhibits astrocyte activation, maintains the integrity of neuronal morphology, and ameliorates cognitive deficits after transient global cerebral ischemia.

1. INTRODUCTION

Cardiopulmonary arrest is accompanied by global cerebral ischemia and is one of the leading causes of death and disability. Although rapid resuscitation after cardiac arrest restores oxygen and glucose delivery to the brain, survivors can experience cognitive impairments [1]. Transient global cerebral ischemia can result in delayed neuronal death in the vulnerable CA1 hippocampal subregion, and that may play a key role in the onset of cognitive impairments [2]. Determining the cellular and molecular events underlying the cognitive decline induced by transient global cerebral ischemia may lead to strategies for improving neurological outcomes.

After an ischemic stroke, astrocytes undergo a pronounced transformation called reactive astrocytosis and form a glial scar [3]. Astrocytes are well known for their supportive roles in the brain, including maintaining ion homeostasis, supplying energy to neurons, clearing neurotransmitter, and structurally, they have a close association with synapses [4]. Moreover, astrocytes are actively involved in normal memory functions as well as in the abnormal processes leading to cognitive impairment under pathological conditions [5, 6]. However, the precise role of reactive astrocytes in cognitive impairment and functional recovery after cerebral ischemia is largely unknown.

Lysosomal‐associated membrane protein type‐2A (LAMP‐2A) is one of three splice variants of a single gene, LAMP2 [7]. LAMP‐2A, LAMP‐2B, and LAMP‐2C have identical luminal regions but different transmembrane and cytosolic regions [8, 9]. LAMP‐2A is the only one of the three isoforms required for chaperone‐mediated autophagy (CMA), a cellular process that allows the selective degradation of cytosolic substrate proteins that contain a peptide sequence biochemically related to Lys–Phe–Glu–Arg–Gln (KFERQ) [10, 11]. CMA dysfunction has been implicated in the pathogenesis of neurodegenerative brain diseases, including Parkinson's disease and Alzheimer's disease. The level of LAMP‐2A is a biochemical hallmark of CMA activity. Conditional LAMP‐2A knockdown leads to accumulation of CMA‐specific substrates in the presynaptic membrane [12]. More importantly, increased LAMP‐2A levels have been found in cortical neurons during the late stage of permanent focal cerebral ischemia [13]. However, the expression of LAMP‐2A in astrocytes of the hippocampus and its influence on synaptic plasticity in the CA1 hippocampal subfield and cognitive impairments after transient global brain ischemia remain to be elucidated.

In the present study, we examined the expression of LAMP‐2A in the rat CA1 hippocampal subregion after transient global ischemia and in primary cultured astrocytes after transient oxygen–glucose deprivation (OGD). We also investigated whether and how astrocytic LAMP‐2A contributes to cognitive dysfunction and selective ischemic vulnerability in the hippocampus. Our data provide evidence that LAMP‐2A deficiency in astrocytes protects against ischemia‐induced deficits in learning and memory by preventing degradation of hippocampal synapses and dendritic spines and by maintaining a normal level of synapse‐associated proteins after ischemia. Conditional LAMP‐2A knockdown in CA1 astrocytes inhibited the activation of astrocytes and prevented neuronal death by inhibiting the mitochondrial pathway of apoptosis after ischemia/reperfusion (I/R). Together, our results suggest that astrocytic LAMP‐2A plays an important role in the global ischemic brain.

2. RESULTS

2.1. LAMP‐2A expression in astrocytes increased in rat CA1 hippocampal subfield after transient global ischemia and transient OGD

First, the expression level of LAMP‐2A after global brain ischemia was measured by quantitative real‐time PCR (qRT‐PCR) and immunoblotting analyses. A schematic representation of the sampling site for hippocampal CA1 tissues is shown in Figure 1A. Both mRNA (one‐way ANOVA followed by Tukey's test, F _[3,16] = 184.3, p < 0.0001, Figure 1B) and protein (one‐way ANOVA followed by Tukey's test, F _[2,6] = 19.33, p = 0.0024, Figure 1C1,C3) expression levels of LAMP‐2A were consistently upregulated 24 and 48 h in the hippocampus after I/R. Meanwhile, glial fibrillary acidic protein (GFAP) in the CA1 subregion increased after I/R (one‐way ANOVA followed by Tukey's test, F _[2,6] = 7.597, p = 0.0286, Figure 1C2), consistent with previous studies [14, 15]. Subsequently, we conducted immunofluorescence analysis to evaluate the level of LAMP‐2A and GFAP in CA1 astrocytes after I/R. As shown in Figure 1D, E, there was a significant increase of LAMP‐2A intensity in GFAP⁺ cells in the hippocampal CA1 subregion after I/R compared with the Sham group (unpaired t test, p < 0.0001). To verify the increase in astrocytic LAMP‐2A levels upon I/R, we measured LAMP‐2A expression in primary cultured cortical astrocytes in response to OGD, a well‐established in vitro model of brain ischemia [16]. Similar to the results in vivo, sustained increases in LAMP‐2A and GFAP were observed in cultured astrocytes after OGD (Figure 1F, LAMP‐2A: one‐way ANOVA followed by Tukey's test, F _[2,6] = 69.44, p < 0.0001; GFAP: one‐way ANOVA followed by Tukey's test, F _[2,6] = 29.04, p = 0.0008). These results suggest that elevated LAMP‐2A expression in astrocytes may be linked to the susceptibility of hippocampal CA1 neurons to cell death after transient global ischemia.

FIGURE 1.

LAMP‐2A in astrocytes is elevated in the rat CA1 hippocampal subfield after transient global ischemia and transient OGD. (A) Schematic representation of the CA1 sampling site and image capture site for astrocytes in the hippocampus. (B) qRT‐PCR analysis of Lamp‐2a transcripts in rat hippocampal CA1 from rats subjected to ischemia and reperfusion (I/R). The levels of Lamp‐2a mRNA 6, 24, and 48 h after I/R were normalized to the level in the Sham group. One‐way ANOVA followed by Tukey's test, F _[3,16] = 184.3; Sham versus I/R 6 h, I/R 24 h, and I/R 48 h, ****p < 0.0001, n = 5 for each group. (C1–C3) Immunoblot analysis of GFAP and LAMP‐2A levels in hippocampal CA1 24 and 48 h after I/R (C1). Actin was used as an internal control. The levels of GFAP and LAMP‐2A were normalized to the respective Sham groups (C2–C3). GFAP: One‐way ANOVA followed by Tukey's test, F _[2,6] = 7.597; Sham versus I/R 24 h, *p = 0.0394, Sham versus I/R 48 h, *p = 0.0305; LAMP‐2A: One‐way ANOVA followed by Tukey's test, F _[2,6] = 19.33; Sham versus I/R 24 h, **p = 0.0037, Sham versus I/R 48 h, **p = 0.0045, n = 3 rats for each group. (D) Representative images showing GFAP (green) and LAMP‐2A (red) immunofluorescence in the CA1 hippocampal region at I/R24h. The white arrows indicate LAMP‐2A aggregates in astrocytes. Scale bar = 50 μm. (E) Quantitative analysis of LAMP‐2A intensity in GFAP⁺ cells in the hippocampal CA1 subregion in the Sham and I/R24h groups. N = 30 cells from 5 rats in each group. Unpaired t test, ****p < 0.0001, t (58) = 6.642. (F) Immunoblot analysis of GFAP and LAMP‐2A levels in primary astrocyte cultures after OGD. Actin was used as an internal control. The levels of GFAP and LAMP‐2A were normalized to their respective control (Con) groups. GFAP: One‐way ANOVA followed by Tukey's test, F _[2,6] = 29.04; Con versus OGD/R6h, **p = 0.0012, Con versus OGD/R24h, **p = 0.0017; LAMP‐2A: One‐way ANOVA followed by Tukey's test, F _[2,6] = 69.44; con versus OGD/R6h, ****p < 0.0001, con versus OGD/R 24 h, ***p = 0.0003, n = 3 for each group.

2.2. LAMP‐2A ablation in hippocampal astrocytes inhibits astrocyte activation induced by transient global ischemia

To determine the contribution of astrocytic LAMP‐2A to the activation of astrocytes in the hippocampus after transient global ischemia, we conducted conditional gene silencing by injecting an adeno‐associated virus (AAV) containing Lamp‐2a shRNA driven by an astrocyte‐specific promoter (AAV‐GFAP‐shLamp‐2a‐EGFP) into the rat CA1 hippocampal subfield 7–8 weeks before I/R (Figure 2A). As shown in Figure 2B, the CA1 astrocytes infected with AAV‐GFAP‐shLamp‐2a had a significantly reduced level of LAMP‐2A. This suggests that AAV‐GFAP‐shLamp‐2a successfully knocked down LAMP‐2A in CA1 astrocytes. Next, we conducted GFAP immunofluorescence to investigate whether downregulation of astrocytic LAMP‐2A influences the activation of astrocytes after acute I/R. GFAP⁺ puncta were significantly increased in the CA1 region after I/R, but this increase was blocked in the LAMP‐2A knockdown group (one‐way ANOVA followed by Tukey's test, F _[3,16] = 43.39, p < 0.0001, Figure 2C, D). In fact, the total number of astrocytes was not changed after I/R or astrocytic LAMP‐2A knockdown (one‐way ANOVA followed by Tukey's test, F _[3,20] = 0.8767, p = 0.4697, Figure 2E). When brain ischemia occurs, astrocytes respond by changing their morphology and transform from normal resting astrocytes (small cell bodies with bush‐like processes) into reactive astrocytes (hypertrophied with bulky cytoplasm and thick processes). As shown in Figure 2F, G, astrocytic LAMP‐2A knockdown restored the number of resting astrocytes to the Sham level (one‐way ANOVA followed by Tukey's test, F _[3,20] = 28.85, p < 0.0001, Figure 2F) and decreased the number of activated astrocytes (one‐way ANOVA followed by Tukey's test, F _[3,20] = 80.39, p < 0.0001, Figure 2G) in the hippocampal CA1 subregion after IR. GFAP immunoblotting showed that LAMP‐2A knockdown reversed the elevated level of GFAP induced by I/R (Figure 2H, one‐way ANOVA followed by Tukey's test, F _[3,8] = 17.5, p < 0.0001). These findings strongly suggest that hippocampal astrocytic LAMP‐2A contributes to the activation of astrocytes in the hippocampus after global cerebral ischemia.

FIGURE 2.

Knockdown of LAMP‐2A in astrocytes protects against astrocyte activation after transient global ischemia. (A) Schematic representation of the viral injections and image capture site for astrocytes in the hippocampal CA1 subregion. (B) GFAP (green) and LAMP‐2A (red) immunofluorescence in the rat CA1 hippocampal region after inhibition of astrocytic LAMP‐2A by AAV‐GFAP‐shLamp‐2a. Cells infected with the AAV‐GFAP‐shLamp‐2a are shown in white. Scale bar = 20 μm. (C) Representative images showing GFAP immunofluorescence in the rat CA1 hippocampal region 24 h after I/R (I/R24h). Scale bar = 30 μm. (D) The number of GFAP‐positive puncta is presented as fold change relative to the Sham group. The results were calculated by one‐way ANOVA followed by Turkey's test, F _[3,16] = 43.39; Sham versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, I/R + GFAP‐shLamp‐2a versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, Sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.8936, I/R versus I/R + GFAP‐shNC, n.s., p = 0.9773; n = 5 images from 5 rats for each group. (E–G) Number of GFAP⁺ astrocytes (E), resting astrocytes (F), and activated astrocytes (G) in 0.1 μm² of hippocampal CA1 subreigon. GFAP⁺ astrocytes: One‐way ANOVA followed by Tukey's test, F _[3,20] = 0.8767, n.s., p = 0.4697. Resting astrocytes: One‐way ANOVA followed by Tukey's test, F _[3,20] = 28.85; Sham versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, I/R and I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a: ***p = 0.002; I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a: ***p = 0.003, I/R versus I/R + GFAP‐shNC, n.s., p = 0.9997; Sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.1474. Activated astrocyts: One‐way ANOVA followed by Tukey's test, F _[3,20] = 80.39; Sham versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, I/R and I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a: ****p < 0.0001; I/R versus I/R + GFAP‐shNC: N.s., p = 0.3500; sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.0519. N = 6 images from 5 rats for each group. (H) Immunoblot analysis of LAMP‐2A and GFAP in the CA1 region at I/R24h when astrocytic LAMP‐2A was inhibited by AAV‐GFAP‐shLamp‐2a. Actin served as an internal control. The levels of LAMP‐2A and GFAP were normalized to their respective Sham groups. LAMP‐2A: One‐way ANOVA followed by Tukey's test, F _[3,8] = 62.31; Sham versus I/R, ****p < 0.0001, Sham versus I/R + GFAP‐shNC, **p = 0.0011, I/R and I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a: ****p < 0.0001, Sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.0540, I/R versus I/R + GFAP‐shNC, n.s., p = 0.1015; GFAP: One‐way ANOVA followed by Tukey's test, F _[3,8] = 17.5; Sham versus I/R, **p = 0.0027, Sham versus I/R + GFAP‐shNC, **p = 0.0015, I/R versus I/R + GFAP‐shLamp‐2a: *p = 0.0152, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, **p = 0.0079, Sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.5369, I/R versus I/R + GFAP‐shNC, n.s., p = 0.9556. N = 3 rats for each group.

2.3. LAMP‐2A ablation in astrocytes reverses the cognitive impairment induced by global cerebral ischemia

Hippocampal pyramidal neurons in the CA1 subregion play a critical role in spatial learning and memory [17, 18]. To explore whether LAMP‐2A knockdown in astrocytes affects learning and memory after transient global cerebral ischemia, rats were tested in the Morris water maze (MWM) and in a contextual fear conditioning test. The experimental timeline for the MWM is shown in Figure 3A. The escape latency for rats in all four groups decreased in a time‐dependent manner over the five hidden‐platform training sessions, indicating that the rats progressively learned the task (Figure 3B). However, compared with the Sham group, I/R rats showed a prolonged escape latency, suggesting that global ischemia impaired spatial learning from the second training day onward (two‐way repeated measures ANOVA followed by Tukey's test, F _[4,25] = 62.31, p < 0.0001, Figure 3B). Interestingly, the rats with knockdown of LAMP‐2A took significantly less time to find the platform on Days 10 and 11, compared with the I/R + GFAP‐shNC rats (Figure 3B). There was no significant difference between the escape latency of I/R rats and rats in I/R + GFAP‐shNC group (Figure 3B). In the probe trial, the platform was removed, and the length of time that the rats stayed in the target quadrant (where the platform had previously been positioned) was recorded. Compared with the Sham group, I/R induced a reduction in the time spent in the target quadrant (Figure 3C). However, rats with LAMP‐2A knockdown spent significantly more time in the target quadrant than the I/R + GFAP‐shNC groups and there was no significant difference between the Sham and AAV‐GFAP‐shLamp‐2a‐treated groups (one‐way ANOVA followed by Tukey's test, F _[3,20] = 70.96; p < 0.0001, Figure 3C). Notably, there were no significant differences in swimming speed among the groups during probe trial (one‐way ANOVA followed by Tukey's test, F _[3,20] = 0.5182; p = 0.6746, Figure 3D). The swimming paths of the rats in each group during the Morris water maze were shown as Figure 3E.

FIGURE 3.

Astrocytic LAMP‐2A deficiency prevents deficits in spatial learning and memory induced by global cerebral ischemia. (A) Schematic representation of the experimental design of the Morris water maze (MWM) test. (B) Escape latency for rats to find the platform on the seventh to the 11th day after transient global brain ischemia (I/R). Two‐way repeated measures ANOVA followed by Tukey's test: Day 8, Sham versus I/R and I/R + GFAP‐shNC: ****p < 0.0001; day 9, Sham versus I/R, ***p = 0.0007, Sham versus I/R + GFAP‐shNC, ***p = 0.0005; Day 10, Sham versus I/R, ***p = 0.0003, Sham versus I/R + GFAP‐shNC, ***p = 0.0002; Day 11, Sham versus I/R, **p = 0.0018, Sham versus I/R + GFAP‐shNC, ***p = 0.0001; I/R versus I/R + GFAP‐shNC: Day 7, n.s., p = 0.9808, Day 8, n.s., p = 0.0017, Day 9, n.s., p = 0.9995, Day 10, n.s., p = 0.9991, Day 11, n.s., p = 0.8818; Day 10, I/R versus I/R + GFAP‐shLamp‐2a, ^# p = 0.0392, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, ^# p = 0.0276; Day 11, I/R versus I/R + GFAP‐shLamp‐2a, ^# p = 0.0317, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, ^## p = 0.0037. N = 6 rats for each group. (C) Time that rats spent in the target quadrant during the probe trial. One‐way ANOVA followed by Tukey's test, F _[3,20] = 70.96; Sham versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, I/R and I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a，****p < 0.0001, I/R versus I/R + GFAP‐shNC, n.s., p = 0.9985, sham versus I/R + GFAP‐shLamp‐2a，n.s., p = 0.2115; n = 6 rats for each group. (D) Swimming speed calculated for each training session during the probe trial. One‐way ANOVA followed by Tukey's test, F _[3,20] = 0.5182, n.s., p = 0.6746; n = 6 rats for each group. (E) Swimming paths of the rats in each group during the Morris water maze. (F) Schematic representation of the experimental design of the contextual memory test. (G) Freezing time of rats in each group on the 8th day after transient global brain ischemia. One‐way ANOVA followed by Tukey's test, F _[3,20] = 10.19; Sham versus I/R, **p = 0.0015, Sham versus I/R + GFAP‐shNC, **p = 0.0014, I/R versus I/R + GFAP‐shLamp‐2a: *p = 0.0198, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, *p = 0.0185, Sham versus I/R + GFAP‐shLamp‐2a, p = 0.6678; n = 6 for each group.

Next, we used contextual fear conditioning to investigate whether knockdown of hippocampal astrocytic LAMP‐2A can prevent the impairment to contextual memory induced by global brain ischemia. The procedure for contextual fear conditioning is shown in Figure 3F. As expected, 1 day after training, I/R rats had significantly reduced freezing time than rats in the Sham group, suggesting impaired contextual memory after I/R. However, astrocytic LAMP‐2A knockdown prevented the ischemia‐induced deficit (one‐way ANOVA followed by Tukey's test, F _[3,20] = 10.19; p = 0.0003, Figure 3G). Taken together, these results suggest that hippocampal astrocytic LAMP‐2A ablation prevents the spatial and contextual memory deficits caused by global cerebral ischemia.

2.4. Astrocytic LAMP‐2A ablation promotes dendritic growth and dendritic spine formation following global cerebral ischemia

Next, we examined neuronal morphology in the CA1 subregion after astrocytic LAMP‐2A knockdown. Golgi–Cox staining was used to assay the neuronal dendrites and dendritic spines. A schematic representation of the hippocampal location selected for the analysis of dendritic crossing and spines in pyramidal neurons is shown in Figure 4A. Compared with the Sham group, I/R group had significantly fewer total intersections on both the apical and basal dendrites in hippocampal pyramidal neurons (Figure 4B). This I/R‐induced reduction in total intersections was prevented by astrocytic LAMP‐2A knockdown (two‐way ANOVA and repeated measures followed by Tukey's test, F _[11,384] = 74, p < 0.0001, Figure 4C). LAMP‐2A knockdown also had an impact on dendritic spines of pyramidal neurons in the hippocampus after transient global ischemia (Figure 4D): there were significantly fewer dendritic spines in the I/R group than in the Sham group, but this reduction was partially blocked by LAMP‐2A knockdown (one‐way ANOVA followed by Tukey's test, F _[3,69] = 26.88, p < 0.0001, Figure 4E).

FIGURE 4.

Astrocytic LAMP‐2A deficiency maintains dendritic growth, dendritic spine formation, and synaptic plasticity following global cerebral ischemia. (A) Schematic representation of the hippocampal region from which pyramidal neurons were selected for the analysis of dendritic crossings and dendritic spines. (B) Representative images of Golgi–cox‐impregnated photomicrographs of CA1 pyramidal neurons (top) and Sholl rings (bottom) of the dendritic arbors in each group. Scale bar = 20 μm. (C) Statistical analysis of the number of intersections within 120 μm of the soma. Two‐way repeated measures ANOVA followed by Tukey's test, 55 μm from soma, Sham versus I/R, ***p = 0.0001, Sham versus I/R + GFAP‐shNC, ***p = 0.0003, I/R versus I/R + GFAP‐shLamp‐2a: **p = 0.0086, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, ^# p = 0.0173; 65 μm from soma, Sham versus I/R, ***p = 0.0004, Sham versus I/R + GFAP‐shNC, ****p < 0.0001, I/R versus I/R + GFAP‐shLamp‐2a: *p = 0.0331, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, ^## p = 0.0025; 75 μm from soma, Sham versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, I/R versus I/R + GFAP‐shLamp‐2a: **p = 0.0047, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, ^## p = 0.0055; 85 μm from soma, Sham versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, I/R versus I/R + GFAP‐shLamp‐2a: *p = 0.0331, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, ^## p = 0.0047; 95 μm from soma, Sham versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, I/R versus I/R + GFAP‐shLamp‐2a: n.s., p = 0.3228, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.1531; 105 μm from soma, Sham versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, I/R versus I/R + GFAP‐shLamp‐2a: n.s., p = 0.3477, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.5354; 115 μm from soma, Sham versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, I/R versus I/R + GFAP‐shLamp‐2a: n.s., p = 0.1531, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.8069; n = 20 cells from 5 rats. (D) Representative images of dendritic spines from CA1 pyramidal neurons after global transient brain ischemia. Scale bar = 5 μm. (E) Statistical analysis of dendritic spines from randomly selected dendritic segments of pyramidal neurons. One‐way ANOVA followed by Tukey's test, F _[3,69] = 28.69; Sham versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, I/R versus I/R + GFAP‐shLamp‐2a: ***p = 0.0002, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, ****p < 0.0001, Sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.0528, n = 20 dendrites from 20 cells of 5 rats; n = 5 rats for each group.

2.5. Astrocytic LAMP‐2A ablation improves the synaptic ultrastructure and blocks the I/R‐induced decrease in synaptic proteins

We next used transmission electron microscopy (TEM) to investigate the influence of astrocytic LAMP‐2A downregulation on the number of hippocampal synapses. Similar to the results from the Golgi–Cox staining, the number of hippocampal synapses was significantly lower in the I/R group than in the Sham group, and this reduction was prevented by astrocytic LAMP‐2A ablation (Figure 5A,B, one‐way ANOVA followed by Tukey's test, F _[3,28] = 6.03, p = 0.0027). There were no significant differences in synaptic cleft width among the groups (Figure 5D, one‐way ANOVA followed by Tukey's test, F _[3,62] = 1.323, p = 0. 2749). Furthermore, the thickness of the postsynaptic density (PSD) was lower in I/R rats but was unchanged in the I/R + GFAP‐shLamp‐2a group (Figure 5C,E, one‐way ANOVA followed by Tukey's test, F _[3,60] = 6.03, p = 0.0026). To verify the effects of astrocytic LAMP‐2A downregulation on synapse‐related proteins, the expression levels of synaptophysin and PSD‐95 were examined. I/R decreased the expression of synaptophysin and PSD‐95 in the vulnerable CA1 subfield but astrocytic LAMP‐2A downregulation prevented this decrease (Figure 5F, one‐way ANOVA followed by Tukey's test, PSD95, F _[3,8] = 11.79, p = 0.0026, synaptophysin, F _[3,8] = 22.81, p = 0.0003).

FIGURE 5.

Astrocytic LAMP‐2A deficiency improves the synaptic ultrastructure and synaptic proteins in the CA1 hippocampal subregion after global cerebral ischemia. (A) Representative transmission electron microscopy images of CA1 hippocampal subregion synapses in each group after transient global brain ischemia (I/R). Scale bar = 500 nm. (B) Quantitative analysis of hippocampal synapses in the four groups. One‐way ANOVA followed by Tukey's test, F _[3,28] = 6.03; Sham versus I/R, *p = 0.0281, Sham versus I/R + GFAP‐shNC, *p = 0.0164, I/R versus I/R + GFAP‐shLamp‐2a: *p = 0.0443, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, *p = 0.0262, Sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.9994, I/R versus I/R + GFAP‐shNC, n.s., p = 0.9879. Sham: n = 9 images from 5 rats; I/R: n = 8 images from 5 rats; I/R + GFAP‐shNC: n = 7 images from 5 rats; I/R + GFAP‐shLamp‐2a: n = 8 images from 5 rats. (C) The synaptic cleft and the thickness of the PSD in the hippocampus CA1 subregion after transient global brain ischemia. Scale bar = 40 nm. (D) Quantitative analysis of the width of the synaptic cleft in the four groups. One‐way ANOVA followed by Tukey's test, F _[3,62] = 1.323, n.s., p = 0.2749; sham: n = 18 synapses from 5 rats; I/R: n = 16 synapses from 5 rats; I/R + GFAP‐shNC: n = 15 synapses from 5 rats; I/R + GFAP‐shLamp‐2a: n = 17 synapses from 5 rats. (E) Quantitative analysis of PSD thickness in the four groups. One‐way ANOVA followed by Tukey's test, F _[3,60] = 6.03; Sham versus I/R, *p = 0.0438, Sham versus I/R + GFAP‐shNC, *p = 0.0346, I/R versus I/R + GFAP‐shLamp‐2a: *p = 0.0297, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, *p = 0.0231, Sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.9972, I/R versus I/R + GFAP‐shNC, n.s., p > 0.9999. Sham: n = 17 synapses from 5 rats; I/R: n = 15 synapses from 5 rats; I/R + GFAP‐NC: n = 16 synapses from 5 rats; I/R + GFAP‐shLamp‐2a: n = 16 synapses from 5 rats (F) Immunoblot analysis of PSD95 and synaptophysin in CA1 after I/R when astrocytic LAMP‐2A was inhibited by AAV‐GFAP‐shLamp‐2a. PSD95: One‐way ANOVA followed by Tukey's test, F _[3,8] = 11.79; Sham versus I/R, *p = 0.0128, Sham versus I/R + GFAP‐shNC, **p = 0.0047, I/R versus I/R + GFAP‐shLamp‐2a, **p = 0.0475, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, *p = 0.0161, sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.7752, I/R versus I/R + GFAP‐shNC, n.s., p = 0.8579. Synaptophysin: One‐way ANOVA followed by Tukey's test, F _[3,8] = 22.81; Sham versus I/R, ***p = 0.0005, Sham versus I/R + GFAP‐shNC, **p = 0.0025, I/R versus I/R + GFAP‐shLamp‐2a, **p = 0.0016, I/R+ GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, **p = 0.0092, Sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.7164, I/R versus I/R + GFAP‐shNC, n.s., p = 0.5083; n = 3 rats for each group.

These results suggest that downregulation of astrocytic LAMP‐2A contributes to the preservation of synapses in the hippocampus after transient global cerebral ischemia.

2.6. Knockdown of astrocytic LAMP‐2A protects against hippocampal neuronal apoptosis by inhibiting Bax/Bad translocation to mitochondria after transient global ischemia

Next, we further explored whether astrocytic LAMP‐2A ablation can protect against neuronal loss after global brain ischemia. Figure 6A shows the area used for image capture of CA1 pyramidal neurons. Immunofluorescence analysis of NeuN showed that LAMP‐2A ablation could prevent the loss of neurons in the hippocampal CA1 region caused by global cerebral ischemia (Figure 6B, one‐way ANOVA followed by Tukey's test, F _[3,44] = 110.2, p < 0.0001). Furthermore, immunoblotting analysis of cleaved caspase‐3 assays was conducted to evaluate apoptosis‐like neuronal death, which is prevalent in the brain following acute global cerebral ischemia [19, 20]. As shown in Figure 6C, cleaved‐caspase‐3 expression increased significantly in the CA1 region after I/R and this increase was diminished in the LAMP‐2A knockdown group (one‐way ANOVA followed by Tukey's test, F _[3,8] = 69.69, p < 0.0001). Immunofluorescence analysis of cleaved‐caspase‐3 and NeuN was used to confirm the result. As shown in Figure 6D, E, astrocytic LAMP‐2A knockdown prevented the I/R‐induced neuronal apoptosis (Figure 6E, one‐way ANOVA followed by Tukey's test, F _[3,124] = 81.42; p < 0.0001). These findings strongly suggest that hippocampal astrocytic LAMP‐2A is responsible for delayed neuronal apoptosis in the hippocampus following global cerebral ischemia.

FIGURE 6.

Knockdown of astrocytic LAMP‐2A protects against hippocampal neuronal apoptosis by inhibiting Bax/Bad translocation to mitochondria after transient global ischemia. (A) Schematic representation of the image‐capture area for pyramidal neurons in the hippocampus. (B) The density of surviving neurons was measured with immunofluorescent staining with the anti‐NeuN antibody in rat hippocampal CA1 at I/R24h. Cell density was counted as the number of surviving pyramidal neurons per 1 mm length. One‐way ANOVA followed by Tukey's test, F _[3,44] = 110.2; Sham versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, I/R and I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, ****p < 0.0001, I/R versus I/R + GFAP‐shNC, n.s., p = 0.9926, Sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.0693; n = 12 images from 5 rats for each group. Scale bar = 40 μm. (C) Immunoblot analysis of cleaved‐caspase‐3 in the CA1 hippocampal region after I/R when astrocytic LAMP‐2A was inhibited by AAV‐GFAP‐shLamp‐2a. Actin served as an internal control. The levels of cleaved‐caspase‐3 were normalized to the respective Sham groups. One‐way ANOVA followed by Tukey's test, F _[3,8] = 69.69; sham versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, I/R versus I/R + GFAP‐shLamp‐2a: ****p < 0.0001, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, ***p = 0.0001, Sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.2909, I/R versus I/R + GFAP‐shNC, n.s., p = 0.7866; n = 3 rats for each group. (D) Representative images showing cleaved‐caspase‐3 (green) and NeuN (red) immunofluorescence in the CA1 hippocampal region 24 h after I/R. Scale bar = 10 μm. (E) Quantitative analysis of the mean intensity of cleaved‐caspase‐3 in NeuN ⁺ cells in hippocampal CA1 subregion after I/R. One‐way ANOVA followed by Tukey's test, F _[3,124] = 81.42; Sham versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, I/R + GFAP‐shLamp‐2a versus I/R and I/R + GFAP‐shNC, ****p < 0.0001, Sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.5947, I/R versus I/R + GFAP‐shNC, n.s., p = 0.3677; n = 33 NeuN ⁺ cells from 5 rats for each group. (F) The purity of mitochondria isolated from the CA1 hippocampal regions. Cox4 is a mitochondrial marker; GAPDH is cytosolic marker. (G) Immunoblot analysis of Bax/Bad in mitochondrial fractions from hippocampal CA1 tissue at I/R24h in rats with or without prior AAV‐GFAP‐shLamp‐2a treatment. Cox4 was used as an internal control. The levels of Bax and Bad were normalized to the respective Sham groups. Bax: One‐way ANOVA followed by Turkey's test, F _[3,8] = 23.18; Sham versus I/R, **p = 0.0044, Sham versus I/R + GFAP‐shNC, ***p = 0.0010, I/R versus I/R + GFAP‐shLamp‐2a: **p = 0.0033, I/R + GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, ***p = 0.0008, Sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.9949, I/R versus I/R + GFAP‐shNC, n.s., p = 0.5743. Bad: One‐way ANOVA followed by Turkey's test, F _[3,8] = 22.3; sham versus I/R, **p = 0.0011, sham versus I/R + GFAP‐shNC, **p = 0.0055, I/R versus I/R + GFAP‐shLamp‐2a: ***p = 0.0008, I/R+ GFAP‐shNC versus I/R + GFAP‐shLamp‐2a, **p = 0.0042, Sham versus I/R + GFAP‐shLamp‐2a, n.s., p = 0.9960, I/R versus I/R + GFAP‐shNC, n.s., p = 0.5152; n = 3 rats for each group.

Both the intrinsic mitochondrial signaling pathway and the extrinsic death receptor pathway mediate neuronal apoptosis after global ischemia [18, 21]. To investigate the molecular mechanisms underlying astrocytic LAMP‐2A‐associated anti‐apoptotic signaling events after global ischemia, highly purified mitochondrial fractions of hippocampal CA1 region (Figure 6F) were used to detect the levels of the pro‐apoptotic proteins Bax and Bad after I/R. As shown in Figure 6G, mitochondrial Bax/Bad levels were significantly increased 24 h after I/R, compared with the Sham group. LAMP‐2A knockdown in CA1 astrocytes inhibited this I/R‐induced increase (one‐way ANOVA followed by Tukey's test, Bax, F _[3,8] = 23.18, p = 0.0003; Bad, F _[3,8] = 22.3, p = 0.0003).

These results indicate that astrocytic LAMP‐2A plays a key role in the mitochondrial translocation of Bax/Bad, which is involved in the selective neuronal apoptosis induced by global ischemia.

3. DISCUSSION

Ischemic brain damage remains the leading cause of morbidity and mortality in patients suffering from cardiac arrest with resuscitation [1]. In this study, we found that LAMP‐2A levels in astrocytes increased in the vulnerable rat CA1 hippocampal subfield after transient global ischemia and transient OGD. Knockdown of astrocytic LAMP‐2A in rats prevented global cerebral I/R‐induced cognitive decline and loss of CA1 pyramidal neurons.

Although it is well known that astrocytes become activated and undergo important morphological modifications, such as hyperplasia, proliferation, increased expression of GFAP after brain ischemia [22], the function of this activation after brain ischemia and the factors that regulate it are not fully understood. Reactive astrocytes can be a double‐edged sword after brain ischemia, with both beneficial and detrimental effects [23]. Our results suggest that activated astrocytes accompany neuronal damage after transient global brain ischemia and that reduced levels of hippocampal astrocytic LAMP‐2A can inhibit astrocytic activation and promote neuronal survival after brain ischemia. The present study provides morphological and molecular evidence that inhibiting the activation of astrocytes can reduce synaptic damage caused by cerebral ischemia. However, the mechanism by which a deficiency of LAMP‐2A in astrocytes protects neurons from injury remains unknown.

The most well‐defined role for LAMP‐2A is as a receptor for CMA, mediating the lysosomal uptake of selective substrates related to neurodegenerative diseases, including α‐synuclein and leucine‐rich repeat kinase‐2 in Parkinson's disease [24, 25, 26], tau protein in Alzheimer's disease [27], and huntingtin in Huntington's disease [28]. Patients with Parkinson's disease have reduced levels of LAMP‐2A, resulting in the accumulation of specific CMA substrates. Blocking LAMP‐2A in astrocytes leads to the accumulation of neuron‐derived CMA substrates (α‐synuclein), a hallmark of the pathology of Parkinson's disease [29]. An elevated level of LAMP‐2A in response to long‐term hypoxic stress accounts for the survival of Neuro2A cells [13]. Together with the results of this study, this suggests that astrocytic LAMP‐2A targets specific substrates and thus determines different cell fates under various pathophysiological conditions. LAMP‐2A levels have also been found to increase at a later stage of permanent focal cerebral ischemia [13]. The accumulation and assembly of LAMP2A on the lysosomal membrane is a hallmark of CMA activation; however, the activity, targeted substrates, and contribution of CMA to the neuronal survival following transient or permanent focal cerebral ischemia remain to be explored. Transient global brain ischemia resulted in increased astrocytic LAMP‐2A, which was responsible for decreased neuronal function after global brain ischemia. Thus, we speculate that abnormal expression of astrocytic LAMP‐2A would cause dysregulate astrocytic CMA, which may induce excessive clearance or accumulation of CMA‐targeted substrates, triggering neuronal death in the hippocampus after cerebral ischemia.

Neuronal damage during ischemia is concomitant with cognitive impairment. Such cognitive impairment may in fact be induced by damage to the structure and function of the hippocampus after cerebral ischemia [30, 31]. In the present study, global brain ischemia resulted in impaired spatial learning and memory, consistent with other studies [32, 33]. Moreover, conditional knockdown of LAMP‐2A in hippocampal astrocytes mitigated the ischemia‐induced spatial learning and memory deficits in the MWM and the fear‐conditioning test. However, a previous study found that LAMP‐2‐deficient mice (concurrent knockout of LAMP‐2A, LAMP‐2B, and LAMP‐2C) had impaired memory [34]. There are two possible reasons for the conflicting results: first, other memory‐related encephalic regions may be involved in the memory impairments observed in the LAMP‐2‐deficient mice; and second, the LAMP‐2B and LAMP‐2C isoforms may have a compensatory function.

Proper morphology in the surviving neurons is crucial for hippocampal function after brain ischemia. Changes in dendritic complexity and the number of spines are associated with deficits in learning and memory after brain ischemia. In the present study, the results from our analysis of dendritic morphology complemented our behavioral results: knocking down astrocytic LAMP‐2A may enhance neuroplasticity and thus contribute to improved learning and memory. Previous studies have found that I/R‐induced rapid and sustained reorganization of synaptic structures in the hippocampus [36]. Our TEM results suggest that conditional knockdown of astrocytic LAMP‐2A may prevent synaptic loss after global brain ischemia. Pre‐ and post‐synaptic proteins like synaptophysin and PSD‐95 are indicators of synaptic structure and have previously been used to evaluate neuroplasticity in other models of cerebral ischemia [37], and hippocampal neuroplasticity is associated with relevant cognitive behaviors [38, 39]. We found that I/R induced a marked decline in the levels of synaptophysin and PSD‐95 in the CA1 hippocampal subregion in rats, consistent with previous studies. Downregulation of astrocytic LAMP‐2A maintained synaptophysin and PSD‐95 at their basal levels. These results suggest that astrocytic LAMP‐2A deficiency may exert protective effects by enhancing hippocampal neuroplasticity after transient global cerebral ischemia. However, it has been reported that astrocytes themselves mediate synaptic plasticity and contribute to memory and learning [35]. Thus, hippocampal astrocytes may contribute to the recovery of learning and memory after brain ischemia by directly modulating synaptic transmission and plasticity. A complete molecular understanding of astrocyte‐neuron communication in synaptic structure and neuronal functional recovery following global brain ischemia remains to be elucidated.

Previous studies have shown that, after brain ischemia, activated astrocytes cause neuronal death by releasing pro‐inflammatory factors (TNF‐α, IL‐1α, IL‐1β), ecitotoxins and reactive oxygen species (ROS) which lead to mitochondrial‐mediated apoptosis [40]. In the present study, the mitochondrial pathway of apoptosis was involved in the process of neuronal death after brain ischemia and was accompanied by activation of astrocytes. This indicates that activated astrocyte indirectly may cause neuronal damage by releasing ROS and activating mitochondria‐mediated apoptosis. Therefore, inhibiting astrocyte activation after brain ischemia may ameliorate the damage to neuronal integrity by reducing the release of ROS and weakening the mitochondrial pathway of apoptosis. However, we cannot rule out the possibility that the inflammatory response related to astrocyte activations, excitotoxins, and other astrocyte‐derived molecules are also involved in the impairment of neuronal integrity after brain ischemia. Furthermore, activated astrocytes may regulate the neuronal integrity directly, since astrocytes have been reported to be related to synaptogenesis after ischemic stroke [41]. It is clear that in‐depth and systematic research is needed to explore both upstream and downstream mechanisms of astrocyte activation.

4. CONCLUSIONS

Our findings suggest that astrocytic LAMP‐2A is elevated in hippocampal CA1 tissue and primary cultured astrocytes after transient global cerebral ischemia and transient OGD. In line with this, astrocytic LAMP‐2A deficiency ameliorated the spatial learning and memory deficits induced by global cerebral ischemia. Conditional knockdown of astrocytic LAMP‐2A prevented the loss of hippocampal synapses and dendritic spines after ischemia and enhanced neuroplasticity by regulating synapse‐associated proteins. Furthermore, our results suggest that LAMP‐2A deficiency in astrocytes is anti‐apoptotic against delayed hippocampal neuronal death after ischemia: knockdown of LAMP‐2A prevented the translocation of the pro‐apoptotic proteins Bax and Bad to mitichondria after brain ischemia. Therefore, astrocytic LAMP‐2A may be a novel target for treating cognitive decline in patients after global ischemia.

5. MATERIALS AND METHODS

5.1. Antibodies and reagents

Rabbit anti‐LAMP‐2A (L0668) was purchased from Sigma (St. Louis, MO, USA). Mouse anti‐Actin (ab6276), anti‐Bad (ab32445), and anti‐synaptophysin (ab32127) were purchased from Abcam (Cambridge, UK). Rabbit anti‐NeuN (12943), anti‐Bax (14796), and anti‐Cox4 (4844) were purchased from Cell Signaling Technology (Danvers, MA, USA). Mouse anti‐PSD95 (CP35) was purchased from Millipore (Temecula, CA, USA). Mouse anti‐cleaved‐caspase‐3 (66470‐2‐lg), anti‐GAPDH (60004‐1‐lg) and anti‐GFAP (16825‐1‐AP) were purchased from Proteintech (Chicago, IL, USA). Alexa Fluor 488‐ and 594‐conjugated secondary fluorescent antibodies (A10067 and A11037) were purchased from Invitrogen (Carlsbad, CA, USA). Alexa Fluor 647‐conjugated secondary fluorescent antibody (A0468) was purchased from Beyotime (Beijing, China).

5.2. Experimental animals

All experiments were performed according to the guidelines of the local Animal Care and Use Committee (Approval ID: SYXK [SU] 2016–0028). Adult male Sprague–Dawley rats weighing 220–300 g were kept on a 12 h light/dark cycle with free access to food and water. All animals were randomly allocated into different treatment groups and data were assessed under blinded conditions.

5.3. Transient global cerebral ischemia

Transient global cerebral ischemia was induced by the four‐vessel occlusion method, as described previously [42]. Briefly, the vertebral arteries were electrocauterized under anesthesia (5% isoflurane for induction and 1.5%–2% isoflurane for maintenance). After 24 h for recovery, global ischemia was induced by occluding the carotid arteries with aneurysm clips for 15 min; blood flow was restored by releasing the clips. The sham operation was performed with the same surgical procedures except without occlusion of the carotid arteries. Rectal temperature was maintained at 37 ± 0.5°C during and after the ischemic insult.

5.4. Stereotaxic injection of adeno‐associated viruses

Adeno‐associated viruses (AAV) (serotypes 2/9) were packaged by OBiO Technology Corp., Ltd. (Shanghai, China). All surgical procedures were performed under isoflurane anesthesia with the animal placed in a stereotaxic frame. For the conditional knockdown of astrocytic LAMP‐2A, AAV‐GFAP‐shLamp‐2a (~ 8 × 10⁹ vg/rat) or the negative control AAV‐GFAP‐shNC was injected into the rat hippocampal CA1 region (from bregma: antero–posterior, −3.4 mm; lateral, ± 1.5 mm; depth, −2.7 mm) 7–8 weeks before global ischemia. Injections were performed with a Hamilton brain microinfusion syringe (Hamilton, Nevada, USA). After delivery of the viral vector at an injection rate of 0.1 μl/min the capillary was held in place for 5 min, retracted 0.5 mm, and, after 3 min, slowly withdrawn from the brain.

AAV‐GFAP‐shLamp‐2a: 5′‐TGCGCCATCATACTGGATATTC‐3′;

AAV‐GFAP‐shNC: 5′‐TGCTGATTCCGCCTAAAGATTC‐3′.

5.5. Sample preparation

At the indicated times after reperfusion following global ischemia (24 h, 48 h, etc.), CA1 hippocampal tissue was harvested as described previously [43]: First, the cortex covering the hippocampus was removed along the ventricle to expose the hippocampus, which was then separated from the surrounding tissues. Next, the brain regions containing CA1, CA2, and CA3 subfields were separated from the DG along the hippocampal fissure which is an easily recognizable space between the CA1 and DG subfield. Lastly, the CA1 subfield was dissected from the CA2 and CA3 subfield along the line between CA1 and CA2 subfield. The dissected CA1 subfield was frozen rapidly in liquid nitrogen and then kept at −80°C until use. All the above operations must be completed within 2 min on ice. Each unilateral CA1 subregion sample weighs 15–20 mg and was homogenized in ice‐cold homogenization buffer (in mmol/L: MOPS [pH 7.4] 50, sucrose 320, KCl 100, MgCl₂ 0.5, and protease inhibitors containing EDTA 1, EGTA 1, NaF 50, phenylmethylsulfonyl fluoride 1, benzamidine 1, and 5 μg/ml each of aprotinin, leupeptin, and pepstatin A). After centrifugation at 800 × g for 15 min at 4°C, the supernatants were collected. The Lowry method was used for protein quantitation. Samples were stored at −80°C until use.

5.6. Immunoblotting

Equal amounts of proteins were separated by SDS‐PAGE and then electro‐transferred onto nitrocellulose membrane. After blocking, the membranes were incubated overnight at 4°C with the indicated primary antibodies diluted in blocking buffer: anti‐LAMP‐2A (1:10,000), anti‐Actin (1:30,000), anti‐GFAP (1:5000), anti‐PSD95 (1:2000)，anti‐synaptophysin (1:30,000), anti‐Bad (1:10,000), anti‐Bax (1:1000), anti‐Cox4 (1:10,000), anti‐cleaved‐caspase‐3 (1:2000), anti‐GAPDH (1:20,000). After washing with Tris‐buffered saline with 0.1% Tween‐20, the membranes were incubated with the corresponding secondary antibodies for final detection. Detection was conducted by the Western Chemiluminescent HRP Substrate kit (WBKLS0500; Millipore, Darmstadt, Germany) according to the manufacturer's instructions. Protein bands were collected and analyzed with Alpha Viewer–FluorChem FC3 Software (Proteinsample, USA).

5.7. Primary astrocyte culture and OGD

For the primary astrocyte cultures, cortex from E18 Sprague–Dawley rats was isolated and dissociated, as described previously [44]. Briefly, dissected cerebral cortexes were digested with 0.25% trypsin for 10 min at 37°C and then filtered through a sterile 40‐μm nylon cell strainer. Astrocytes were suspended in DMEM/F12(1:1) (GIBCO, Thermo Fisher Scientific, Waltham, MA, USA, 11330) containing 10% heat‐inactivated fetal bovine serum (GIBCO, 10099) and 1% 100 U/ml penicillin/streptomycin (Beyotime, Jiangsu, China, C0222), seeded onto dishes or plates coated with poly‐l‐lysine, and then incubated in a humidified atmosphere with 5% CO₂ at 37°C. Then astrocytes were cultured in normal medium under normal culture conditions for the designated time. For OGD/R, astrocytes were incubated in glucose‐free Dulbecco's modified Eagle medium in an anaerobic chamber filled with 5% CO₂ and 94% N₂ at 37°C for 4 h. Then astrocytes were cultured in normal medium under normal culture conditions for the designated time before harvested.

5.8. Immunofluorescence

Rats were deeply anesthetized using isoflurane, followed by intra cardial perfusion with saline solution and 4% paraformaldehyde in 0.1 M phosphate‐buffer (PB). The brains were then removed immediately, fixed in 4% paraformaldehyde overnight, and equilibrated in 30% sucrose at 4°C. Fifteen micrometer thick serial coronal sections were taken on a freezing microtome. Every fifth section throughout the CA1 hippocampal subfield was selected. After rinsing with 0.1 M PBS (30 min) and blocking with 0.2% (vol/vol) Triton X‐100 and 10% (wt/vol) normal goat serum in 0.1 M PBS for 1 h at room temperature, sections were incubated with the following primary antibodies diluted in blocking buffer overnight at 4°C: anti‐NeuN (1:500), anti‐LAMP‐2A (1:500), anti‐GFAP (1:500), and anti‐cleaved‐caspase‐3 (1:400). After rinsing with PBS, sections were incubated with Alexa Fluor 488 (1:500)‐, Alexa Fluor 594 (1:500)‐, or Alexa Fluor 647 (1:500)‐conjugated secondary fluorescent antibody for 1 h at room temperature. Nuclei were stained with 4′,6‐diamidino‐2‐phenylindole (DAPI) for 10 min at room temperature. After rinsing 6 times with PBS, brain sections were mounted with Vectashield antifade mounting medium (Vector Labs, VA, USA). Confocal images were captured by a Fluoview confocal microscope (Zeiss, Oberkochen, Germany). Images were taken at equal exposure for each group.

To calculating the density of surviving neurons, 12 sections from 5 rats were used. Neurons which appeared round to oval in shape with a central nucleus were deemed as surviving, and neuronal density was calculated as the number of surviving pyramidal neurons in the hippocampal CA1 pyramidal layer per 1 mm length. For astrocytes, we counted the total number of GFAP⁺ astrocytes in 0.1 μm² of the CA1 subregion. The number of normal resting astrocyte (small cell bodies and bush‐like processes) and activated astrocyte (hypertrophied with bulky cytoplasm and thick processes) were counted for further analysis, as in previous studies [45, 46]. LAMP‐2A intensity of GFAP⁺ astrocytes and the mean cleaved‐caspase‐3 intensity of NeuN⁺ neurons in single CA1 was measured in ZEN Blue 3.0 software. Image collection and data analysis were carried out by experimenters blinded to the experimental conditions.

5.9. Quantitative real‐time PCR (qRT‐PCR) for mRNA

After global ischemia, the CA1 hippocampal subfield was harvested and rapidly frozen in liquid nitrogen. Total RNA from brain was extracted with RNAiso Plus (9108; TaKaRa Bio, Dalian, China). The concentration and integrity of the RNA were determined by NanoDrop 2000 (Thermo Fisher Scientific). RNA was reverse transcribed with the PrimeScript RT reagent kit with gDNA Eraser (RR047; TaKaRa). SYBR green qPCR mix (RR820A; TB green Premix Ex Taq II, Takara) was used to perform qRT‐PCR (Applied Biosystems, StepOnePlus Real‐Time PCR System) according to the manufacturer's instructions. RNA expression levels were calculated by the 2^−ΔΔCt method with normalization against β‐actin reference transcripts. The following qRT‐PCR primers were used:

Rat‐Lamp‐2a‐F: 5′‐ TTGGCTAATGGCTCAGCTTT‐3′

Rat‐Lamp‐2a‐R: 5′‐ ATGGGCACAAGGAAGTTGTC‐3′

Rat‐β‐actin‐F: 5′‐ CCCATCTATGAGGGTTACGC‐3’

Rat‐β‐actin‐R: 5′‐ TTTAATGTCACGCACGATTTC‐3′

5.10. Morris water maze test

The MWM test was employed 7 days after I/R to assess spatial memory acquisition and retention in rats, as previously described. The maze consisted of a black tank (165 cm diameter and 50 cm height) filled with water (30 cm deep, 25 ± 1°C). Video tracking software divided the tank into four quadrants and a platform. The platform (12 cm in diameter and 29 cm high) was 1–1.5 cm below the water surface and was located in the center of the destination quadrant. Rats were required to find the hidden platform within 60 s (escape latency) by using environmental spatial clues which were maintained throughout testing, and were allowed to stay on the platform for 20 s to learn its location; if the rat failed to find the platform, the rat was guided to it by the experimenter and a score of 60 s was assigned as the escape latency. During the learning process, the rats (n = 6 per group) were subjected to four consecutive trials per day at 10 min intervals for 5 days, starting (facing the wall) from one of four points into the water maze. On the sixth day, each rat was subjected to a probe trial (60 s) in which the platform was removed, to assess their spatial memory. The time the rats spent in the target quadrant and the swimming speed were recorded.

5.11. Contextual fear conditioning

Fear conditioning is a useful behavioral paradigm for assessing learning and memory. Seven days after I/R, contextual fear conditioning was conducted, as reported previously [47]. Briefly, the procedure involved training and then testing the rats. In the training session, rats were first placed in the fear‐conditioning chamber for a 6 min trial. Rats were placed into a shock chamber and allowed to explore for 2 min. Then, a tone (8 kHz) was presented for 30 s and a constant mild foot shock (0.7 mA) was given during the last 2 s. The tone and foot shock were presented twice more with an average interval of 120 s. The test session was performed 1 day after the training session. During the test session, the rats were placed into the same fear conditioning chamber and allowed to habituate for 5 min without any tone or shock.

Before each training or test session, rats were brought to the experiment room and allowed to habituate for 60 min. The chamber was wiped with 70% alcohol between animals. Movement of the rats was monitored by an attached tracking system. Video Freeze software was used to calculate the freezing time.

5.12. Golgi–Cox staining

After the MWM test was complete, the dendrites and dendritic spines were evaluated with a rapid Golgi–Cox staining kit (006182; Hitobiotec, Kingsport, TN, USA), according to the manufacturer's instructions. Briefly, rats were decapitated and the whole brains were immersed in impregnation solution (a mixture of solutions 1 and 2) and held in the dark at room temperature (23 ± 2°C) for 14 days (the solution was changed once after 24 h). Then, the brains were transferred into solution 3 and stored in the dark for 2–3 days at 4°C (the solution was changed once after 12 h). The brains were sliced into 150‐μm‐thick sections at the level of the hippocampus with a vibratome and cryostat (VT1000; Leica, Wetzlar, Germany). The slides were stained and further processed according to the manufacturer's instructions and then cover‐slipped with neutral balsam mounting medium (BL704A; Biosharp, Beijing, China) and observed under a light microscope (Leica DM2500, Wetzlar, Germany) with the help of an oil immersion objective. Dendritic crossings in pyramidal neurons were analyzed with Sholl analysis. The count of dendritic intersections in the CA1 subfield included apical and basal dendrites. Neurons that were stained well, relatively isolated from neighboring cells, and had mainly intact and fully impregnated apical and basal arborizations without truncated branches were analyzed. For analysis of dendritic interactions, specified 120‐μm‐long CA1 apical and basal dendritic sections from 18 randomly selected pyramidal cells of 5 rats were examined in Image J software (NIH, Bethesda, Maryland, USA). The number of spines was counted along a 50 μm linear length of an apical second‐order, oblique dendrite with clear spine resolution. The data were counted visually and separately by three experimenters blinded to the experimental design.

5.13. Transmission electron microscopy

After the contextual fear conditioning test was complete, rats were deeply anesthetized with isoflurane and then transcardially perfused with 4% paraformaldehyde. The CA1 hippocampal region was collected and rapidly fixed in a solution composed of 4% paraformaldehyde and 2.5% glutaraldehyde, followed by a wash with 0.1 M phosphate buffer solution (PBS, pH 7.4) and postfixation in 1% osmic acid for 2 h. Subsequently, the tissue was washed with double distilled water and dehydrated with an ethanol and acetone gradient. Samples were embedded with different concentrations of epoxy resin and polymerized at 37°C for 24 h, followed by 45°C for 24 h and then 60°C for 24 h. The samples were cut into ultrathin sections (70 nm) and stained with uranyl acetate and lead citrate. Two grids per specimen and 10 photographs per grid were randomly taken of the synaptic terminals and viewed on a transmission electron microscope (TEM) (FEI Tecnai G2 Spirit TWIN, America) to estimate the synaptic morphometry. To calculate the number of synapses, gray type I synapses (asymmetric synapses considered to mediate excitatory transmission) were identified in the micrographs by the presence of synaptic vesicles (SVs) and dense material in the postsynaptic axon terminal, we counted the visible synapses in one image. Postsynaptic density (PSD) thickness was evaluated as the length of a perpendicular line traced from the postsynaptic membrane to the most convex part of the synaptic complex. The synaptic cleft (SC) widths were estimated by measuring the widest and narrowest portions of the synapse and then averaging these values. The data were obtained by observers blinded to the experimental design.

5.14. Mitochondria isolation

Mitochondria were isolated from hippocampal CA1 with the Mitochondria Isolation Kit for Tissue (89801; Thermo Fisher Scientific), according to the manufacturer's instructions. In brief, CA1 homogeneous suspensions were prepared with a pre‐chilled Dounce homogenizer. Then, the mitochondrial fraction was separated from the cytosolic fraction by extraction reagents and differential centrifugation. After mitochondria isolation, the mitochondrial pellet was lysed with 2% CHAPS (C9426; Sigma) in Tris‐buffered saline containing protease inhibitors. All procedures were performed at 4°C.

5.15. Statistical analysis

All statistical analyses were conducted in Graphpad Prism 7.0 software. Protein intensity, qRT‐PCR, quantitative analysis of immunoflurorescence (except LAMP‐2A intensity of GFAP⁺ CA1 cells), time spent in the target area, swimming speed, freezing time, number of dendritic spines, number of hippocampal synapses, width of synaptic cleft, and PSD thickness were analyzed with one‐way ANOVA followed by Tukey's test. The LAMP‐2A intensity of GFAP⁺ CA1 cell was analyzed with an unpaired t test. The escape latency (time for rats to find the platform) and the number of dendritic intersections were analyzed with two‐way ANOVAs followed by Tukey's multiple comparisons test. Data throughout are presented as the mean ± SEM, Statistical significance was defined as p < 0.05.

AUTHOR CONTRIBUTIONS

Han‐Yu Fu and Jing‐Wei Zhou designed the experiments. Han‐Yu Fu and Jing‐Wei Zhou performed the ischemia experiments and analyzed the data. Han‐Yu Fu, Hui Li, and Long Yang performed the OGD experiments and analyzed the data. Yang Cui, Qiao Li and Ding Wang performed the behavioral assays. Han‐Yu Fu, Jing‐Wei Zhou, and De‐Juan Wang wrote the manuscript. All authors critically read the manuscript.

CONFLICT OF INTEREST

No financial conflicts of interest are reported by the authors.

ETHICS STATEMENT

All the experimental protocols were in accordance with the Chinese Council on Animal Care Guidelines and approved by the Institutional Animal Care Committee of Xuzhou Medical University.

Fu H‐Y, Cui Y, Li Q, Wang D, Li H, Yang L, et al. LAMP‐2A ablation in hippocampal CA1 astrocytes confers cerebroprotection and ameliorates neuronal injury after global brain ischemia. Brain Pathology. 2023;33(2):e13114. 10.1111/bpa.13114

DATA AVAILABILITY STATEMENT

Data is available upon request to the corresponding author.