Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| strain, strain background (M. musculus) | wildtype C57BL/6 J | The Jackson Laboratory | Stock #000664 | |
| strain, strain background (M. musculus) | mito:mKate2 mouse Tg(CAG-mKate2)1Poche/J |
The Jackson Laboratory | Stock 032188 | |
| strain, strain background (M. musculus) | LysM-Cre mouse B6.129P2-Lyz2tm1(cre)Ifo/J |
The Jackson Laboratory | Stock 004781 | |
| strain, strain background (M. musculus) | Lox-stop-lox-MitoTag mouse B6N.Cg-Gt(ROSA)26Sortm1(CAG-EGFP*)Thm/J |
The Jackson Laboratory | Stock 032675 | |
| cell line (Homo-sapiens) | MDA-MB-231 | American Type Culture Collection | HTB-26 | |
| cell line (Homo-sapiens) | MDA-MB-468 | American Type Culture Collection | HTB-132 | |
| cell line (Homo-sapiens) | A375 | American Type Culture Collection | CRL-1619 | |
| cell line (Homo-sapiens) | THP-1 | American Type Culture Collection | TIB-202 | |
| cell line (Homo-sapiens) | MCF10a | American Type Culture Collection | CRL-10317 | |
| cell line (M. musculus) | E0771 | American Type Culture Collection | CRL-3461 | |
| transfected construct (Homo-sapien) | pLPCX mito-Grx1-roGFP2 | Addgene | 64977 | |
| transfected construct (S. cerevisiae) | pLPCX mito-roGFP2-Orp1 | Addgene | 64992 | |
| antibody | BV711-CD11b (mouse anti-human, monoclonal) | Biolegend | 301344 | 1:20-1:40 Used for flow cytometry |
| antibody | PE anti-human CD326 (EpCAM) Antibody (mouse andti-human, monoclonal) |
Biolegend | 369806 | 1:40 Used for flow cytometry |
| antibody | APC-Ki67 (mouse anti-human, Monoclonal) |
ThermoFisher | 17-5699-42 | 1:20 – 1:40 Used for flow cytometry |
| antibody | anti-GFP (Chicken, polyclonal) | Abcam | AB13970, | 1:500 |
| antibody | anti-RFP (rabbit, polyclonal) | Abcam | AB62341 | 1:1000 |
| antibody | Alexa Fluor 488 AffiniPure (Goat anti-Chicken, polyclonal) | Jackson ImmunoResearch | 103-545-155 | 1:500 |
| antibody | IgG (H+L) (Cross-Adsorbed Goat anti-Rabbit Alexa Fluor 555, polyclonal) | Invitrogen | A21428 | 1:500 |
| recombinant DNA reagent | Mito-mEm: pLKO.1 mito-mEmerald | This paper | Addgene, 174548 | Lentiviral construct to transfect and express fluorescently-tagged mitochondria |
| recombinant DNA reagent | Mito-RFP: pLKO.1 mito-TagRFP-T | This paper | Addgene, 174543 |
Lentiviral construct to transfect and express fluorescently-tagged mitochondria |
| recombinant DNA reagent | mEmerald-TOMM20: pLKO.1 mEmerald-TOMM20-N-10 | This paper | Addgene, 54282 |
Lentiviral construct to transfect and express fluorescently-tagged mitochondria |
| recombinant DNA reagent | mCherry-TOMM20: pLKO.1 mCherry-TOMM20-N-10 | This paper | Addgene, 55146 |
Lentiviral construct to transfect and express fluorescently-tagged mitochondria |
| recombinant DNA reagent | Mito-KR: pLKO.1 3xHA-KillerRed-OMP25 | This paper | Addgene, 174544 |
Lentiviral construct to transfect and express mitochondrially-localized KillerRed |
| recombinant DNA reagent | ERK-KTR-mRuby: pLentiPGK Blast DEST ERKKTRmRuby2 |
Addgene | 90231 | Lentiviral construct to transfect and express ERK Kinase Translocation reporter |
| recombinant DNA reagent | ERK-KTR-Clover: pLentiPGK Puro DEST ERKKTRClover |
Addgene | 90227 | Lentiviral construct to transfect and express ERK Kinase Translocation reporter |
| recombinant DNA reagent | Non-target-shRNA | Sigma | SHC002 | Lentiviral construct to transfect and express non-target shRNA |
| recombinant DNA reagent | DRP1-KD: DRP1-shRNA |
Sigma | TRCN0000001097 | Lentiviral construct to transfect and knock down gene target HGNC ID 2973 |
| sequence-based reagent | Primer: DRP1-F | This paper | AGAAAATGGGGTGGAAGCAGA | |
| sequence-based reagent | Primer: DRP1-R | This paper | AAGTGCCTCTGATGTTGCCA | |
| sequence-based reagent | Primer: GAPDH-F | This paper | AGCCACATCGCTCAGACA | |
| sequence-based reagent | Primer: GAPDH-R | This paper | ACATGTAAACCATGTAGTTGAGGT | |
| peptide, recombinant protein | GM-CSF | Peprotech | 300–03 | 20 ng/mL |
| peptide, recombinant protein | IFN-γ | Peprotech | 3000–02 | 20 ng/mL |
| peptide, recombinant protein | IL-4 | Peprotech | 200–04 | 20 ng/mL |
| peptide, recombinant protein | IL-13 | Peprotech | 200–13 | 20 ng/mL |
| commercial assay or kit | eBioscience Foxp3/Transcription Factor Staining Buffer Set | ThermoFisher | 00-5523-00 | |
| commercial assay or kit | Polyplus-transfection jetPRIME DNA/siRNA transfection kit | Genesee Scientific | 55–131 | Used to transfect pLPCX mito-Grx1-roGFP2 and pLPCX mito-roGFP2-Orp1 probes |
| commercial assay or kit | MitoTracker Deep Red | ThermoFisher | M22426 | Used at 25 nM |
| commercial assay or kit | TMRM: Tetramethylrhodamine, Methyl Ester, Perchlorate |
ThermoFisher | T668 | Used at 100 nM |
| commercial assay or kit | LysoTracker Blue | ThermoFisher | L7525 | Used at 75 nM |
| commercial assay or kit | MemBrite 640/660 | Biotium | 30097 | Used at 1:1000 |
| commercial assay or kit | DCFDA: Carboxy-H2DCFDA |
ThermoFisher | C400 | Used at 5μM |
| chemical compound, drug | ERKi: SCH772984 |
SelleckChem | 7101 | Used at 1 µM |
| chemical compound, drug | PMA: Phorbol 12-myristate 13-acetate |
SelleckChem | S7791 | Used at 100 nM (cancer cell treatment) and 162 nM (THP1 differentiation) |
| chemical compound, drug | MitoTEMPO | Cayman Chemical | 16621 | Used at 100 µM |
| software, algorithm | QPI analyses | This Paper | https://github.com/Zangle-Lab/Macrophage_tumor_mito_transfer | |
| software, algorithm | Single-cell RNA-sequencing | This paper | GEO accession number: GSE181410 (RRID:SCR_002630 (version number 1)) https://github.com/rohjohnson-lab/kidwell_casalini_2021 |