Table 3.
The somatic ARMC5 variants in the bilateral adrenal mass
| Location | Gene symbol | Transcripts | Genomic location | cHGVS | pHGVS | ExIn ID | Mutation frequency | MutationTaster | SIFT | PolyPhen-2 | ExAC or 1000G |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Right adrenal | ARMC5 | NM_001105247.1 | 16p11.2 | c.284C > A | p.S95* | EX1 | 20.1% | Disease causing | Deleterious | Benign | −/− |
| Right adrenal | ARMC5 | NM_001105247.1 | 16p11.2 | c.294Gdel | p.G99Efs*38 | EX1 | 10.4% | Disease causing | Deleterious | Benign | −/− |
| Right adrenal | ARMC5 | NM_001105247.1 | 16p11.2 | c.1572_1607delAGCCCTGCTGCTGCTGTCGCGCTTTTCCCAGGCCCC | p.A525_P536del | EX4 | 2.0% | Disease causing | Deleterious | Benign | −/− |
| Left adrenal | ARMC5 | NM_001105247.1 | 16p11.2 | c.435C > A a | p.C145* | EX1 | 4.5% | Disease causing | Deleterious | Benign | −/− |
| Left adrenal | ARMC5 | NM_001105247.1 | 16p11.2 | c.2542G > T | p.E848* | EX6 | 2.1% | Disease causing | Deleterious | Benign | −/− |
HGVS Human Genome Variation Society, ExIn exon-intron, ExAC the Exome Aggregation Consortium, 1000G 1000 Genomes
a this mutation has been reported in the Catalogue Of Somatic Mutations In Cancer (COSMIC)