Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers sequences used in quantitative real time PCR assay.
| Genes | Primers | Sequences | Bp |
|---|---|---|---|
| GAPDH | Foreword | Gtatcggacgcctggttac | 128 bp |
| Reverse | Cttgccgtgggtagagtcat | ||
| Bax | Foreword | Gtctccggcgaattggagat | 100 bp |
| Reverse | Acccggaagaagacctctcg | ||
| Bcl2 | Foreword | Catcgccctgtggatgactg | 95 bp |
| Reverse | ggccatatagttccacaaaggc | ||
| P53 | Foreword | Cccctgtcatcttttgtccct | 137 bp |
| Reverse | Agctggcagaatagcttattgag |
