Skip to main content
NCBI home page
Journal of Virology logoLink to Journal of Virology
. 2023 Mar 14;97(3):e00041-23. doi: 10.1128/jvi.00041-23

Bombyx mori Nucleopolyhedrovirus Hijacks Multivesicular Body as an Alternative Envelopment Platform for Budded Virus Egress

Congyue Yao a,#, Shijia Pan a,#, Ying Xu a, Mengze Lu a, Yating Zhao a, Jiayao Huo a, Bifang Hao a,b,✉, Jinshan Huang a,b,✉
Editor: Felicia Goodrumc
PMCID: PMC10062136  PMID: 36916914

ABSTRACT

Baculovirus budded virus (BV) acquires its envelope and viral membrane fusion proteins from the plasma membrane (PM) of the host cell during the budding process. However, this classical BV egress pathway has been questioned because an intracellularly localized membrane fusion protein, SPΔnGP64 (glycoprotein 64 [GP64] lacking the signal peptide [SP] n region), was assembled into the envelope to generate infective BVs in our recent studies. Here, we identify an additional pathway for Bombyx mori nucleopolyhedrovirus (BmNPV) BV assembly and release that differs, in part, from the currently accepted model for the egress pathway of baculovirus. Electron microscopy showed that during infection, BmNPV-infected cells contained many newly formed multivesicular body (MVB)-like compartments that included mature virions at 30 h postinfection (p.i.). Immunoelectron microscopy demonstrated that the MVBs contained CD63, an MVB endosome marker, and GP64, a BmNPV fusion glycoprotein. MVB fusion with the PM and the release of mature virions, together with naked nucleocapsids, were observed at the cell surface. Furthermore, MVB egress mediated the translocation of SPΔnGP64 to the PM, which induced cell-cell fusion until 36 h p.i. This BV egress pathway can be partially inhibited by U18666A incubation and RNA interference targeting MVB biogenesis genes. Our findings indicate that BmNPV BVs are enveloped and released through MVBs via the cellular exosomal pathway, which is a subordinate BV egress pathway that produces virions with relatively inferior infectivity. This scenario has significant implications for the elucidation of the BmNPV BV envelopment pathway.

IMPORTANCE BmNPV is a severe pathogen that infects mainly Bombyx mori, a domesticated insect of economic importance, and accounts for approximately 15% of economic losses in sericulture. BV production plays a key role in systemic BmNPV infection of larvae. Despite the progress made in the functional gene studies of BmNPV, BmNPV BV egress is ill-understood. This study reports a previously unreported MVB envelopment pathway in BmNPV BV egress. To our knowledge, this is the first report of a baculovirus using dual BV egress pathways. This specific BV egress mechanism explains the cause of the non-PM-localized SPΔnGP64-rescued gp64-null bacmid infectivity, elucidating the reason underlying the retention of SP by BmNPV GP64. The data obtained elucidate an alternate molecular mechanism of baculovirus BV egress.

KEYWORDS: BmNPV, GP64, baculovirus, budded virus, membrane biogenesis, membrane fusion protein, multivesicular body

INTRODUCTION

Baculoviruses are enveloped double-stranded DNA viruses that replicate in the nuclei of infected insect cells and infect mainly Lepidoptera insects. During the baculovirus infection cycle, two virion phenotypes, occlusion-derived virus (ODV) and budded virus (BV), are produced (1). Both BVs and ODVs contain a nucleocapsid, but the sources and compositions of their envelopes differ, and this accounts for the distinct roles they play in virus infection. BVs acquire envelopes and viral membrane proteins from the plasma membrane (PM) during the budding process and mediate viral transmission between cells (2). ODVs acquire envelopes in the nucleus, and the envelopes are then embedded within a polyhedron matrix to form occlusion bodies, which mediate virus transmission among insects (3). Bombyx mori nucleopolyhedrovirus (BmNPV) is a severe pathogen that infects mainly Bombyx mori and causes significant economic losses in sericulture. The genome sequence of BmNPV is more then 90% identical to the genome of Autographa californica multiple nucleopolyhedrovirus (AcMNPV), another well-studied baculovirus, and the host range of the two viruses is nonoverlapping (4, 5). In recent years, progress has been reported in functional studies of a series of genes (6, 7); however, little is known regarding the mechanism underlying BmNPV BV egress.

BmNPV infection depends on cholesterol and its transporters in the host cells (8–11). Based on our recent studies, this may be due to BmNPV glycoprotein 64 (GP64), as BmNPV infection depends on cholesterol recognition amino acid consensus (CRAC) domain 1 (CRAC1) and CRAC2 of GP64 (12); this differs from AcMNPV infection, which depends on CRAC2 (13). GP64 is the membrane fusion protein (MFP) of alphabaculovirus and is secreted into the PM and assembled in BVs during the virion budding process. BmNPV GP64 retains its signal peptide (SP) in the mature virion, as this uncleaved SP is required for GP64’s localization to the PM (14). Moreover, BV dynamic amplification profiles and bioassays indicated that GP64 SP retention conferred strong infectivity on BmNPV BVs (12). Interestingly, the absence of the SP n region (SPΔnGP64) resulted in intracellularly localized SPΔnGP64 that rescued gp64-null bacmid infectivity. This implied that SPΔnGP64 was assembled into the BVs of vBmBacΔgp64-SPΔngp64 (12), whose infection is dependent on CRAC2. The current model of PM budding does not account for the non-PM localization of SPΔnGP64’s assembly into the viral envelope. This raised an interesting question on whether the BmNPV BV has an alternative envelopment pathway.

During the AcMNPV BV budding process, the nucleocapsids egress from the nucleus, first acquiring an envelope from the nuclear membrane, and are then transported to the vicinity of the PM. However, this nuclear envelope is lost in cytosol transportation (15), and the naked nucleocapsid acquires an envelope from the PM during the budding process. A recent study indicates that the endosomal sorting complex required for transport (ESCRT) and vacuolar protein sorting 4 (VPS4) are required for AcMNPV egress (16); these host factors are required for the formation of the multivesicular bodies (MVBs) (17). MVBs are involved in virion egress for many RNA and DNA viruses (18); therefore, we hypothesized that MVBs may be involved in BmNPV BV egress.

To reveal the intracellular envelopment mechanism of BmNPV BVs, vBmBacΔgp64-SPΔngp64 and vBmBacΔgp64-gp64 were used to infect BmN cells. The subcellular structure of BmN cells was observed using a transmission electron microscope (TEM) and immunolocalization assays, and the virion egress was verified using an MVB inhibitor and RNA interference (RNAi) technology targeting ESCRT genes. Our data revealed a novel envelopment pathway for baculovirus BVs in which MVBs serve as a subordinate envelopment/budding platform for BmNPV BV egress.

RESULTS

BmNPV BV envelopment occurred in the cytoplasm of infected BmN cells.

To reveal the envelopment platform, BmN cells were infected with viruses containing PM-localized GP64 (vBmBacΔgp64-gp64) or non-PM-localized GP64 (vBmBacΔgp64-SPΔngp64), and the cells were fixed for TEM analysis at 30 h postinfection (p.i.). As shown by the results in Fig. 1A and D typical pathological effects, such as an enlarged nucleus, numerous nucleocapsids in the nucleus, and naked nucleocapsids in the cytoplasm, were observed in the infected cells. Coincidentally, certain enlarged MVBs containing numerous nucleocapsids with envelopes (Fig. 1B and E, red arrows) enclosed by a membrane structure (Fig. 1B and E, yellow arrows) were observed in the virus-infected cells. Based on this evidence, MVBs appeared to be involved in BmNPV BV egress, and intracellular SPΔnGP64 or GP64 may have been assembled into BVs in MVBs. Additionally, both naked and enveloped nucleocapsids were observed in the vicinity of the PM (Fig. 1C and F, light blue and red arrows), and enveloped virions appeared to be released into the extracellular space by fusion (Fig. 1F, green arrow).

FIG 1.

FIG 1

Open in a new tab

Morphological features of BmN cells infected by BmNPV. BmN cells were infected with vBmBacΔgp64-gp64 (A, B, C) or vBmBacΔgp64-SPΔngp64 (D, E, F) at an MOI of 10, and the cells were fixed for TEM analysis at 30 h p.i. MVBs containing numerous nucleocapsids with envelopes are boxed (A and D), and partial MVBs (red boxes) are enlarged (B and E). Yellow arrows show the outer membranes of MVBs, and red arrows present the membranes of nucleocapsids (B and E). Both naked (light blue arrows) and enveloped (red arrows) nucleocapsids were observed in the vicinity of the PM (C and F), and enveloped BVs were released to the extracellular space by fusion with the PM (green arrow). N, nucleus; NE, nuclear envelope.

MVBs were involved in BV egress.

To confirm the involvement of MVBs in the intracellular envelopment of the BmNPV nucleocapsid, infected-cell sections were subjected to immunolocalization assays with anti-GP64 and anti-CD63 antibodies. In the control section, almost no gold particles were observed in the MVBs with nonspecific antibodies (Fig. 2A and B). In contrast, the application of anti-CD63 antibody showed that gold nanoparticles were detected mainly in MVBs (Fig. 2C and D, yellow arrows), and since CD63 is the marker protein of MVBs, this implies that MVBs are involved in nucleocapsid envelopment. Following the application of anti-GP64 antibody, gold nanoparticles were observed in the MVBs, and the nucleocapsids were surrounded by particles (Fig. 2E and F, red arrows), which indicated that GP64 and SPΔngp64 were transported into the MVBs during the protein sorting process. Therefore, our preliminary data indicate that MVBs are an envelopment platform for BmNPV BVs.

FIG 2.

FIG 2

Open in a new tab

Immunolocalization assays. BmN cells were infected with vBmBacΔgp64-gp64 (A, C, and E) or vBmBacΔgp64-SPΔngp64 (B, D, and F) at an MOI of 10 and then fixed (30 h p.i.) for immunogold staining with preimmune serum (A and B), anti-CD63 antibody (C and D), and anti-GP64 antibody (E and F). Yellow and red arrows show the gold dots in MVBs treated with anti-CD63 antibody and anti-GP64 antibody, respectively.

Temporal analysis of MBV involvement in BV egress.

To investigate the time course of MVB involvement in BV egress, BmN cells were infected with vBmBacΔgp64-gp64, fixed, and subjected to TEM analysis at 0, 12, 24, 30, 36, and 48 h p.i. As shown by the results in Fig. 3, at the early stage of infection (between 0 and 12 h p.i.), observing MVBs and nucleocapsids in the cytoplasm of the cells was difficult (Fig. 3A and B). At 24 h p.i., naked nucleocapsids were observed in the cytoplasm (Fig. 3C, light blue arrows) but not in MVBs; however, these nucleocapsids did not gather in the MVBs. Several MVBs with accumulations of nucleocapsids bearing an envelope were observed at 30 h p.i. (Fig. 3D, red arrows); meanwhile, the enveloped BVs appeared to be released into the extracellular space by fusion with the PM (Fig. 3D, green arrow). At 36 h p.i., nucleocapsids could be observed within some MVBs (Fig. 3E, red arrows), while some were filled with membrane structures and had a few virions (Fig. 3E, yellow arrows). At 48 h p.i., MVBs were observed, with a few containing enveloped nucleocapsids (Fig. 3F, red arrows), while a few MVBs were half empty (Fig. 3F, magenta arrows). Naked nucleocapsids were also observed in the cytoplasm (Fig. 3F, blue arrows). These assays implied that MVB involvement in BV egress occurred mainly from 30 h p.i. to the late stage of infection (48 h p.i.).

FIG 3.

FIG 3

Open in a new tab

Temporal analysis of the MVB involvement in BV egress. BmN cells were infected with vBmBacΔgp64-gp64 at an MOI of 10 and then processed for TEM analysis. MVBs and nucleocapsids in the cytoplasm of the cells were difficult to observe in the infected cells at 0 (A), 12 (B), and 24 h p.i. (C). Several MVBs with accumulations of nucleocapsids bearing an envelope were observed at 30 (D), 36 (E), and 48 (F) h p.i. Light blue arrows show naked nucleocapsids. The green arrow presents an enveloped nucleocapsid released to the extracellular space. Red arrows show MVBs with nucleocapsid accumulations. Yellow arrows show MVBs with membrane structures. Magenta arrows show empty or half-empty MVBs.

SPΔnGP64 was translocated to the cell PM in the infection process.

SPΔnGP64 was not transported to the PM following transfection (14); however, it was detected in the MVBs of the infected cells. Enveloped BVs are released into the extracellular space by fusion with the PM; therefore, SPΔnGP64 is translocated to the PM in the budding process. To verify this, a cell-cell fusion assay and cell enzyme-linked immunosorbent assay (ELISA) were used to quantify the cell surface localization of GP64 or SPΔnGP64. BmN cells were infected with vBmBacΔgp64-gp64 or vBmBacΔgp64-SPΔngp64, and the cells were induced with a low-pH medium for the cell-cell fusion assay at the indicated time points. As shown by the results in Fig. 4A, syncytia were observed from 12 h p.i. in vBmBacΔgp64-gp64-infected cells (arrows), and the fusion efficiency increased with increasing infection time (Fig. 4B; data for cell detachment were not collected after 36 h p.i.). Conversely, no syncytia were observed in the cells infected with vBmBacΔgp64-SPΔngp64 at 0, 12, and 24 h p.i., syncytia were observed until 36 h p.i., and the fusion efficiency was increased in the late stage of infection (Fig. 4B), indicating that SPΔnGP64 was transported to the cell surface during the infection process. To quantitatively analyze the GP64 surface display, parallel-infected cells were quantified using cell ELISA with anti-GP64 antibody, because the infected cells were not permeabilized, and thus, the intracellular GP64 would not be detected by ELISA. The results demonstrated that GP64 was rapidly expressed and secreted into the PM from 12 h p.i. to 36 h p.i. (Fig. 4C). However, SPΔnGP64 was detected at 12 h p.i. with a lower absorbance (Fig. 4C), showing a level that was not sufficient to induce cell-cell fusion (Fig. 4A and B). The absorbance of SPΔnGP64 increased slowly, and the accumulated SPΔnGP64 mediated the formation of syncytia until 36 h p.i. Moreover, the absorbance at this time point was 0.376 ± 0.003 (mean ± standard deviation) on average, which showed no significant difference from that of GP64 (0.38 ± 0.002) at 12 h p.i. SPΔnGP64 yielded a high absorbance score at 72 h p.i., similar to that of GP64 at 36 h p.i. (Fig. 4C), and the fusion rate showed a positive relationship with absorbance (r = 0.996) from 36 to 72 h p.i. These findings indicate that MVB envelopment mediated SPΔnGP64 transport to the PM of BmN cells. The SPΔnGP64 surface display rate was correlated with BV egress, implying that MVB BV egress may occur earlier than we observed by TEM.

FIG 4.

FIG 4

Open in a new tab

Surface localization assay of GP64 and SPΔnGP64. (A) Cell-cell fusion assay. BmN cells were seeded in 48-well plates overnight and infected with vBmBacΔgp64-gp64 or vBmBacΔgp64-SPΔngp64 at an MOI of 3. Cell-cell fusion was induced using low-pH TC100 medium (pH 4.5) at the indicated time points. Arrows show syncytia. (B) Comparison of fusion efficiencies between the two viruses. Five fields were randomly selected for the fusion assay, and the cell fusion efficiency was calculated as the percentage of fused nuclei out of the total number of nuclei. (C) GP64 cell surface localization assay by cell-based ELISA with anti-GP64 antibody. Parallel-infected cells were fixed without permeabilization and quantified using cell ELISA with a GP64 antibody and HRP-labeled secondary antibody. Error bars show standard errors of the means.

Non-PM-localized SPΔnGP64 was associated with low infectivity.

Because SPΔnGP64 was not secreted into the PM in the early stage of infection, BV budding from the PM should show no infectivity; in this regard, only intracellularly enveloped virions in MVBs have infectivity. Therefore, the relative infectivity of vBmBacΔgp64-SPΔngp64 was lower than that of vBmBacΔgp64-gp64. To confirm this, we evaluated the dynamic BV production and relative infectivities using a one-step growth curve and quantitative PCR (qPCR) analysis. The one-step growth curve indicated that the BV titers of vBmBacΔgp64-SPΔngp64 were significantly lower than those of vBmBacΔgp64-gp64 at the three time points (P < 0.000001) (Fig. 5A), and a significant difference was detected between the two viruses through two-way analysis of variance (ANOVA) [F(1,2) = 3.48E+017, P < 0.001]. qPCR was used for evaluation of the BV genome copy numbers, revealing that vBmBacΔgp64-SPΔngp64 possessed cycle threshold (CT) values similar to those of vBmBacΔgp64-gp64 at 24 and 48 h p.i. (Fig. 5B), indicating that there was no significant difference in the numbers of virus particles. Based on the standard curve between bacmid DNA dosages and CT values (Fig. 5C), the relative infectivity of BVs was evaluated using the value for titer averaged by copy number; a relatively lower value represents lower infectivity. As shown by the results in Fig. 5D, vBmBacΔgp64-gp64 exhibited a significantly higher 50% tissue culture infective dose (TCID50) per copy than vBmBacΔgp64-SPΔngp64 at 24 h p.i. (P = 0.000002), indicating that vBmBacΔgp64-SPΔngp64 exhibited a significantly lower infectivity than vBmBacΔgp64-SPΔngp64. At 48 h p.i., the difference narrowed (P = 0.003), indicating that SPΔnGP64 surface display facilitated an increase in the relative infectivity of vBmBacΔgp64-SPΔngp64.

FIG 5.

FIG 5

Open in a new tab

Comparison of BV relative infectivities. (A) Dynamic BV production of vBmBacΔgp64-gp64 and vBmBacΔgp64-SPΔngp64. BmN cells were infected with vBmBacΔgp64-gp64 or vBmBacΔgp64-SPΔngp64 at an MOI of 10. At the appropriate time points (12, 24, and 48 h p.i.), supernatants were collected, and the titers of the BVs were determined using an EDPA. Each viral infection was carried out in triplicate, and BV titers at different times p.i. were statistically analyzed using two-way ANOVA in GraphPad Prism 8 and Student’s t test. (B) Genomic DNA copy number comparison by qPCR. BV DNA was extracted and served as a template for qPCR; the CT values were compared at three time points with Student’s t test. (C) Standard curve of DNA dosages and CT values by qPCR. Bacmid DNA was isolated and quantified, a standard curve was generated using 10-fold dilutions of the BmBacmid DNA, and a linear equation was constructed. (D) Comparison of relative infectivities of vBmBacΔgp64-gp64 and vBmBacΔgp64-SPΔngp64. The relative viral infectivities were evaluated using the titers averaged by the genomic DNA copy number. Error bars show standard errors of the means.

U18666A inhibited BV egress and GP64 surface localization.

U18666A is an inhibitor of cholesterol transport; however, it has been used to investigate virion budding in MBVs as an effective MVB inhibitor (19, 20). Therefore, U18666A was utilized for BmNPV BV egress analysis. BmN cells were infected with viruses and then incubated with the indicated concentrations of U18666A at 12 h p.i.; the effect on BV egress was observed at 48 h p.i. As expected, BV titration indicated that 8 μM U18666A, but not 2 μM U18666A, significantly inhibited vBmBacgp64-gp64 production (Fig. 6A), whereas both drug concentrations significantly decreased the BV titer of vBmBacΔgp64-SPΔngp64 (Fig. 6A). This indicates that U18666A significantly inhibited BV egress. Moreover, viral DNA was extracted from the cells and BVs and the genomic copy number was quantified through qPCR, which indicated that U18666A incubation significantly inhibited DNA release (Fig. 6B).

FIG 6.

FIG 6

Open in a new tab

Inhibitory effect of U18666A on BV egress. (A) Effect of U18666A incubation on BV production. BmN cells were infected with vBmBacΔgp64-gp64 or vBmBacΔgp64-SPΔngp64 and then incubated with the indicated concentrations of U18666A at 12 h p.i., and the titer of each treatment was determined at 48 h p.i. (B) Comparison of rates of release of DNA copies with U18666A incubation by qPCR. BV DNA and total cellular viral DNA were extracted and subjected to qPCR; the graph shows the rates of DNA copy release, which were calculated by the extracellular BV genome copy number averaged by the total genome copy number. (C) Comparison of total GP64 protein expression. BmN cells were infected with vBmBacΔgp64-gp64 or vBmBacΔgp64-SPΔngp64 and then incubated with U18666A for 48 h, and cells were harvested for Western blotting with anti-GP64 antibody and antitubulin antibody. (D) GP64 and SPΔnGP64 surface localization assay. Parallel-infected cells were fixed and quantified using cell ELISA with anti-GP64 antibody and HRP-labeled secondary antibody. The graphs show the mean values from three independent experiments with standard errors of the means (SEMs). The P values from Student’s t test are shown.

In addition, MVB BVs released into the extracellular space mediated GP64 or SPΔnGP64 PM localization; therefore, we subsequently observed the GP64 or SPΔnGP64 surface display. Total protein expression was first detected by Western blotting, indicating that U18666A application did not inhibit the total expression of GP64 or SPΔnGP64 (Fig. 6C). However, the cell ELISA showed that the drug at both concentrations significantly decreased the absorbance of the infected cells (Fig. 6D), indicating that U18666A decreased the GP64 surface display efficiency. Our data indicated that incubation with U18666A inhibited BV release, thereby inhibiting GP64 and SPΔnGP64 surface localization, and that vBmBacΔgp64-SPΔngp64 was more sensitive to drug incubation.

Interference with MVB formation-associated genes inhibited BV egress.

To verify that MVB formation was involved with BV egress, BmN cells were first infected with the viruses, and then MVB formation-associated genes were knocked down by small interfering RNA (siRNA) and the effect of their depletion on BV egress was investigated. As shown by the qPCR assay results in Fig. 7A, all siRNAs significantly decreased the expression of their target genes, VPS4, VPS24, VTA1, and SNF7. We found that interference with all genes decreased BV production in the infected cells at 48 h p.i. (Fig. 7B and C); however, only VTA1 interference significantly reduced BV production in vBmBacΔgp64-gp64-infected cells (Fig. 7B). In contrast, vBmBacΔgp64-SPΔngp64 was very sensitive to interference from VPS4, VPS24, VTA1, and SNF7, and significant inhibitory effects were detected (Fig. 7C). The GP64 surface localization verified this interference. Western blotting with the anti-GP64 antibody indicated that there was no significant difference between the total GP64 of RNAi-treated and control samples for cells infected with both viruses (Fig. 7D). However, VTA1 depletion significantly decreased GP64 surface localization in the vBmBacΔgp64-gp64-infected cells (Fig. 7E). In contrast, interference with all four genes significantly inhibited SPΔnGP64 surface localization in vBmBacΔgp64-SPΔngp64-infected cells (Fig. 7F). These results imply that BV egress is dependent on MVB formation-associated genes, particularly the BV egress of vBmBacΔgp64-SPΔngp64.

FIG 7.

FIG 7

Open in a new tab

Effect of depletion of MVB formation-associated gene expression on BV egress. (A to C) Efficiency of RNA interference in gene expression determined by qPCR (A), and effects of siRNAs on BV production of vBmBacΔgp64-gp64 (B) and vBmBacΔgp64-SPΔngp64 (C). BmN cells were preseeded in 24-well cell culture plates overnight and infected with vBmBacΔgp64-gp64 or vBmBacΔgp64-SPΔngp64 at an MOI of 1 for 2 h, and then the cells were transfected with siRNA. The cells were collected for qPCR assay with primers for VPS4, VPS24, SNF7, and VTA1. Significance was statistically analyzed using Student’s t test in GraphPad Prism 8. The supernatants were harvested at 48 h p.i. for titration using an EDPA. Each viral infection was carried out in triplicate, and BV titers at different times p.i. were statistically analyzed using Student’s t test in GraphPad Prism 8. (D to F) GP64 protein expression assay (D), and surface localization assay of BmN cells infected with vBmBacΔgp64-gp64 (E) and vBmBacΔgp64-SPΔngp64 (F). BmN cells were seeded in 48-well plates overnight and infected with vBmBacΔgp64-gp64 or vBmBacΔgp64-SPΔngp64. The cells were collected for Western blotting with anti-GP64 antibody and antitubulin antibody or cell-based ELISA with anti-GP64 antibody and HRP-labeled secondary antibody. Error bars show standard errors of the means. The P values from Student’s t test are shown.

DISCUSSION

In this study, we report for the first time that BmNPV nucleocapsids acquire envelope and GP64 in MVBs. Therefore, we believe that BmNPV BV egress has two pathways: the classical PM budding pathway, which produces a cytomembrane-enveloped BV (CEBV), and MVBs as an alternative envelopment platform for BmNPV BV egress, producing an intracellularly enveloped BV (IEBV) (Fig. 8). For vBmBacΔgp64-gp64 BV egress, both pathways produce infectious virions (Fig. 8A). However, for vBmBacΔgp64-SPΔngp64 BV egress, IEBV is an infectious particle because it acquires its envelope and SPΔnGP64 from MVBs, while the infectivity of CEBV varies by the infection stage, showing low or no infectivity in the early stage because SPΔnGP64 accumulation on the PM is not sufficient to induce cell-cell fusion. In the late stage, CEBV is an infectious virion particle only once it acquires sufficient SPΔnGP64 from the PM, because it acquires envelope elsewhere than the PM (Fig. 8B).

FIG 8.

FIG 8

Open in a new tab

Schematic diagrams of BmNPV budding pathways. (A) The SP cleavage of wild-type GP64 is blocked by a helix structure formed by the n region of the SP. This uncleaved SP mediates GP64 secretion to the PM (black arrow). Nucleocapsids bud from the PM, acquire envelope and GP64, and produce cytomembrane-enveloped BVs (CEBVs). (B) Alternatively, partial GP64 is transported to MVBs, nucleocapsids bud into the MVBs to acquire envelope and GP64 (red arrow), and the enveloped nucleocapsids are then released to the extracellular space, producing intracellularly enveloped BVs (IEBVs). However, the absence of the n region causes SP cleavage, producing SPΔnGP64, which fails in PM localization (black blunted line), and nucleocapsids budding from the PM generate CEBVs, which show low or no infectivity in the early stage; non-PM-localized SPΔnGP64 is transported to the MVBs, and nucleocapsids bud into the MVBs to acquire envelope and SPΔnGP64 and are then released to generate IEBVs (red arrow). Moreover, SPΔnGP64 is translocated to the PM accompanying IEBV egress, and SPΔnGP64 accumulation on the PM ensures that CEBVs possess infectivity, which is produced in the late stage of infection.

There are numerous instances of enveloped viruses budding at the PM, and virions like those of retroviruses, alphaviruses, rhabdoviruses, orthomyxoviruses, and paramyxoviruses are released directly into the extracellular space. However, virus budding can also occur on intracellular membranes, resulting in the accumulation of particles in the lumen of cellular organelles (21). MVBs are enveloped platforms for numerous RNA viruses (22–26). However, budding sites have not been identified unequivocally for all viruses, as they vary by cell type, according to previous research. For example, HIV-1 buds almost exclusively from the PM of T cells (27), but HIV-1 can also bud into the MVBs of macrophages (22); however, the PM was confirmed as the primary site of HIV budding in macrophages in a subsequent study (27). Our findings are consistent with the budding mechanism of HIV-1 in macrophages, implying that the two envelopment mechanisms can coexist in the same cells.

In this study, the TEM assay provided direct evidence that MVB envelopment occurred from 30 to 48 h p.i. (Fig. 1 and 3). Consequently, a higher titer of BVs was achieved in the medium at 48 h p.i. than at 36 h p.i. (Fig. 5A). The data presented did not support the perception that these virions in MVBs were the accumulation of re-internalized BVs. Moreover, indirect evidence implied that IEBV production occurred from the early stage of infection, because SPΔnGP64, which cannot be secreted to the PM by transfection (14), was detected in the PM from 12 h p.i. (Fig. 4C). In addition, virion transport in vesicles is faster than cytosolic transport (28–30), which may be the reason that MVB envelopment was not observed by TEM in the early stage of infection.

In the dual budding pathways, we suggest that the nucleocapsid mainly buds from the PM. IEBVs exhibited the same infectivity during the infection process; however, the infectivity of CEBVs varied at the infection stage. This CEBV difference partially explains the large difference detected between the two viruses at 24 and 48 h p.i. The smaller difference at 12 h p.i. may be caused by the mixture of unremoved BVs during the infection. Based on CEBV production with low or no infectivity at 24 h p.i., we infer that approximately 16.5% of nucleocapsids were enveloped in MVBs to generate IEBVs, according to the relative infectivity assay (Fig. 5D).

Treatment with U18668A, an inhibitor of MVB formation, had a stronger effect on vBmBacΔgp64-SPΔngp64 than on vBmBacΔgp64-gp64 (Fig. 6), which was consistent with other studies on virion budding (19, 20, 31–33) and may be because IEBVs are the key infective BV egress pathway. However, U18666A may also inhibit the budding of nucleocapsids at the PM. MVB envelopment of virions was further verified by RNAi targeting ESCRT genes that were involved in MVB biogenesis and virion egress (34–36). VPS24, SNF7, VPS4, and VTA1 are required for the egress of several different virions (18, 35–40). Our data verified that these genes were required for IEBV production. In contrast, the depletion of most of these genes had an attenuating effect on vBmBacΔgp64-gp64 production, because CEBV production and GP64 secretion did not depend on MVB formation. Surprisingly, VTA1 plays a key role in vBmBacΔgp64-gp64 egress and GP64 surface localization (Fig. 7B and E), which may be due to the regulatory function of VTA1 in ESCRT (41–43).

In our previous studies, we confirmed that uncleaved SP was required for GP64 and Ebola virus glycoprotein PM localization in BmN cells (12, 14, 44, 45). These data imply that Bombyx mori cells possess a unique GP64 sorting mechanism that is unclear. GP64 localization in MVBs is essential for IEBV infectivity, which corresponds with the fact that glycoprotein B (gB) sorting to MVBs is a critical step for herpes simplex virus (HSV) envelopment and egress (36). Coincidently, both GP64 and gB are class III membrane fusion proteins (MFPs), verifying that glycoproteins play a key role in virion budding (46–49). Therefore, the retention of the SP by GP64 may be an adaption of BmNPV to this special protein sorting mechanism. A proteomic study of the BV envelope indicated that vBmBacΔgp64-SPΔngp64 possessed a lower GP64 intensity than vBmBacΔgp64-gp64 (50). We propose that GP64’s SP retention confers the strong infectivity of BmNPV (12, 14) by increasing the GP64 intensity, which is probably a consequence of PM budding pathways. Therefore, the dual envelopment pathways of BmNPV may be a result of evolution. Our results confirm that enveloped DNA viruses have a more complicated envelopment mechanism than RNA viruses (36, 51, 52). One application of BmNPV BVs is heterogeneous protein expression by surface display technique (53). Our study provides an alternative strategy for intracellularly localized integrated membrane protein display on BVs.

In summary, our results show that the MVB budding pathway is a subordinate envelopment platform for the BmNPV nucleocapsid. To the best of our knowledge, this is the first report on the coexistence of two budding pathways in a baculovirus, and it provides additional insight on the budding mechanism of the enveloped DNA virus. Nevertheless, a key question remains: why did GP64 transport to MVBs in the protein sorting process? What is more, why did GP64 targeting the PM need uncleaved SP? A possible explanation is that small vesicles mediate GP64’s transport from the Golgi apparatus to the PM and the uncleaved SP helix is vital for the vesicle’s fusion with the PM. Several transport machineries from the Golgi apparatus to the PM have been reviewed (54); therefore, discovering the direct trafficking pathway of GP64 is the main task in our study.

MATERIALS AND METHODS

Cells and viruses.

BmN cells were cultured at 27°C using standard techniques (55). Two recombinant BmNPVs, vBmBacΔgp64-gp64 and vBmBacΔgp64-SPΔngp64, were constructed as previously described (12). Briefly, a recombinant bacmid with gp64 inactivated (BmBacΔgp64) was prepared first, and then gp64 or gp64 without the n region of SP (SPΔngp64) was introduced into BmBacΔgp64 to generate BmBacΔgp64-gp64 and BmBacΔgp64-SPΔngp64, respectively. The titers of the BVs were determined using an endpoint dilution assay (EDPA).

Electron microscopy analyses.

BmN cells were preseeded in a 25-cm2 flask (Nest Biotechnology, Wuxi, China) for overnight culture, and then the cells were infected with vBmBacΔgp64-gp64 and vBmBacΔgp64-SPΔngp64 at a multiplicity of infection (MOI) of 10 for 2 h; the cells were then washed with TC100 medium (Applichem, Darmstadt, Germany) twice and cultured normally. The supernatant was removed 30 h postinfection (p.i.), and the cells were washed twice with phosphate-buffered saline (PBS). BmN cells were fixed with 2.5% glutaraldehyde, and the cells were collected at 3,000 rpm for 30 min; the pellets were rinsed in phosphate buffer (0.1 M pH 7.0) and dehydrated in an ethanol series for TEM analyses, as previously described (56).

Immunogold labeling.

Ultrathin sections were first incubated in undiluted blocking buffer solution (20 mM phosphate buffer, 150 nM NaCl, 0.1 to 0.2% bovine serum albumin [BSA], 15 mM NaN3, pH adjusted to 7.4) for 30 min at 37°C and then in diluted anti-GP64 antibody (1:100) (the gift of Manli Wang of Wuhan Institute of Virology, CAS) or anti-CD63 antibody (1:100) (Sigma-Aldrich, USA) overnight at 4°C. After washing three times in double-distilled water (ddH2O) for 5 min each time, sample sections were incubated in diluted IgG-gold conjugate (1:100) as a secondary antibody for 2 h at 37°C and then washed three times in ddH2O as described above. Preimmune serum was used instead of the primary antibody as a negative control. Gold labeling was visualized using an H7650 TEM (Hitachi, Ibaraki, Japan) at an acceleration voltage of 80 kV. Photographs were obtained by using a Gatan 832 charge-coupled device (CCD) camera (Gatan, Pleasanton CA, USA).

Temporal analysis of the subcellular structure of virus-infected BmN cells.

BmN cells were infected with vBmBacΔgp64-gp64 at an MOI of 10 for 2 h, the unbound viruses were removed, the cells were washed twice with TC100 medium, and fresh medium was added for normal culture. The cells were fixed with 2.5% glutaraldehyde at 0, 12, 24, 30, 36, and 48 h postinfection (h p.i.), and then the cells were subjected to TEM analysis. Time zero was defined as the point at which cells had been infected for 2 h.

Dynamic BV production of vBmBacΔgp64-gp64 and vBmBacΔgp64-SPΔngp64.

BmN cells (5 × 105) were infected with vBmBacΔgp64-gp64 or vBmBacΔgp64-SPΔngp64 at an MOI of 10. At the appropriate time points (12, 24, and 48 h p.i.), supernatants were collected and the titers of the BVs were determined using an endpoint dilution assay (EDPA). Each viral infection was carried out in triplicate, and the BV titers at different times p.i. were statistically analyzed using two-way ANOVA in GraphPad Prism 8 and Student’s t test.

BV genome DNA extraction.

To isolate BV DNA, 500-μL amounts of BVs were incubated with equal volumes of polyethylene glycol 8000 (PEG 8000) (20% [wt/vol] in 1 M NaCl) for 30 min at 25°C. Then, the mixture was collected by centrifugation (12,000 × g for 15 min), resuspended (100 μL H2O), and lysed by incubation (50°C for 1 h) in virus disruption buffer (80 μL total volume containing 10 mM Tris-HCl [pH 7.6], 10 mM EDTA, 0.25% sodium dodecyl sulfate [SDS]), and proteinase K (5 μL; 20 mg/mL). Lysed BVs were phenol extracted, and viral DNA was precipitated with ethanol and resuspended in 20 μL H2O.

Extraction of intracellular viral genomic DNA.

The infected BmN cells were collected by centrifugation at 4,000 rpm for 10 min, and the supernatant was discarded. Cell pellets were resuspended with 500 μL 20% PEG 8000 and dissolved at 4°C overnight. Pellets were collected by centrifugation at 3,500 rpm for 20 min. The pellets were subsequently resuspended in 300 μL lysis buffer (0.5% SDS, 10 mM Tris-HCl [pH 7.8], 5 mM EDTA, 10 μg/mL RNase, and 50 μg/mL protease K) and incubated overnight at 37°C. The lysed cell samples were mixed with 300 μL phenol-chloroform according to the DNA extraction protocol, and viral DNA was dissolved in 20 μL Tris-EDTA (TE) buffer (10 mM Tris-HCl [pH 7.8] and 10 mM EDTA) and subjected to qPCR.

qPCR.

The genomic DNA copy number was determined as previously described (57), with some modifications. qPCR was performed with SYBR green dye (TaKaRa, Dalian, China) using primers VP39 QF and VP39 QR (Table 1) and a real-time PCR detection system (QuantStudio 6 flex system, Applied Biosystems). BmBacmid DNA was isolated according to the method in the Bac-to-Bac manual (Thermo Fisher Scientific) and quantified by spectrophotometer measurement of the optical density at 260 nm (OD260). A standard curve was generated using 10-fold dilutions of the BmBacmid DNA. qPCR was carried out using 40 cycles of denaturation at 95°C, followed by 60°C and 72°C for annealing/extension.

TABLE 1.

Target sequences of RNAi and sequences of primers for qPCR

RNAi target or qPCR primera Sequence (5′→3′)
Targets
 VPS4 GATGATAAGAAGAGTGATA
 VPS24 GCATAAACTTCGCAAAGAA
 VTA1 CCTTAAGAATGGAGAGACA
 SNF7 GCTCCAACCGTGAAGGAAA
Primers
 VPS4 QF TCCGAGCCCAACTGATCCTA
 VPS4 QR TGACATTGTAACTGGCGGCT
 VPS24 QF AGGAGATGCTGGACGAAACC
 VPS24 QR CAACTTCACTTTGCGCTGCT
 VTA1 QF AAGTATGCTAAGTGGAAGGCTG
 VTA1 QR GGGTGCTATGGGAGGTGTT
 SNF7 QF CAGGTGCTGGATGAGATCGG
 SNF7 QR TGTCGGCGTCTGTAGTTGAT
 VP39 QF TCTCGTCCATCGTGTCGTTC
 VP39 QR CGTCTTCGTCGAAAATGGGC
 GAPDH QF CATTCCGCGTCCCTGTTGCTAAT
 GAPDH QR GCTGCCTCCTTGACCTTTTGC
Open in a new tab
a

F, forward; R, reverse.

Comparison of relative infectivities of vBmBacΔgp64-gp64 and vBmBacΔgp64-SPΔngp64.

To compare the relative infectivities of the two viruses, 1 μL BV DNA was used as the template for qPCR, and the CT values at each time point were recorded. The DNA concentration at each time point was transformed according to the standard curve and CT values. The relative viral infectivity was evaluated using the genomic DNA copy number averaged by the titer (58). The significance of the differences between the two viruses was statistically analyzed using two-way ANOVA in GraphPad Prism 8, and the t test was used to perform statistical significance analysis at three time points.

Cell-based ELISA.

BmN cells were seeded in 48-well plates at a density of 1.8 × 105 cells per well overnight and infected with vBmBacΔgp64-gp64 or vBmBacΔgp64-SPΔngp64 at an MOI of 3 for 2 h. At 0, 12, 24, 36, 48, and 72 h p.i., the supernatant was removed and fixed with 4% paraformaldehyde for 15 min without permeabilization. After cleaning twice with 2% BSA/PBS solution, 5% skim milk powder solution was added and blocked for 1 h, and then the cells were incubated with GP64 antibody at a ratio of 1:500 for 2 h. After three washes with Tris-buffered saline with Tween 20 (TBST), cells were incubated with horseradish peroxidase (HRP)-labeled secondary antibody (Beyotime, Shanghai, China) at a ratio of 1:500 for 1 h. Finally, the cells were washed with TBST three times, 100 μL tetramethylbenzidine chromogen solution (Beyotime) was added and incubated for 3 min away from light, and the absorbance was measured using a Perkin-Elmer multimode plate reader (Waltham, MA, USA).

Cell-cell fusion assay of virus-infected cells.

BmN cells were seeded overnight in a 48-well cell culture plate (1.8 × 105 cells/well), and then the cells were infected with vBmBacΔgp64-gp64 or vBmBacΔgp64-SPΔngp64 at an MOI of 3. The unbound virus was removed at 2 h p.i. and cells were normal cultured with fresh medium. At 0, 12, 24, 36, 48, and 72 h p.i., cell-cell fusion was induced using a low-pH TC100 medium (pH 4.5), the nuclei were stained with Hoechst stain (H33258) for 30 min, normal cell culture medium was added, and a fluorescence microscope was used for imaging. Five fields were randomly selected for the fusion assay, and the cell fusion efficiency was calculated as the percentage of fused nuclei out of the total number of nuclei.

U18666A inhibitory assay.

BmN cells were then seeded in 12-well plates at a density of 5 × 105 cells per well overnight and infected with vBmBacΔgp64-gp64 or vBmBacΔgp64-SPΔngp64 at an MOI of 1 for 2 h. Unattached viruses were removed, the cells were washed twice with TC100 insect medium without fetal bovine serum (FBS), and BmN cells were cultured with fresh medium. The cells were incubated with 2 or 8 mM U18666A (MedChemExpress, Monmouth Junction, NJ, USA) at 12 h p.i. The supernatant was harvested at 48 h p.i. for titration and BV DNA extraction, and the cells were collected for viral genomic DNA extraction, Western blotting, and cell ELISA.

siRNA synthesis and transfection.

Small interfering RNAs (siRNAs) targeting the VPS4 (100313493), VPS24 (101740115), VTA1 (732946), and SNF7 (101743802) genes were synthesized using the in vitro transcription T7 kit (TaKaRa, Dalian, China) according to the target sequences (Table 1), and scrambled-siRNA sequences were used as negative controls (NC). A total of 5 × 104 BmN cells were preseeded in 24-well cell culture plates overnight. The cells were infected with vBmBacΔgp64-gp64 and vBmBacΔgp64-SPΔngp64 at an MOI of 1 for 2 h. The unbound virus was removed and transfected with 50 pmol of siRNA using R4000 (Engreen Biosystem, Beijing, China) according to the manufacturer’s instructions, and scrambled siRNA was used as a control. The effects of RNA interference were evaluated by qPCR with the primers listed in Table 1. The supernatants of each treatment were collected at 48 h p.i. and subjected to titration, and then the cells were collected for Western blotting or cell ELISA.

ACKNOWLEDGMENTS

This work was supported by the National Natural Science Foundation of China (grants number 32172796 and 32272943).

We thank Manli Wang of Wuhan Institute of Virology, CAS for providing the GP64 antibodies.

Contributor Information

Bifang Hao, Email: bfhao@just.edu.cn.

Jinshan Huang, Email: jshuang@just.edu.cn.

Felicia Goodrum, The University of Arizona.

REFERENCES

  • 1.Harrison RL, Herniou EA, Jehle JA, Theilmann DA, Burand JP, Becnel JJ, Krell PJ, van Oers MM, Mowery JD, Bauchan GR, ICTV Report Consortium . 2018. ICTV virus taxonomy profile: Baculoviridae. J Gen Virol 99:1185–1186. 10.1099/jgv.0.001107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Blissard GW, Theilmann DA. 2018. Baculovirus entry and egress from insect cells. Annu Rev Virol 5:113–139. 10.1146/annurev-virology-092917-043356. [DOI] [PubMed] [Google Scholar]
  • 3.Shi Y, Li K, Tang P, Li Y, Zhou Q, Yang K, Zhang Q. 2015. Three-dimensional visualization of the Autographa californica multiple nucleopolyhedrovirus occlusion-derived virion envelopment process gives new clues as to its mechanism. Virology 476:298–303. 10.1016/j.virol.2014.11.030. [DOI] [PubMed] [Google Scholar]
  • 4.Gomi S, Majima K, Maeda S. 1999. Sequence analysis of the genome of Bombyx mori nucleopolyhedrovirus. J Gen Virol 80:1323–1337. 10.1099/0022-1317-80-5-1323. [DOI] [PubMed] [Google Scholar]
  • 5.Katou Y, Ikeda M, Kobayashi M. 2006. Abortive replication of Bombyx mori nucleopolyhedrovirus in Sf9 and High Five cells: defective nuclear transport of the virions. Virology 347:455–465. 10.1016/j.virol.2005.11.043. [DOI] [PubMed] [Google Scholar]
  • 6.Ono C, Kamagata T, Taka H, Sahara K, Asano S, Bando H. 2012. Phenotypic grouping of 141 BmNPVs lacking viral gene sequences. Virus Res 165:197–206. 10.1016/j.virusres.2012.02.016. [DOI] [PubMed] [Google Scholar]
  • 7.Xu YP, Gu LZ, Lou YH, Cheng RL, Xu HJ, Wang WB, Zhang CX. 2012. A baculovirus isolated from wild silkworm encompasses the host ranges of Bombyx mori nucleopolyhedrosis virus and Autographa californica multiple nucleopolyhedrovirus in cultured cells. J Gen Virol 93:2480–2489. 10.1099/vir.0.043836-0. [DOI] [PubMed] [Google Scholar]
  • 8.Huang J, Hao B, Cheng C, Liang F, Shen X, Cheng X. 2014. Entry of Bombyx mori nucleopolyhedrovirus into BmN cells by cholesterol-dependent macropinocytic endocytosis. Biochem Biophys Res Commun 453:166–171. 10.1016/j.bbrc.2014.09.073. [DOI] [PubMed] [Google Scholar]
  • 9.Zhu F, Song D, Chen H, Tang Q, Huo S, Liu X, Chen K. 2021. A lipidome map of the silkworm Bombyx mori: influences of viral infection. J Proteome Res 20:695–703. 10.1021/acs.jproteome.0c00608. [DOI] [PubMed] [Google Scholar]
  • 10.Fan Y, Bao J, Fu X, Wu P, Chen J, Huang Y, Wei J, Pan G, Li C, Zhou Z. 2022. The NPC families mediate BmNPV entry. Microbiol Spectr 10:e00917-22. 10.1128/spectrum.00917-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Li Z, Fan Y, Wei J, Mei X, He Q, Zhang Y, Li T, Long M, Chen J, Bao J, Pan G, Li C, Zhou Z. 2019. Baculovirus utilizes cholesterol transporter NIEMANN-Pick C1 for host cell entry. Front Microbiol 10:2825. 10.3389/fmicb.2019.02825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hao B, Nan W, Xu Y, Liu L, Liu N, Huang J. 2021. Two cholesterol recognition amino acid consensus motifs of GP64 with uncleaved signal peptide are required for Bombyx mori nucleopolyhedrovirus infection. Microbiol Spectr 9:e0172521. 10.1128/Spectrum.01725-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Luz-Madrigal A, Asanov A, Camacho-Zarco AR, Sampieri A, Vaca L. 2013. A cholesterol recognition amino acid consensus domain in GP64 fusion protein facilitates anchoring of baculovirus to mammalian cells. J Virol 87:11894–11907. 10.1128/JVI.01356-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hao B, Liu L, Liu N, Sun L, Fan F, Huang J. 2022. The Bombyx mori nucleopolyhedrovirus GP64 retains the transmembrane helix of signal peptide to contribute to secretion across the cytomembrane. Microbiol Spectr 10:e01913-22. 10.1128/spectrum.01913-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Fraser MJ. 1986. Ultrastructural observations of virion maturation in Autographa californica nuclear polyhedrosis virus infected Spodoptera frugiperda cell cultures. J Ultrastruct Mol Struct Res 95:189–195. 10.1016/0889-1605(86)90040-6. [DOI] [Google Scholar]
  • 16.Yue Q, Yu Q, Yang Q, Xu Y, Guo Y, Blissard GW, Li Z. 2018. Distinct roles of cellular ESCRT-I and ESCRT-III proteins in efficient entry and egress of budded virions of Autographa californica multiple nucleopolyhedrovirus. J Virol 92:e01636-17. 10.1128/JVI.01636-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Babst M. 2011. MVB vesicle formation: ESCRT-dependent, ESCRT-independent and everything in between. Curr Opin Cell Biol 23:452–457. 10.1016/j.ceb.2011.04.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Watanabe T, Sorensen EM, Naito A, Schott M, Kim S, Ahlquist P. 2007. Involvement of host cellular multivesicular body functions in hepatitis B virus budding. Proc Natl Acad Sci USA 104:10205–10210. 10.1073/pnas.0704000104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lai CK, Jeng KS, Machida K, Lai MM. 2010. Hepatitis C virus egress and release depend on endosomal trafficking of core protein. J Virol 84:11590–11598. 10.1128/JVI.00587-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Elgner F, Ren H, Medvedev R, Ploen D, Himmelsbach K, Boller K, Hildt E. 2016. The intracellular cholesterol transport inhibitor U18666A inhibits the exosome-dependent release of mature hepatitis C virus. J Virol 90:11181–11196. 10.1128/JVI.01053-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Welsch S, Muller B, Krausslich HG. 2007. More than one door—budding of enveloped viruses through cellular membranes. FEBS Lett 581:2089–2097. 10.1016/j.febslet.2007.03.060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Pelchen-Matthews A, Kramer B, Marsh M. 2003. Infectious HIV-1 assembles in late endosomes in primary macrophages. J Cell Biol 162:443–455. 10.1083/jcb.200304008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kolesnikova L, Berghofer B, Bamberg S, Becker S. 2004. Multivesicular bodies as a platform for formation of the Marburg virus envelope. J Virol 78:12277–12287. 10.1128/JVI.78.22.12277-12287.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Urata S, Noda T, Kawaoka Y, Yokosawa H, Yasuda J. 2006. Cellular factors required for Lassa virus budding. J Virol 80:4191–4195. 10.1128/JVI.80.8.4191-4195.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Harty RN, Brown ME, Wang G, Huibregtse J, Hayes FP. 2000. A PPxY motif within the VP40 protein of Ebola virus interacts physically and functionally with a ubiquitin ligase: implications for filovirus budding. Proc Natl Acad Sci USA 97:13871–13876. 10.1073/pnas.250277297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Jiang W, Ma P, Deng L, Liu Z, Wang X, Liu X, Long G. 2020. Hepatitis A virus structural protein pX interacts with ALIX and promotes the secretion of virions and foreign proteins through exosome-like vesicles. J Extracell Vesicles 9:1716513. 10.1080/20013078.2020.1716513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Jouvenet N, Neil SJ, Bess C, Johnson MC, Virgen CA, Simon SM, Bieniasz PD. 2006. Plasma membrane is the site of productive HIV-1 particle assembly. PLoS Biol 4:e435. 10.1371/journal.pbio.0040435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ward BM, Moss B. 2001. Visualization of intracellular movement of vaccinia virus virions containing a green fluorescent protein-B5R membrane protein chimera. J Virol 75:4802–4813. 10.1128/JVI.75.10.4802-4813.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ohkawa T, Welch MD. 2018. Baculovirus actin-based motility drives nuclear envelope disruption and nuclear egress. Curr Biol 28:2153–2159.e4. 10.1016/j.cub.2018.05.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Maday S, Twelvetrees AE, Moughamian AJ, Holzbaur EL. 2014. Axonal transport: cargo-specific mechanisms of motility and regulation. Neuron 84:292–309. 10.1016/j.neuron.2014.10.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Jiang B, Himmelsbach K, Ren H, Boller K, Hildt E. 2015. Subviral hepatitis B virus filaments, like infectious viral particles, are released via multivesicular bodies. J Virol 90:3330–3341. 10.1128/JVI.03109-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Chapuy-Regaud S, Subra C, Requena M, de Medina P, Amara S, Delton-Vandenbroucke I, Payre B, Cazabat M, Carriere F, Izopet J, Poirot M, Record M. 2013. Progesterone and a phospholipase inhibitor increase the endosomal bis(monoacylglycero)phosphate content and block HIV viral particle intercellular transmission. Biochimie 95:1677–1688. 10.1016/j.biochi.2013.05.019. [DOI] [PubMed] [Google Scholar]
  • 33.Tang Y, Leao IC, Coleman EM, Broughton RS, Hildreth JE. 2009. Deficiency of Niemann-Pick type C-1 protein impairs release of human immunodeficiency virus type 1 and results in Gag accumulation in late endosomal/lysosomal compartments. J Virol 83:7982–7995. 10.1128/JVI.00259-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ju Y, Bai H, Ren L, Zhang L. 2021. The role of exosome and the ESCRT pathway on enveloped virus infection. Int J Mol Sci 22:9060. 10.3390/ijms22169060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Huttunen M, Samolej J, Evans RJ, Yakimovich A, White IJ, Kriston-Vizi J, Martin-Serrano J, Sundquist WI, Frickel EM, Mercer J. 2021. Vaccinia virus hijacks ESCRT-mediated multivesicular body formation for virus egress. Life Sci Alliance 4:e202000910. 10.26508/lsa.202000910. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Calistri A, Sette P, Salata C, Cancellotti E, Forghieri C, Comin A, Gottlinger H, Campadelli-Fiume G, Palu G, Parolin C. 2007. Intracellular trafficking and maturation of herpes simplex virus type 1 gB and virus egress require functional biogenesis of multivesicular bodies. J Virol 81:11468–11478. 10.1128/JVI.01364-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Morita E, Sandrin V, McCullough J, Katsuyama A, Baci Hamilton I, Sundquist WI. 2011. ESCRT-III protein requirements for HIV-1 budding. Cell Host Microbe 9:235–242. 10.1016/j.chom.2011.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Usami Y, Popov S, Weiss ER, Vriesema-Magnuson C, Calistri A, Gottlinger HG. 2012. Regulation of CHMP4/ESCRT-III function in human immunodeficiency virus type 1 budding by CC2D1A. J Virol 86:3746–3756. 10.1128/JVI.06539-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Lambert C, Doring T, Prange R. 2007. Hepatitis B virus maturation is sensitive to functional inhibition of ESCRT-III, Vps4, and gamma 2-adaptin. J Virol 81:9050–9060. 10.1128/JVI.00479-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Ward DM, Vaughn MB, Shiflett SL, White PL, Pollock AL, Hill J, Schnegelberger R, Sundquist WI, Kaplan J. 2005. The role of LIP5 and CHMP5 in multivesicular body formation and HIV-1 budding in mammalian cells. J Biol Chem 280:10548–10555. 10.1074/jbc.M413734200. [DOI] [PubMed] [Google Scholar]
  • 41.Norgan AP, Davies BA, Azmi IF, Schroeder AS, Payne JA, Lynch GM, Xu Z, Katzmann DJ. 2013. Relief of autoinhibition enhances Vta1 activation of Vps4 via the Vps4 stimulatory element. J Biol Chem 288:26147–26156. 10.1074/jbc.M113.494112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Hurley JH. 2010. The ESCRT complexes. Crit Rev Biochem Mol Biol 45:463–487. 10.3109/10409238.2010.502516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Harel S, Altaras Y, Nachmias D, Rotem-Dai N, Dvilansky I, Elia N, Rousso I. 2022. Analysis of individual HIV-1 budding event using fast AFM reveals a multiplexed role for VPS4. Biophys J 121:4229–4238. 10.1016/j.bpj.2022.08.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Huang J, Liu N, Xu F, Ayepa E, Amanze C, Sun L, Shen Y, Yang M, Yang S, Shen X, Hao B. 2019. Efficient expression and processing of Ebola virus glycoprotein induces morphological changes in BmN cells but cannot rescue deficiency of Bombyx mori nucleopolyhedrovirus GP64. Viruses 11:1067. 10.3390/v11111067. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Sun L, Yao C, Amanze C, Yin B, Huang J, Hao B. 2022. The cytoplasmic tail substitution increases the assembly efficiency of Ebola virus glycoprotein on the budded virus of Bombyx mori nucleopolyhedrovirus. Protein Expr Purif 200:106156. 10.1016/j.pep.2022.106156. [DOI] [PubMed] [Google Scholar]
  • 46.Weissenhorn W, Poudevigne E, Effantin G, Bassereau P. 2013. How to get out: ssRNA enveloped viruses and membrane fission. Curr Opin Virol 3:159–167. 10.1016/j.coviro.2013.03.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Lai JC, Chan WW, Kien F, Nicholls JM, Peiris JS, Garcia JM. 2010. Formation of virus-like particles from human cell lines exclusively expressing influenza neuraminidase. J Gen Virol 91:2322–2330. 10.1099/vir.0.019935-0. [DOI] [PubMed] [Google Scholar]
  • 48.Cifuentes-Munoz N, Salazar-Quiroz N, Tischler ND. 2014. Hantavirus Gn and Gc envelope glycoproteins: key structural units for virus cell entry and virus assembly. Viruses 6:1801–1822. 10.3390/v6041801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Garoff H, Sjoberg M, Cheng RH. 2004. Budding of alphaviruses. Virus Res 106:103–116. 10.1016/j.virusres.2004.08.008. [DOI] [PubMed] [Google Scholar]
  • 50.Hao B, Li J, Sun C, Huang J. 13 December 2022. Label-free proteomics analysis on the envelope of budded viruses of Bombyx mori nucleopolyhedrovirus harboring differential localized GP64. Virus Genes 10.1007/s11262-022-01961-1. [DOI] [PubMed] [Google Scholar]
  • 51.Sodeik B, Krijnse-Locker J. 2002. Assembly of vaccinia virus revisited: de novo membrane synthesis or acquisition from the host? Trends Microbiol 10:15–24. 10.1016/s0966-842x(01)02256-9. [DOI] [PubMed] [Google Scholar]
  • 52.Mettenleiter TC, Klupp BG, Granzow H. 2006. Herpesvirus assembly: a tale of two membranes. Curr Opin Microbiol 9:423–429. 10.1016/j.mib.2006.06.013. [DOI] [PubMed] [Google Scholar]
  • 53.Zhang Y, Lv Z, Chen J, Chen Q, Quan Y, Kong L, Zhang H, Li S, Zheng Q, Chen J, Nie Z, Wang J, Jin Y, Wu X. 2008. A novel method for isolation of membrane proteins: a baculovirus surface display system. Proteomics 8:4178–4185. 10.1002/pmic.200800133. [DOI] [PubMed] [Google Scholar]
  • 54.Stalder D, Gershlick DC. 2020. Direct trafficking pathways from the Golgi apparatus to the plasma membrane. Semin Cell Dev Biol 107:112–125. 10.1016/j.semcdb.2020.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Huang J, Liu N, Shen X, Hao B. 2019. Preincubation with a low concentration of methyl-beta-cyclodextrin enhances baculovirus expression system productivity. Biotechnol Lett 41:921–928. 10.1007/s10529-019-02708-z. [DOI] [PubMed] [Google Scholar]
  • 56.Lv MF, Xie L, Li YQ, Zhang XM, Li M, Liao ZF, Zhang ZK, Hong J, Zhang HM. 2021. Improved quantification of immune-gold labeling and its use to compare the distribution of cellular factors among sub-chloroplast compartments. Micron 145:103060. 10.1016/j.micron.2021.103060. [DOI] [PubMed] [Google Scholar]
  • 57.Wang M, Tuladhar E, Shen S, Wang H, van Oers MM, Vlak JM, Westenberg M. 2010. Specificity of baculovirus P6.9 basic DNA-binding proteins and critical role of the C terminus in virion formation. J Virol 84:8821–8828. 10.1128/JVI.00072-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Wang M, Tan Y, Yin F, Deng F, Vlak JM, Hu Z, Wang H. 2008. The F-like protein Ac23 enhances the infectivity of the budded virus of gp64-null Autographa californica multinucleocapsid nucleopolyhedrovirus pseudotyped with baculovirus envelope fusion protein F. J Virol 82:9800–9804. 10.1128/JVI.00759-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES