Key resources table
REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Anti-histone H2A.X (rabbit IgG, 1:1000) | Abcam | Cat# ab5392 |
Bungarotoxin (BTX, 1:750) (Alexa594-conjugated) | Invitrogen | Cat# B13423 |
GFAP (chicken IgY, 1:1000) | Aves Labs Inc | GFAP |
GR repeat (rabbit IgG, 1:50) | Proteintech | Cat# 23978–1-AP |
Hb9 (mouse IgG1 kappa light chain, 1:10) | DSHB | Cat# 81.5C10 |
Iba1 (rabbit IgG, 1:100) | GeneTex | Cat# GT101495 |
Islet 1 (rabbit IgG, 2 μg/ml) | Abcam | Cat# ab20670 |
MAP2 (chicken IgY, 1:2000) | Abcam | Cat# ab5392 |
Mu Crystallin (rabbit IgG, 1: 200) (CoraLite®594-conjugated) | Proteintech | Cat# CL594–12495 |
Phospho TDP43(Ser409/410) (mouse IgG2a,1:100) | ProteinTech | Cat# 22309–1-AP |
PR repeat (rabbit IgG, 1:50) | Proteintech | Cat# 23979–1-AP |
STMN2 (rabbit IgG, 1:200) | Novus | Cat# NBP1–49461 |
SYF2 (rabbit IgG, 1:80) for iMN staining and western blots | MilliporeSigma | Cat# HPA070710 |
SYF2 (mouse IgG, 1:150) for post-mortem tissue staining | Abcam | Cat# ab236417 |
Synaptophysin (rabbit IgG, 1:100) | Synaptic systems | Cat# 101002 |
TDP43 (rabbit IgG, 1:200) | Proteintech | Cat# 10782–2-AP |
Tuj1 (mouse IgG, 1:1000) | Biolegend | Cat# 801202 |
DAPI | Thermo Fisher Scientific | Cat# 62248 |
Donkey Anti-Chicken IgY (IgG) (H+L) Alexa Fluor® 647 | Jackson ImmunoResearch | Cat# 703–605-155 |
Donkey anti-Mouse, IgG (H+L) Highly Cross-Adsorbed, Alexa Fluor® 488 | Invitrogen | Cat# A21202 |
Donkey anti-Mouse, IgG (H+L) Highly Cross-Adsorbed, Alexa Fluor® 555 | Invitrogen | Cat# A31570 |
Donkey anti-Mouse, IgG (H+L) Highly Cross-Adsorbed, Alexa Fluor® 647 | Invitrogen | Cat# A32787 |
Donkey anti-Rabbit, IgG (H+L) Highly Cross-Adsorbed, Alexa Fluor® 488 | Invitrogen | Cat# A-21206 |
IRDye® 680RD Donkey anti-Rabbit IgG Secondary Antibody | LI-COR Biosciences | Cat# 926–68073 |
IRDye® 800CW Donkey anti-Mouse IgG Secondary Antibody | LI-COR Biosciences | Cat# 926–32212 |
NeuroTrace™ 500/525 Green Fluorescent Nissl Stain (1:50) | Thermo Fisher Scientific | Cat# N21480 |
Biological samples | ||
CTRL (1) | Johns Hopkins ALS Postmortem Resource Core | JHU124 |
CTRL (2) | Johns Hopkins ALS Postmortem Resource Core | JHU129 |
CTRL (3) | BioChain Institute Inc. | T2234234 |
sALS (1) | Johns Hopkins ALS Postmortem Resource Core | JHU121 |
sALS (2) | Johns Hopkins ALS Postmortem Resource Core | JHU122 |
sALS (3) | Johns Hopkins ALS Postmortem Resource Core | JHU126 |
sALS (4) | Johns Hopkins ALS Postmortem Resource Core | JHU127 |
sALS (5) | Johns Hopkins ALS Postmortem Resource Core | JHU128 |
Chemicals, peptides, and recombinant proteins | ||
DMEM | Gibco | Cat# 11995–065 |
Opti-MEM | Gibco | Cat# 31985–070 |
FBS | GenClone | Cat# 25–514 |
Trypsin | GenClone | Cat# 25–510 |
Polybrene (Hexadimethrine bromide) | Millipore Sigma | Cat# H9268–5G |
DMEM/F12 | Corning | Cat# 10–090-CV |
Laminin | Invitrogen | Cat#23017015 |
Glutamax | Gibco | Cat# 35050–061 |
N2 supplement | Gibco | Cat# 17502048 |
B27 supplement | Gibco | Cat# 17504044 |
Non-essential amino acids (NEAA) | Gibco | Cat# 11140050 |
Human FGF-beta | Peprotech | Cat# 100–18B |
Repsox | Selleckchem | Cat# S7223 |
human CNTF | R&D | Cat# 257-NT |
human BDNF | R&D | Cat# 248BDB |
human GDNF | R&D | Cat# 212-GD |
Alt-R® S.p. HiFi Cas9 Nuclease V3, (100 μg) | IDT | Cat# 1081060 |
Matrigel | Corning | Cat#3 54277 |
mTeSR | StemCell | Cat# 85851 |
Accutase | Innovative Cell Technologies | Cat# AT4104 |
Y-27632 2HCl (ROCK inhibitor) | Selleckchem | Cat# S1049 |
Lenti-X concentrator | TaKaRa | Cat# 631232 |
Polybrene (Hexadimethrine bromide) | Millipore Sigma | Cat# H9268–5G |
Neurobasal-A | Life Technologies | Cat# 10888–022 |
Apilimod | achemblock | Cat# O33822 |
SB431542 | Cayman Chemical | Cat# 13031 |
CHIR99021 | Cayman Chemical | Cat# 13122 |
Retinoic Acid | Millipore Sigma | Cat# R2625 |
DMH1 | Selleckchem | Cat# S7146 |
Purmorphamine | Cayman Chemical | Cat# 10009634 |
T-PER buffer | Thermofisher | Cat# 78510 |
Donor Equine Serum | HyClone | Cat# 16777–030 |
MEM media | Life Technologies | Cat# 10370088 |
Penicillin-streptomycin 50X | Corning | Cat# 30–001-CI |
Compound E | Cayman Chemicals | Cat# 15579 |
Digitonin | Cayman Chemicals | Cat# 14952 |
5-Ethynyl uridine | Millipore Sigma | Cat# 909475 |
Blasticidin S HCl | ThermoFisher | Cat# A1113903 |
Lipofectamine™ Stem Transfection Reagent | Thermo | Cat# STEM00001 |
Doxycycline | Clontech | Cat# 631311 |
BrdU | Millipore Sigma | Cat# B9285 |
Puromycin | Millipore Sigma | Cat# SBR00017 |
Spectrum Collection | Microsource Discovery Systems | The Spectrum collection |
Doramectin | Microsource Spectrum | Cat# 01505902 |
Avermectin A1a | Microsource Spectrum | Cat# 01502347 |
Abamectin (avermectin B1a) | Cayman Chemical | Cat# 19201 |
Moxidectin | Cayman Chemical | Cat# 17165 |
Selamectin | Cayman Chemical | Cat# 21529 |
Eprinomectin | Millipore Sigma | Cat# 32526 |
Ivermectin | Selleckchem | Cat# S1351 |
Cloxyquin (5 chloro-8-quinolinol) 95% | Millipore Sigma | Cat# C47000 |
Dicloxacillin sodium | Millipore Sigma | Cat# D9016 |
Ibuprofen | Millipore Sigma | Cat# I4883 |
Acetylcholine chloride | Tocris Bioscience | Cat# 2809 |
Salsolidine | abCam | Cat# ab143546 |
Alfuzosin hydrochloride | Cayman Chemicals | Cat# 13648 |
Canrenone | Cayman Chemicals | Cat# 21307 |
Torsemide | Selleckchem | Cat# S1698 |
Phenazopyridine hydrochloride | Millipore Sigma | Cat# 34076 |
Phenelzine sulfate | Millipore Sigma | Cat# P6777 |
Levonorgestrel | Cayman Chemicals | Cat# 10006318 |
Dexibuprofen | Cayman Chemicals | Cat# 16793 |
Amlexanox | Cayman Chemicals | Cat# 14181 |
Deflazacort | Cayman Chemicals | Cat# 20386 |
Levetiracetam | Tocris Bioscience | Cat# 2839 |
Alpha tocopherol | Millipore Sigma | Cat# 258024 |
Alpha tocopheryl acetate | Cayman Chemicals | Cat# 10007705 |
Capecitabine | Cayman Chemicals | Cat# 10487 |
Anastrozole | Millipore Sigma | Cat# A2736 |
Fulvestrant | Cayman Chemicals | Cat# 10011269 |
Lomustine | Millipore Sigma | Cat# L5918 |
Pemetrexed | Cayman Chemicals | Cat# 14269 |
Acenocoumarol | Cayman Chemicals | Cat# 10010569 |
Clinafloxacin Hydrochloride | Cayman Chemicals | Cat# 16923 |
CoEnzyme Q10 (Ubidecarenone) | Selleckchem | Cat# S2398 |
Pirenzepine hydrochloride | Tocris Bioscience | Cat# 1071 |
Ketoprofen | Cayman Chemicals | Cat# 10006661 |
Cefsulodin | Cayman Chemicals | Cat# 16127 |
Cefoperazone | Cayman Chemicals | Cat# 16113 |
Cycloheximide | Cayman Chemicals | Cat# 14126 |
Menadione | Cayman Chemicals | Cat# 15950 |
β-carotene | Cayman Chemicals | Cat# 16837 |
Pyrazinamide | Cayman Chemicals | Cat# 23416 |
Salicyclic Acid | Selleckchem | Cat# S4539 |
Sulfabenzamide | Selleckchem | Cat# S4576 |
Sulfacetamide | Cayman Chemicals | Cat# 20377 |
Tetracycline hydrochloride | Cayman Chemicals | Cat# 14328 |
Thioguanine | Cayman Chemicals | Cat# 15774 |
Timolol maleate | Selleckchem | Cat# S4123 |
Tolmetin sodium | Cayman Chemicals | Cat# 18195 |
Ursodiol | Selleckchem | Cat# S1643 |
Azlocillin sodium | Cayman Chemicals | Cat# 18424 |
Cefaclor | Santa Cruz Biotechnology | Cat# sc-205242 |
Vidarabine | Cayman Chemicals | Cat# 18149 |
Arecoline | Cayman Chemicals | Cat# 13662 |
Mebeverine hydrochloride | Santa Cruz Biotechnology | Cat# sc-235579 |
Paromomycin sulfate | Cayman Chemicals | Cat# 23634 |
Cytisine | Selleckchem | Cat# S2287 |
Ftaxilide | Microsource Spectrum | Cat# 01504523 |
Bambuterol hydrochloride | Selleckchem | Cat# S4277 |
Bucladesine | Selleckchem | Cat# S7858 |
Hexamethonium bromide | Selleckchem | Cat# S4069 |
Niacin | Selleckchem | Cat# S1744 |
Nifedipine | Cayman Chemicals | Cat# 11106 |
Norethynodrel | Microsource Spectrum | Cat# 01500435 |
Norgestrel | Cayman Chemicals | Cat# 10006319 |
Noscapine hydrochloride | Cayman Chemicals | Cat# 17255 |
Phenacemide | Microsource Spectrum | Cat# 01500472 |
Pheniramine maleate | Selleckchem | Cat# S4045 |
Phenylbutazone | Cayman Chemicals | Cat# 70400 |
Levosimendan | Cayman Chemicals | Cat# 16128 |
Nortriptyline hydrochloride | Cayman Chemicals | Cat# 15904 |
Oxidopamine hydrochloride | Microsource Spectrum | Cat# 01500450 |
Tibolone | Cayman Chemicals | Cat# 10006321 |
Exemestane | Cayman Chemicals | Cat# 15008 |
Metformin | Selleckchem | Cat# S1950 |
Ganciclovir | Cayman Chemicals | Cat# 13853 |
Letrozole | Cayman Chemicals | Cat# 11568 |
Dihydrotestosterone | Cayman Chemicals | Cat# 15874 |
Riluzole | Millipore Sigma | Cat# R116 |
Edaravone | Selleckchem | Cat# S1326 |
Fluphenazine | Cayman Chemicals | Cat# 23555 |
Critical commercial assays | ||
Click-iT RNA Alexa Fluor 594 imaging kit | Thermo Fisher Scientific | Cat# C10330 |
RNeasy 96 kit | Qiagen | Cat# 74181 |
RNeasy plus mini kit | Qiagen | Cat# 74136 |
Pierce™ BCA Protein assay kit | Thermo Fisher Scientific | Cat# 23227 |
Deposited data | ||
Sequence Read Archive (SRA) (Whole exome sequencing of sALS patients) | https://www.ncbi.nlm.nih.gov/sra | PRJNA552114 |
Sequence Read Archive (SRA) (Whole exome sequencing of sALS patients) | https://www.ncbi.nlm.nih.gov/sra | PRJNA903195 |
Gene Expression Omnibus (Bulk RNA-seq and splicing analysis) | https://www.ncbi.nlm.nih.gov/geo/ | GSE218079 |
Experimental models: Cell lines | ||
CTRL-1 | NINDS Biorepository | ND03231 |
CTRL-2 | NINDS Biorepository | ND03719 |
CTRL-3 | NINDS Biorepository | ND05280 |
CTRL-4 | NINDS Biorepository | ND00184 |
CTRL-5 | NINDS Biorepository | ND41865 |
CTRL-6 | Cedars Sinai Biomanufacturing Center | CS5MRLiCTR |
CTRL-7 | Cedars Sinai Biomanufacturing Center | CS2PFYiCTR |
CTRL-8 | Cedars Sinai Biomanufacturing Center | CS2BVGiCTR |
CTRL-9 | Cedars Sinai Biomanufacturing Center | CS2GW3iCTR |
C9-ALS/FTD-1 | NINDS Biorepository | ND06769 |
C9-ALS/FTD-2 | NINDS Biorepository | ND10689 |
C9-ALS/FTD-3 | NINDS Biorepository | ND12099 |
C9-ALS/FTD-4 | Cedars Sinai Biomanufacturing Center | CS29iALS |
C9-ALS/FTD-5 | Cedars Sinai Biomanufacturing Center | CS2YNLiALS |
C9-ALS/FTD-6 | NINDS Biorepository | ND08957 |
C9-ALS/FTD-7 | NINDS Biorepository | ND12100 |
C9-ALS/FTD-8 | Cedars Sinai Biomanufacturing Center | CS2DDGiALS |
C9-ALS/FTD-9 | NINDS Biorepository | ND50000 |
C9-ISO-1 | Ichida Lab | 6769 iso c1 |
C9-ISO-4 | Cedars Sinai Biomanufacturing Center | 29iALS-ISO |
sALS-1 | NINDS Biorepository | ND08705 |
sALS-2 | NINDS Biorepository | ND09292 |
sALS-3 | NINDS Biorepository | ND09329 |
sALS-4 | NINDS Biorepository | ND10739 |
sALS-5 | NINDS Biorepository | ND13454 |
sALS-6 | NINDS Biorepository | ND14185 |
sALS-7 | Loma Linda University | #3 |
sALS-8 | Loma Linda University | #4 |
sALS-9 | NINDS Biorepository | ND09711 |
sALS-10 | NINDS Biorepository | ND11813 |
sALS-11 | NINDS Biorepository | ND50073 |
sALS-12 | Cedars Sinai Biomanufacturing Center | CS0WD8iALS |
sALS-13 | Cedars Sinai Biomanufacturing Center | CS0KHAiALS |
sALS-14 | Ichida Lab | sALS-14 |
sALS-15 | Cedars Sinai Biomanufacturing Center | CS0GR5iALS |
sALS-16 | Acurastem Inc | ALS93E |
sALS-17 | Cedars Sinai Biomanufacturing Center | CS3XLKiALS |
sALS-18 | Cedars Sinai Biomanufacturing Center | CS2NDDiALS |
sALS-19 | Cedars Sinai Biomanufacturing Center | CS2WW0iALS |
sALS-20 | Cedars Sinai Biomanufacturing Center | CS1RUGiALS |
sALS-21 | Cedars Sinai Biomanufacturing Center | CS2CLNiALS |
sALS-22 | NINDS Biorepository | ND50082 |
sALS-23 | Cedars Sinai Biomanufacturing Center | CS2VU4iALS |
sALS-24 | Cedars Sinai Biomanufacturing Center | CS5HF7iALS |
sALS-25 | Cedars Sinai Biomanufacturing Center | CS0KBHiALS |
sALS-26 | Cedars Sinai Biomanufacturing Center | CS3AH9iALS |
sALS-27 | Cedars Sinai Biomanufacturing Center | CS0JCLiALS |
TARDBP-ALS/FTD-1 | NINDS Biorepository | ND50007 |
TARDBP-ALS/FTD-2 | Grupo de Neurociencias de Antioquia - Universidad de Antioquia | 12240 |
FUS-ALS-1 | NINDS Biorepository | ND35663 |
FUS-ALS-2 | NINDS Biorepository | ND39034 |
SOD1-ALS-1 | NINDS Biorepository | ND35658 |
SOD1-ALS-2 | NINDS Biorepository | ND35659 |
SOD1-ALS-3 | Kiskinis Lab | 39B |
CMT2A-1 | New York Stem Cell Foundation | NYCSF-AG0017–01-MR |
MAPT-1 | Tau consortium | ND32951A.15ᐃ2B09 |
Experimental models: Organisms/strains | ||
Mice: Tg(Thy1-TARDBP)4Singh | The Jackson Laboratory | Strain# 012836 |
Mice: C57BL/6J mice | The Jackson Laboratory | Strain# 000664 |
Mice: ICR/Ha J mice | The Jackson Laboratory | Strain# 009122 |
Oligonucleotides | ||
sgRNA-1 targeting upstream of repeat expansion | This paper | GUAACCUACGGUGUCCCGCU |
sgRNA-2b targeting downstream of repeat expansion | This paper | ACCCCAAACAGCCACCCGCC |
Primer 1 for repeat primed PCR | This paper | FAM-tgtaaaacgacggccagtCAAGGAGGGAAACAACCGCAGCC |
Primer 2 for repeat primed PCR | This paper | caggaaacagctatgaccGGGCCCGCCCCGACCACGCCCCGGCCCCGGCCCCGG |
Primer 3 for repeat primed PCR | This paper | caggaaacagctatgacc |
CLYBL crRNA | Synthego | ATGTTGGAAGGATGAGGAAA |
qPCR primer for HPRT, Forward | This paper | GACTTTGCTTTCCTTGGTCAG |
qPCR primer for HPRT, Reverse | This paper | GGCTTATATCCAACACTTCGTGGG |
qPCR primer for SYF1, Forward | This paper | CATTTCGAGAAGGCTCGGGA |
qPCR primer for SYF1, Reverse | This paper | CAGCTGTCCGTTGTCCTCAT |
Software and algorithms | ||
Image J | https://imagej.nih.gov/ij/ | N/A |
Prism | https://www.graphpad.com/scientific-software/prism/ | N/A |
Next-generation clustered heat map builder and viewer | https://bioinformatics.mdanderson.org/public-software/ngchm/ | N/A |
R studio | https://www.rstudio.com/ | N/A |
Biorender | https://biorender.com/ | N/A |