Table 1.
Mutations detected in the putative CRISPR/Cas9 off-target sites.
| gRNA | Putative off-target gene | Off-target sequence* | No. of mismatches | Mutations |
|---|---|---|---|---|
| T1 | Os03g0372600 | GCAGAAGATCGTGATCAAGGTGG | 2 | not detected |
| Os09g0240500 | TCCGAAGATCGGGATAAAGGCGG | 4 | not detected | |
| Os06g0556300 | TCCAAAGACCGCGATAAAGGTGG | 4 | not detected | |
| T2 | Os02g0584700 | GAGCGACAAGTGCCGGTCGAAGG | 2 | not detected |
| Os02g0585100 | GAGCGACAAGTGCAGGCGGAAGG | 3 | not detected | |
| Os04g0585900 | GTGCGACACGGGCAGGACGACGG | 3 | not detected |
*Mismatching bases are in red. Nucleotides in blue represent protospacer adjacent motif (PAM) sequences.