Table 4.

Primers and amplification conditions.

Region	Primer	Sequence (5′–3′)	Amplification Program	References
ITS	ITS1 (forward)	TCCGTAGGTGAACCTGCGG	Initial denaturation at 94 °C for 2 min, 30 denaturation cycles at 94 °C for 1 min, annealing at 55 °C for 1 min, extension at 72 °C for 3 min, and final extension step at 72 °C for 3 min and 4 °C.	[46]
	ITS4 (reverse)	TCCTCCGCTTATTGATATGC
Elongation factor 1α (tef1)	EF1-728F (forward)	CATCGAGAAGTTCGAGAAGG	Initial denaturation at 94 °C for 2 min, 15 denaturation cycles at 94 °C for 30 s, annealing at 65 °C for 30 s, extension at 72 °C for 1 min, followed by 35 cycles at 94 °C for 30 s, 48 °C for 30 s, and final extension step at 72 °C for 1 min.	[47]
	TEF1R (reverse)	GCCATCCTTGGAGATACCAGC