Skip to main content
. 2023 Mar 16;12:e82345. doi: 10.7554/eLife.82345

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (E. coli) MC1061 Lucigen Lucigen: 10361012 bacterial cells used for surface-display screens
Strain, strain background (E. coli) DH5α Invitrogen Invitrogen: 18265017 bacterial cells used for
general cloning and library cloning
Strain, strain background (E. coli) BL21(DE3) ThermoFisher Scientific Thermo: C600003 bacterial cells for general protein-expression;
pre-transformed with pCDF-YopH for
tyrosine kinase overexpression
Strain, strain background (E. coli) C43(DE3) Lucigen Lucigen: NC9581214 bacterial cells used for SH2 domain over-expression;
pre-transformed with pCDFDuet-BirA-WT for biotinylation
Antibody 4 G10 Platinum, Biotin (mouse monoclonal) Millipore Sigma Millipore Sigma: 16–452-MI biotin conjugated mouse monoclonal
pan-phosphotyrosine antibody dilution: (1:1000)
Antibody PY20-PerCP-eFluor 710 (mouse monoclonal) eBioscience eBioscience: 46-5001-42 PerCP-eFluor 710-conjugated mouse monoclonal
pan-phosphotyrosine antibody, clone PY20 dilution: (1:25)
Antibody PY20-biotin (mouse monoclonal) Exalpha Exalpha: 50-210-1865 biotin conjugated mouse monoclonal
pan-phosphotyrosine antibody dilution (1:500)
Antibody StrepMAB Chromeo 488 (mouse monoclonal) IBA LifeSciences IBA: 2-1546-050 Chromeo 488-conjugated antibody that
recognizes the strep-tag dilution: (1:50–100).
Discontinued, but can be replaced with IBA
LifeSciences StrepMAB-Classic conjugate
DY-488 (IBA: 2-1563-050)
Recombinant DNA reagent pBAD33-eCPX PMID:18480093 Addgene: 23336 pBAD33 plasmid encoding the eCPX bacterial
display gene with flanking 5' and 3' SfiI restriction sites
Recombinant DNA reagent pBAD33-eCPX-cStrep PMID:29547119
pBAD33 plasmid encoding the eCPX bacterial
display gene with a 3' sequence encoding a
strep-tag and flanking 5' and 3' SfiI restriction sites
Recombinant DNA reagent pBAD33-eCPX-cMyc this paper
pBAD33 plasmid encoding the eCPX bacterial
display gene with a 3' sequence encoding a
myc-tag and flanking 5' and 3' SfiI restriction sites
Recombinant DNA reagent X5-Y-X5 Library (myc-tagged) this paper
peptide display library in the pBAD33 vector, fused
to the eCPX scaffold, containing 1–10 million
unique sequences with the structure X5-Y-X5, where X is
encoded by an NNS codon. The scaffold protein is
encoded to have a C-terminal myc-tag: EQKLISEEDL.
Recombinant DNA reagent X5-Y-X5 Library (strep-tagged) this paper
peptide display library in the pBAD33 vector, fused to
the eCPX scaffold, containing 1–10 million unique
sequences with the structure X5-Y-X5,
where X is encoded by an NNS codon.
The scaffold protein is encoded to have a
C-terminal strep-tag: WSHPQFEK.
Recombinant DNA reagent pTyr-Var Library (myc-tagged) this paper
peptide display library in the pBAD33 vector,
fused to the eCPX scaffold, containing ~10,000
unique sequences encoding reference and
variant phosphosite pairs deried from the
PhosphoSitePlus database. The scaffold
protein is encoded to have a C-terminal
myc-tag: EQKLISEEDL.
Recombinant DNA reagent pTyr-Var Library (strep-tagged) this paper
peptide display library in the pBAD33 vector,
fused to the eCPX scaffold, containing ~10,000
unique sequences encoding reference and variant
phosphosite pairs deried from the
PhosphoSitePlus database. The scaffold protein is
encoded to have a C-terminal strep-tag: WSHPQFEK.
Recombinant DNA reagent pET-23a-His6-TEV-Src(KD) PMID:29547119
bacterial expression vector encoding the human
c-Src kinase domain (residues 260–528), with an
N-terminal His6-tag and TEV protease recognition sequence
Recombinant DNA reagent pET-23a-His6-TEV-Fyn(KD) PMID:29547119
bacterial expression vector encoding the human
Fyn kinase domain (residues 261–529) with an
N-terminal His6-tag and TEV protease recognition sequence
Recombinant DNA reagent pET-23a-His6-TEV-Hck(KD) PMID:29547119
bacterial expression vector encoding the human
Hck kinase domain (residues 252–520) with an
N-terminal His6-tag and TEV protease recognition sequence
Recombinant DNA reagent pET-23a-His6-TEV-Abl(KD) PMID:29547119
bacterial expression vector encoding the mouse
c-Abl kinase domain (residues 232–502) with an
N-terminal His6-tag and TEV protease recognition sequence
Recombinant DNA reagent pET-23a-His6-TEV-AncSZ(KD) DOI:
10.1101/2022.04.24.489292
bacterial expression vector encoding the AncSZ
kinase domain (residues 352–627) with an N-terminal
His6-tag and TEV protease recognition sequence
Recombinant DNA reagent pET23a-His6-TEV-Fer(KD) this paper
bacterial expression vector encoding the mouse
Fer kinase domain (residues 553–823) with an
N-terminal His6-tag and TEV protease recognition sequence
Recombinant DNA reagent pET-His6-TEV-FGFR1(KD) PMID:30004690 Addgene: 79719 bacterial expression vector encoding the human
FGFR1 kinase domain (residues 456–763) with an
N-terminal His6-tag and TEV protease recognition sequence
Recombinant DNA reagent pET-His6-TEV-FGFR3(KD) PMID:30004690 Addgene: 79731 bacterial expression vector encoding the human
FGFR3 kinase domain (residues 449–759) with an
N-terminal His6-tag and TEV protease recognition sequence
Recombinant DNA reagent pET-His6-TEV-EPHB1(KD) PMID:30004690 Addgene: 79694 bacterial expression vector encoding the human
EPHB1 kinase domain (residues 602–896) with an
N-terminal His6-tag and TEV protease recognition sequence
Recombinant DNA reagent pET-His6-TEV-EPHB2(KD) PMID:30004690 Addgene: 79697 bacterial expression vector encoding the human
EPHB2 kinase domain (residues 604–898) with an
N-terminal His6-tag and TEV protease recognition sequence
Recombinant DNA reagent pET-His6-TEV-MERTK(KD) PMID:30004690 Addgene: 79705 bacterial expression vector encoding the human
MERTK kinase domain (residues 570–864) with an
N-terminal His6-tag and TEV protease recognition sequence
Recombinant DNA reagent pCDF-YopH PMID:16260764
bacterial expression vector for co-expression of
untagged YopH phosphatase with tyrosine kinases
Recombinant DNA reagent pET28-His6-TEV-SHP2-C459E-no tail this paper
bacterial expression vector encoding the human SHP2
(residues 1–526) with the C459E mutation, an N-terminal
His6-tag, and TEV protease recognition sequence
Recombinant DNA reagent pET28-His6-TEV-SHP2-C459E-no tail-D61V this paper
bacterial expression vector encoding the human SHP2
(residues 1–526) with C459E and D61V mutations, an
N-terminal His6-tag, and TEV protease recognition sequence
Recombinant DNA reagent pET28-His6-TEV-SHP2-C459E-no tail-D61N this paper
bacterial expression vector encoding the human
SHP2 (residues 1–526) with C459E and D61N mutations,
an N-terminal His6-tag, and TEV protease recognition sequence
Recombinant DNA reagent pCDFDuet-BirA-WT this paper
bacterial expression vector encoding BirA biotin ligase,
used to coexpress with SH2 domain expression
vector for biotinylation of SH2 domain
Recombinant DNA reagent pET-His6-SUMO-Src(SH2) this paper
bacterial expression vector encoding the human
cSrc SH2 domain (residues 143–250) with an
N-terminal His6-SUMO tag
Recombinant DNA reagent pET-His6-SUMO-SHP2(CSH2) this paper
bacterial expression vector encoding the human SHP2
CSH2 domain (residues 105–220) with an N-terminal His6-SUMO tag
Recombinant DNA reagent pET-His6-SUMO-Grb2(SH2) this paper
bacterial expression vector encoding the human Grb2
SH2 domain (residues 56–152) with an N-terminal His6-SUMO tag
Recombinant DNA reagent pULTRA CMF PMID:28604693
bacterial expression vector encoding the tRNA/syntetase
pair for incorporation of 4-carboxymethyl phenylalanine
via Amber suppression
Recombinant DNA reagent pEVOL pAzFRS.2.t1 PMID:26571098 Addgene: 73546 bacterial expression vector encoding the tRNA/syntetase
pair for incorporation of 4-azido phenylalanine and other
Phe derivatives via Amber suppression
Recombinant DNA reagent pULTRA chAcKRS3 PMID:29544052
bacterial expression vector encoding the tRNA/syntetase
pair for incorporation of acetyl-lysine via Amber suppression;
gift from Abhishek Chatterjee at Boston College
Recombinant DNA reagent pULTRA-Amp CMF this paper
bacterial expression vector encoding the tRNA/syntetase
pair for incorporation of 4-carboxymethyl phenylalanine
via Amber suppression, altered to have an ampicillin resistance marker
Recombinant DNA reagent pULTRA-Amp pAzFRS.2.t1 this paper
bacterial expression vector encoding the tRNA/syntetase
pair for incorporation of 4-azido phenylalanine and other
Phe derivatives via Amber suppression, altered to have
an ampicillin resistance marker
Recombinant DNA reagent pULTRA-Amp chAcKRS3 this paper
bacterial expression vector encoding the tRNA/syntetase
pair for incorporation of acetyl-lysine via Amber suppression,
altered to have an ampicillin resistance marker
Sequence-based reagent X5-Y-X5 library oligo; eCPX-rand-lib this paper, purchased from Millipore Sigma
primer sequence: 5’-GCTGGCCAGTCTGGCCAGNNS
NNSNNSNNSNNStatNNSNNSNNSNNSNNSGGAGG
GCAGTCTGGGCAGTCTG 3’
Sequence-based reagent Oligopool-fwd-primer this paper, purchased from Millipore Sigma
primer sequence: 5’-GCTGGCCAGTCTG-3’
Sequence-based reagent Oligopool-rev-primer this paper, purchased from Millipore Sigma
primer sequence: 5’-CAGACTGCCCAGACT-3’
Sequence-based reagent link-eCPX-fwd this paper, purchased from Millipore Sigma
5’-GGAGGGCAGTCTGGGCAGTCTG-3’
Sequence-based reagent link-eCPX-rev this paper, purchased from Millipore Sigma
5’-GCTTGGCCACCTTGGCCTTATTA-3’
Sequence-based reagent BB-fwd-primer this paper, purchased from Millipore Sigma
5’-TAATAAGGCCAAGGTGGCCAAGC-3’
Sequence-based reagent BB-rev primer this paper, purchased from Millipore Sigma
5’-CTGGCCAGACTGGCCAGCTACG-3’
Sequence-based reagent TruSeq-eCPX-Fwd sequence from PMID:29547119, purchased from Millipore Sigma round one amplicon PCR primer primer sequence: 5’-TGACTGGAGTTCAGACGTG
TGCTCTTCCGATCTNNNNNNACCGCA
GGTACTTCCGTAGCT-3’
Sequence-based reagent TruSeq-eCPX-Rev sequence from PMID:29547119, purchased from Millipore Sigma round one amplicon PCR primer primer sequence: 5’-CACTCTTTCCCTACACGACG
CTCTTCCGATCTNNNNNN
TTTTGTTGTAGTCACCAGACTG-3’
Sequence-based reagent D701 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-CAAGCAGAAGACGG
CATACGAGATcgagtaatGTG
ACTGGAGTTCAGACGTG-3'
Sequence-based reagent D702 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-CAAGCAGAAGA
CGGCATACGAGATtctccgga
GTGACTGGAGTTCAGACGTG-3'
Sequence-based reagent D703 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-CAAGCAGAAGA
CGGCATACGAGATaatgagcg
GTGACTGGAGTTCAGACGTG-3'
Sequence-based reagent D704 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-CAAGCAGAAGAC
GGCATACGAGATggaatctcG
TGACTGGAGTTCAGACGTG-3'
Sequence-based reagent D705 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-CAAGCAGA
AGACGGCATACGAGA
TttctgaatGTGACTGGAGT
TCAGACGTG-3'
Sequence-based reagent D706 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-CAAGCAGAAGA
CGGCATACGAGATacgaattc
GTGACTGGAGTTCAGACGTG-3'
Sequence-based reagent D707 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-CAAGCAGAAG
ACGGCATACGAGATagcttcag
GTGACTGGAGTTCAGACGTG-3'
Sequence-based reagent D708 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-CAAGCAGAAGACG
GCATACGAGATgcgcattaGT
GACTGGAGTTCAGACGTG-3'
Sequence-based reagent D709 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-CAAGCAGAAG
ACGGCATACGAGATcatagccg
GTGACTGGAGTTCAGACGTG-3'
Sequence-based reagent D710 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-CAAGCAGA
AGACGGCATACGAGATttcgcgga
GTGACTGGAGTTCAGACGTG-3'
Sequence-based reagent D711 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-CAAGCAGAAGACG
GCATACGAGATgcgcgaga
GTGACTGGAGTTCAGACGTG-3'
Sequence-based reagent D712 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-CAAGCAGAA
GACGGCATACGAGATctatcgctGT
GACTGGAGTTCAGACGTG-3'
Sequence-based reagent D501 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-AATGATACGGCGA
CCACCGAGATCTACACtatagcct
ACACTCTTTCCCTACACGAC-3'
Sequence-based reagent D502 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-AATGATACGGCG
ACCACCGAGATCTACACatagaggc
ACACTCTTTCCCTACACGAC-3'
Sequence-based reagent D503 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-AATGATACGGCGA
CCACCGAGATCTACACcctatcct
ACACTCTTTCCCTACACGAC-3'
Sequence-based reagent D504 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-AATGATACGGCGA
CCACCGAGATCTACACggctctga
ACACTCTTTCCCTACACGAC-3'
Sequence-based reagent D505 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-AATGATACGGC
GACCACCGAGATCTACACaggcgaag
ACACTCTTTCCCTACACGAC-3'
Sequence-based reagent D506 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-AATGATACGG
CGACCACCGAGATCTACACtaatctta
ACACTCTTTCCCTACACGAC-3'
Sequence-based reagent D507 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-AATGATACGGC
GACCACCGAGATCTACACcaggacgt
ACACTCTTTCCCTACACGAC-3'
Sequence-based reagent D508 sequence from Illumina, purchased from Millipore Sigma round two amplicon/indexing PCR primer primer sequence: 5'-AATGATACG
GCGACCACCGAGATCTACAC
gtactgacACACTCTTTCCCTACACGAC-3'
Peptide, recombinant protein Src(KD) this paper, expressed/purified in-house
human c-Src kinase domain (residues 260–528)
Peptide, recombinant protein Fyn(KD) this paper, expressed/purified in-house
human Fyn kinase domain (residues 261–529)
Peptide, recombinant protein Hck(KD) this paper, expressed/purified in-house
human Hck kinase domain (residues 252–520)
Peptide, recombinant protein Abl(KD) this paper, expressed/purified in-house
mouse c-Abl kinase domain (residues 232–502)
Peptide, recombinant protein JAK2 Protein, active Millipore Sigma Millipore Sigma: 14–640 M Active, C-terminal His6-tagged,
recombinant, human JAK2, amino
acids 808-end, expressed by baculo
virus in Sf21 cells, for use in Enzyme Assays.
Peptide, recombinant protein AncSZ(KD) this paper, expressed/purified in-house
AncSZ kinase domain (residues 352–627)
designed by ancestral sequence reconstruction
Peptide, recombinant protein Fer(KD) this paper, expressed/purified in-house
mouse Fer kinase domain (residues 553–823)
Peptide, recombinant protein FGFR1(KD) this paper, expressed/purified in-house
human FGFR1 kinase domain (residues 456–763)
Peptide, recombinant protein FGFR3(KD) this paper, expressed/purified in-house
human FGFR3 kinase domain (residues 449–759)
Peptide, recombinant protein EPHB1(KD) this paper, expressed/purified in-house
human EPHB1 kinase domain (residues 602–896)
Peptide, recombinant protein EPHB2(KD) this paper, expressed/purified in-house
human EPHB2 kinase domain (residues 604–898)
Peptide, recombinant protein MERTK(KD) this paper, expressed/purified in-house
human MERTK kinase domain (residues 570–864)
Peptide, recombinant protein Src(SH2) this paper, expressed/purified in-house
human c-Src SH2 domain (residues 143–250)
Peptide, recombinant protein SHP2(C-SH2) this paper, expressed/purified in-house
human SHP2 C-SH2 domain (residues 105–220)
Peptide, recombinant protein Grb2(SH2) this paper, expressed/purified in-house
human Grb2 SH2 domain (residues 56–152)
Peptide, recombinant protein SHP2(PTP; C459E) this paper, expressed/purified in-house
human full-length SHP2 (residues 1–526; C459E)
Peptide, recombinant protein SHP2(PTP; C459E, D61V) this paper, expressed/purified in-house
human full-length SHP2 (residues 1–526; C459E, D61V)
Peptide, recombinant protein SHP2(PTP; C459E, D61N) this paper, expressed/purified in-house
human full-length SHP2 (residues 1–526; C459E, D61N)
Peptide, recombinant protein SHP2(PTP; C459E, G60V) this paper, expressed/purified in-house
human full-length SHP2 (residues 1–526; C459E, G60V)
Peptide, recombinant protein Src Consensus this paper, synthesized in-house
peptide sequence: Ac-GPDECIYDMFPFKKKG-NH2
Peptide, recombinant protein Src Consensus (P-5C, D+1 G) this paper, synthesized in-house
peptide sequence: Ac-GCDECIYGMFPFRRRG-NH2
Peptide, recombinant protein Abl Consensus this paper, synthesized in-house
peptide sequence: Ac-GPDEPIYAVPPIKKKG-NH2
Peptide, recombinant protein Fer Consensus this paper, synthesized in-house
peptide sequence: Ac-GPDEPIYEWWWIKKKG-NH2
Peptide, recombinant protein EPHB1 Consensus this paper, synthesized in-house
peptide sequence: Ac-GPPEPNYEVIPPKKKG-NH2
Peptide, recombinant protein EPHB2 Consensus this paper, synthesized in-house
peptide sequence: Ac-GPPEPIYEVPPPKKKG-NH2
Peptide, recombinant protein SrcTide (1995) sequence from PMID:7845468, synthesized in-house
peptide sequence: Ac-GAEEEIYGEFEAKKKG-NH2
Peptide, recombinant protein SrcTide (2014) sequence from PMID:25164267, purchased from Synpeptide
peptide sequence: Ac-GAEEEIYGIFGAKKKG-NH2
Peptide, recombinant protein AblTide (2014) sequence from PMID:7845468, synthesized in-house
peptide sequence: Ac-GAPEVIYATPGAKKKG-NH2
Peptide, recombinant protein HRAS_Y64 sequence from PMID:35606422, purchased from Synpeptide
peptide sequence: Ac-AGQEEYSAMRD-NH2
Peptide, recombinant protein HRAS_Y64_E63K sequence from PMID:35606422, purchased from Synpeptide
peptide sequence: Ac-AGQEKYSAMRD-NH2
Peptide, recombinant protein CDK13_Y716_YF this paper, synthesized in-house
peptide sequence: Ac-IGEGTYGQVFK-NH2
Peptide, recombinant protein CDK13_Y716_G717R_YF this paper, synthesized in-house
peptide sequence: Ac-IGEGTYRQVFK-NH2
Peptide, recombinant protein CDK5_Y15 sequence from PMID:35606422, purchased from Synpeptide
peptide sequence: Ac-IGEGTYGTVFK-NH2
Peptide, recombinant protein CDK5_Y15_G16R sequence from PMID:35606422, purchased from Synpeptide
peptide sequence: Ac-IGEGTYRTVFK-NH2
Peptide, recombinant protein PLCG1_Y210 this paper, synthesized in-house
peptide sequence: Ac-SGDITYGQFAQ-NH2
Peptide, recombinant protein PLCG1_Y210_T209N this paper, synthesized in-house
peptide sequence: Ac-SGDINYGQFAQ-NH2
Peptide, recombinant protein GLB1_Y294 this paper, synthesized in-house
peptide sequence: Ac-VASSLYDILAR-NH2
Peptide, recombinant protein GLB1_Y294_L297F this paper, synthesized in-house
peptide sequence: Ac-VASSLYDIFAR-NH2
Peptide, recombinant protein MISP_Y95 this paper, synthesized in-house
peptide sequence: Ac-EGWQVYRLGAR-NH2
Peptide, recombinant protein HLA-DPB1_Y59_F64L_YF this paper, synthesized in-house
peptide sequence: Ac-LERFIYNREEL-NH2
Peptide, recombinant protein PEAK1_Y797 this paper, synthesized in-house
peptide sequence: Ac-SVEELYAIPPD-NH2
Peptide, recombinant protein SIRPA_Y496_P491L this paper, synthesized in-house
peptide sequence: Ac-LFSEYASVQV-NH2
Peptide, recombinant protein HGD_Y166_F169L this paper, synthesized in-house
peptide sequence: Ac-GNLLIYTELGK-NH2
Peptide, recombinant protein ITGA3_Y237_YF this paper, synthesized in-house
peptide sequence: Ac-WDLSEYSFKDP-NH2
Peptide, recombinant protein ITGA3_Y237_S235P_YF this paper, synthesized in-house
peptide sequence: Ac-WDLPEYSFKDP-NH2
Peptide, recombinant protein Src Consensus (C-2S) this paper, synthesized in-house
peptide sequence: Ac-GPDESIYDMFPFKKKG-NH2
Peptide, recombinant protein Src Consensus (C-2P) this paper, synthesized in-house
peptide sequence: Ac-GPDEPIYDMFPFKKKG-NH2
Peptide, recombinant protein ACTA1_Y171_YF this paper, synthesized in-house
peptide sequence: Ac-QPIFEG(pY)ALPHAG-NH2
Peptide, recombinant protein ACTA1_Y171_A172G_YF this paper, synthesized in-house
peptide sequence: Ac-QPIFEG(pY)GLPHAG-NH2
Peptide, recombinant protein ACTB_Y240 this paper, synthesized in-house
peptide sequence: Ac-QSLEKS(pY)ELPDGG-NH2
Peptide, recombinant protein ACTB_Y240_P243L this paper, synthesized in-house
peptide sequence: Ac-QSLEKS(pY)ELLDGG-NH2
Peptide, recombinant protein CCDC39_Y593 this paper, synthesized in-house
peptide sequence: Ac-QRKQQL(pY)TAMEEG-NH2
Peptide, recombinant protein CLIP2_Y972 this paper, synthesized in-house
peptide sequence: Ac-QSDQRR(pY)SLIDRG-NH2
Peptide, recombinant protein CLIP2_Y972_R977P this paper, synthesized in-house
peptide sequence: Ac-QSDQRR(pY)SLIDPG-NH2
Peptide, recombinant protein CBS_Y308 this paper, synthesized in-house
peptide sequence: Ac-QVEGIG(pY)DFIPTG-NH2
Peptide, recombinant protein CBS_Y308_G307S this paper, synthesized in-house
peptide sequence: Ac-QVEGIS(pY)DFIPTG-NH2
Peptide, recombinant protein fluorescently-labeled c-Src-SH2 consensus peptide sequence from PMID:7680959
peptide sequence: FITC-Ahx-GDG(pY)EEISPLLL-NH2; gift from Jeanine Amacher at Western Washignton University
Peptide, recombinant protein Src Consensus (D+1 K) this paper, synthesized in-house
peptide sequence: Ac-GPDECIYKMFPFKKKG-NH2
Peptide, recombinant protein Src Consensus (D1AcK) this paper, synthesized in-house
peptide sequence: Ac-GPDECIY(AcK)MFPFKKKG-NH2
Peptide, recombinant protein Src Consensus (C-2K) this paper, synthesized in-house
peptide sequence: Ac-GPDEKIYDMFPFKKKG-NH2
Peptide, recombinant protein Src Consensus (C-2AcK) this paper, synthesized in-house
peptide sequence: Ac-GPDE(AcK)IYDMFPFKKKG-NH2
Peptide, recombinant protein Abl Consensus (A+1 K) this paper, synthesized in-house
peptide sequence: Ac-GPDEPIYKVPPIKKKG-NH2
Peptide, recombinant protein Abl Consensus (A+1 AcK) this paper, synthesized in-house
peptide sequence: Ac-GPDEPIY(AcK)VPPIKKKG-NH2
Peptide, recombinant protein Abl Consensus (I+5 K) this paper, synthesized in-house
peptide sequence: Ac-GPDEPIYAVPPKKKKG-NH2
Peptide, recombinant protein Abl Consensus (I+5 AcK) this paper, synthesized in-house
peptide sequence: Ac-GPDEPIYAVPP(AcK)KKKG-NH2
Commercial assay or kit MiSeq Reagent Kit v3 (150 cycles) Illumina Illumina:
MS-102–3001
Commercial assay or kit NextSeq 500 Mid-Output v2 Kit (150 cycles) Illumina Illumina:
FC-404–2001
Commercial assay or kit Promega QuantiFluor dsDNA Sample Kit Promega Promega:
E2671
Commercial assay or kit ADP Quest Assay Kit Eurofins Discoverx Eurofins Discoverx:
90–0071
Commercial assay or kit Dynabeads FlowComp Flexi Kit ThermoFisher Scientific ThermoFisher Scientific:
11061D
Chemical compound, drug 4-carboxymethyl phenylalanine (CMF) Millipore Sigma Millipore
Sigma:
ENA423210770
Chemical compound, drug 4-azido-L-phenylalanine (AzF) Chem-Impex International Chem-Impex:
06162
Chemical compound, drug N-ε-Acetyl-L-Lysine (AcK) MP Biomedicals MP
Biomedicals:
02150235.2
Chemical compound, drug Click-iT sDIBO -Alexa fluor 555 ThermoFisher Thermo: C20021
Other Creatine Phosphokinase from rabbit muscle Millipore Sigma Millipore Sigma:
C3755-500UN		 purified enzyme extracted from rabbit muscle
Software, algorithm FLASH (version FLASH2-2.2.00) PMID:21903629
https://ccb.jhu.edu/software/FLASH/
Software, algorithm Cutadapt (version 3.5) DOI:10.14806/ej.17.1.200
https://cutadapt.readthedocs.io/en/stable/
Software, algorithm Python scripts for processing and analysis of adeep sequencing data this paper (Li et al., 2023)
https://github.com/nshahlab/2022_Li-et-al_peptide-display
Software, algorithm Logomaker PMID:31821414
https://logomaker.readthedocs.io/en/latest/index.html