| Antibodies |
|
| Hamster monoclonal anti-mouse CD3 |
eBioscience |
Clone 145-2C11 |
| Hamster monoclonal anti-mouse CD28 |
eBioscience |
Clone 37.51 |
| Rat monoclonal anti-mouse IFN-gamma |
eBioscience |
Clone AN-18 |
| Rat monoclonal anti-mouse CD4 |
eBioscience |
Clone GK1.5 |
| Rat monoclonal anti-mouse IFN-gamma |
eBioscience |
Clone XMG1.2 |
| Rat monoclonal anti-mouse CD8 |
eBioscience |
Clone 53-6.7 |
| Rat monoclonal anti-mouse TNF-α |
eBioscience |
Clone MP6-XT22 |
| Rat monoclonal anti-mouse Granzyme B |
eBioscience |
Clone NGZB |
| Rat monoclonal anti-mouse CD44 |
eBioscience |
Clone IM7 |
| Hamster monoclonal anti-mouse CD69 |
eBioscience |
Clone H1.2F3 |
| Hamster monoclonal anti-mouse KLRG1 |
eBioscience |
Clone 2F1 |
| Anti-mouse CX3CR1 |
BioLegend |
Clone SA011F11 |
| Anti-mouse CD127 (IL-7R) |
BioLegend |
Clone A7R34 |
| Anti-mouse CD279 (PD-1) |
BD Biosciences |
Clone RMP1-30 |
| Anti-mouse Ly108 (Slamf6) |
BioLegend |
Clone 330-AJ |
| Anti-mouse Tim-3 |
BioLegend |
Clone RMT3-23 |
| Anti-human/mouse TOX |
Miltenyi Biotec |
Clone REA473 |
| Anti-human/mouse T-bet |
BioLegend |
Clone 4B10 |
| Rabbit monoclonal anti-mouse TCF1 |
Cell Signaling |
Clone C63D9 |
| Mouse monoclonal anti-mouse CD90.1 (Thy-1.1) |
eBioscience |
Clone HIS51 |
| Rabbit polyclonal anti-human/mouse beta-actin |
Cell Signaling |
#4967 |
| Rabbit polyclonal anti-Ldha |
Cell Signaling |
#2012 |
| Rat monoclonal anti-mouse Ki67 |
eBioscience |
Clone SolA15 |
| Rabbit monoclonal anti-phospho-S6 ribosomal protein (Ser235/236) |
Cell Signaling |
#8520 |
|
| Bacterial and virus strains |
|
| Luciferase shRNA (LMPd-Amt backbone): AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGAT GTAGGATTCCAATTCAGCGGGAGCC |
vector backbone (Chen et al., 2014) |
custom |
|
Ldha shRNA1 (LMPd-Amt backbone): TGCTGTTGACAGTGAGCGAACTCAATTTGGTCCAGCGAAATAGTGAAGCCACAGATGTATTTCGCTGGACCAAATTGAGTCTGCCTACTGCCTCGGA |
This paper |
custom |
|
| Chemicals, peptides, and recombinant proteins |
|
| D-glucose [13C6] |
Cambridge Isotopes |
CLM-1396 |
| L-glutamine [13C5] |
Cambridge Isotopes |
CLM-1822 |
| sodium acetate [13C2] |
Cambridge Isotopes |
CLM-440 |
| sodium D-3-hydroxybutyrate [13C4] |
Cambridge Isotopes |
CLM-3853 |
| citric acid [13C6] |
Sigma Aldrich |
606081 |
| sodium lactate [13C3] |
Cambridge Isotopes |
CLM-10768 |
| sodium pyruvate [13C3] |
Cambridge Isotopes |
CLM-2440 |
| L-alanine [13C3] |
Cambridge Isotopes |
CLM-2184 |
| IMDM GlutaMAX |
Thermo Fisher |
3198-022 |
| Heat-inactivated FCS |
Biochrom |
S0115– Lot# 1289W |
| Penicillin-streptomycin |
Millipore |
A2213 |
| 2-mercaptoethanol |
Gibco |
#21985-023 |
| Recombinant murine IL-2 |
Peprotech |
212-12 |
| Phorbol 12-myristate 13-acetate (PMA) |
Sigma-Aldrich |
P-8139 |
| Ionomycin |
Sigma-Aldrich |
10634 |
| Glucose ≥99,5 % D(+) |
Roth |
HN06.1 |
| L-Glutamine |
Biochrom AG |
M11-004 |
| Sodium Pyruvate |
Gibco |
#11360-070 |
| Fixable Viability Dye eFluor 780 |
eBioscience |
#65-0865-14 |
| CellTrace Violet Cell Proliferation Kit |
Thermo Fisher |
C34557 |
| BD GolgiStop |
BD Biosciences |
#51-2092KZ |
| Foxp3/transcription factor staining buffer set |
eBioscience |
#00-5523-00 |
| Lyse/Fix Buffer, 5X |
BD Biosciences |
558049 |
| Perm Buffer III |
BD Biosciences |
558050 |
| 16% Formaldehyde |
Polysciences |
18814-20 |
| Hexadimethrine bromide (Polybrene) |
Sigma-Aldrich |
107689 |
| OVA(257-264) SIINFEKL peptide |
Bio-Synthesis |
custom |
|
| Critical commercial assays |
|
| EasySep Mouse Naïve CD8+ T cell isolation kit |
StemCell technologies |
#19858 |
| EasySep Mouse CD90.1 positive selection kit |
StemCell technologies |
#18958 |
| Qiagen RNAeasy Kit |
Qiagen |
#74106 |
| cOmplete, EDTA-free Protease Inhibitor Cocktail |
Roche |
11873580001 |
| Seahorse XFe96 FluxPak |
Agilent technologies |
#102416-100 |
| NAD:NADH-Glo Assay |
Promega |
G9071 |
|
| Experimental models: Cell lines |
|
| 293T |
ATCC |
CRL-3216 |
|
| Experimental models: Organisms/strains |
|
| C57BL/6J mice |
Charles River Laboratories |
CR:027 |
| OT-I mice |
Jackson Laboratories |
JAX:003831 |
| CD90.1 (Thy.1.1) mice |
Jackson Laboratories |
JAX:000406 |
|
| Software and algorithms |
|
| FlowJo 9.9.5 |
FlowJo LLC |
https://www.flowjo.com/
|
| GraphPad Prism V6 or V7 |
GraphPad Software |
https://www.graphpad.com/
|
| El-Maven |
Elucidata |
https://elucidatainc.github.io/ElMaven/
|
| Compound Discoverer V3.2 |
Thermo Scientific |
https://www.thermofisher.com/
|
| Mass Hunter V10 |
Agilent Technologies |
https://www.agilent.com
|
