Investigating the Role of EPA and DHA on Cellular Oxidative Stress; Profiling Antidiabetic and Antihypertensive Potential

Abstract

Background:

Polyunsaturated fatty acids (PUFAs) remain part of the diet and are essential for growth and development. Furthermore, omega − 3 fatty acids boost various cardiovascular disease risk factors as well as lower blood pressure and cholesterol levels. The effects of PUFAs on glycemia in type 2 diabetes patients are unclear. In the present study, the anti-diabetic and anti-hypertensive potential of eicosapentenoic acid (EPA) and docosahexaenoic acid (DHA)—two polyunsaturated fatty acids—were examined.

Material and Methods:

Using 3T3-L1 pre-adipocyte cells fed with PUFAs, the antioxidant capacity of EPA and DHA was assessed using the 2,2-diphenyl-1-picrylhydrazyl (DPPH) assay/test. The DPPH activity of EPA and DHA was 49.72 and 50.51%, respectively, indicating a reduction in oxidative stress. The number, size, and total lipid content of adipocytes in adipose tissue were used to study the anti-diabetic effect of EPA and DHA. Both PUFAs were revealed to have a much lower capacity for cell lysis of 3T3-L1 pre-adipocytes when compared to propylene glycol monomethyl ether acetate (PMA). In 3T3-L1 pre-adipocyte cells that had been treated with EPA and DHA, the gene expression profiles for ATP synthase 6 were examined.

Results:

The results demonstrated a similar trend of reducing total lipid content in 3T3-L1 pre-adipocyte cells treated with EPA and DHA. The amount of cell lysis was then examined for 3T3-L1 pre-adipocyte cells exposed to DHA and EPA, and the results showed 38.45% and 41.26%, respectively. In the 3T3-L1 pre-adipocyte cells, treatment with PUFAs, EPA, and DHA dramatically lowered total lipid content after 48 hours. The study also revealed that exposing 3T3-L1 pre-adipocyte cells to EPA at 90 g/ml for 48 hours reduced the total lipid content by a significant amount.

Conclusion:

According to the findings, EPA and DHA therapy reversed oxidative stress in mitochondria and upregulated the ATP synthase 6 gene. This discovery shows how EPA and DHA have anti-diabetic and hypertension properties.

INTRODUCTION

Oxidative stress is a result of metabolism, specifically catabolism, as well as biotransformation/detoxification activities, etc., inside the cellular milieu.[1] Oxygen- and nitrogen-containing reactive free radicals are produced as a result of these biological activities. Reactive oxygen species (ROS) and reactive nitrogen species (RNS) are two groups of chemically reactive molecules that contain oxygen. Reactive oxygen and nitrogen species (RONS) is the name given to both classes.[2,3] By destroying vital macromolecules like protein (enzymes), DNA, and RNA, these free radicals have a direct impact on pathophysiology. They also have an indirect impact on gene expression profiles by changing regulatory proteins and enzymes.[4] One of the main risk factors for many human diseases, such as diabetes (diabetes mellitus) and hypertension, is a high amount of ROS and RNS, which causes systemic inflammation.[5] The significance of oxidative stress in the development and progression of diabetes mellitus was revealed by Maritim et al. in 2003.[6] In the study, free radicals were discussed and how ROS was produced disproportionately in people with diabetes, influencing glucose oxidation, non-enzymatic protein glycation, and the oxidative breakdown of glycated proteins that followed. As a result, during mitochondrial stress (MS) and endoplasmic reticulum (ER) stress a breakdown of homeostasis not only in the metabolism of nutrients but also in energy further activates stress-mediated pathways.[6]

Free-radical damage to cellular organelles and enzymes, increased lipid peroxidation, and the emergence of insulin resistance might result from an elevated level of free radicals and the concurrent reduction of the antioxidant defense system.[2] These effects of oxidative stress may encourage the emergence of diabetes complications.[6] It has been reported that significant variations in vitamins, lipid peroxidation, nitrite concentration, non-enzymatic glycosylated proteins, hyperglycemia in diabetes changes oxidative stress biomarkers such as superoxide dismutase, catalase, glutathione reductase, glutathione peroxidase, and glutathione levels.[7] Although the association between oxidative stress and hypertension is not studied completely, oxidative stress raises a number of cardiovascular disease risk factors.[8] Griendling et al.[9] showed in a recent study that oxidative stress resulted in a higher quantity of ROS, specifically superoxide, hydrogen peroxide, and peroxynitrite, which altered many pathways. The posttranslational oxidative modifications are altered by oxidative stress, which also affects the activity of enzymes like nicotinamide adenine dinucleotide phosphate oxidases, uncoupled endothelial nitric oxide synthase, ER, and mitochondria.[10,11] These enzymes are essential for vascular biology, and a change in their activity caused by ROS-induced damage raises the risk of hypertension by activating inflammasome and causing ER stress.[12,13] De Champlain[14] showed that the clinical samples for hypertension had higher levels of ROS (superoxide, hydrogen peroxide).[14]

Both omega–3 and omega–6 polyunsaturated fatty acids (PUFAs) are essential for human health and disease pathophysiology, though they have different therapeutic advantages.[15] Studies have recently shown that PUFAs (n-3) like eicosapentenoic acid (EPA) and docosahexaenoic acid (DHA) are converted into metabolic enzymatic products that have therapeutic potential, including anti-inflammatory and anti-cancer properties effectiveness in improving cardiac function, depression, cognitive function, and blood. Due to the activities of the enzymes cyclooxygenase (COX) and lipoxygenase (LOX), EPA and DHA serve as a precursor to the bioactive lipid mediators resolvins, maresins, and protectins.[16] These specialized pro-resolving mediators (SPMs) are bioactive lipid molecules that efficiently treat inflammation by reversing inflammatory mediators at the site of inflammation. Different kinds of resolvins are produced by EPA and DHA; EPA produces E-series resolvins, whereas DHA produces D-series resolvins.[17] Systemic inflammation is linked to both diabetes mellitus and hypertension, and chronic systemic inflammation affects one or more genes. The previous findings demonstrated that taking supplements of omega-3 fatty acids, specifically EPA and DHA, efficiently reduced inflammation while also reducing ER stress and MS.[18]

By interfering with the operations of important cellular organelles including the endoplasmic reticulum and the mitochondria, oxidative stress is the defining feature of a number of human disorders. Oxidative stress impairs mitochondrial functioning, which prevents them from reestablishing energy equilibrium.[19] The synthesis of ATP, intracellular Ca²⁺ regulation, ROS formation and scavenging, apoptotic cell death regulation, and activation of the caspase family of proteases are all impacted by an increase in redox potential in the mitochondria as a result of oxidative stress. Consequently, oxidative stress and diminished mitochondrial activity serve as key risk factors for metabolic diseases.[20] The list of metabolic abnormalities includes hypertension, hyperglycemia, abdominal obesity, dyslipidemia, and metabolic syndrome (MetS), the latter of which is a combination of low HDL cholesterol and high triglyceride levels. The change of numerous genes involved in mitochondrial biogenesis and dynamics is also connected to oxidative stress and mitochondrial dysfunction.[21] A shift in the gene expression profile was evident in the regulation of oxidative stress. In addition to reducing oxidative stress over time, a number of antioxidants and ROS-scavenging compounds have also restored gene expression profiles for proteins including ATP synthase 6 and GTPase, including its isoforms.[22,23] The impact of omega–3 fatty acids, specifically EPA and DHA, in controlling oxidative stress in cells, restoring mitochondrial function, and regulating gene expression profile were examined in the study. The study also offers a rationale for the anti-inflammatory, anti-diabetic, and anti-hypertensive effects of EPA and DHA enzymatic products.

MATERIALS AND METHODS

Consumables and experiments

The molecular biology grades were used to purchase all the reagents and supplies. Sigma-Aldrich sold EPA and DHA that was 99.80% pure. American Type Culture Collection (ATCC) Mumbai was contacted to obtain 3T3-L1 pre-adipocyte cells, which were then cultured in the recommended conditions. Cells were grown to confluence in DMEM/F12 media (1:1) (Sigma-Aldrich) with 10% foetal bovine serum (FBS), 1% fungizone, and L-glutamine penicillin-streptomycin at 37°C with CO₂ 5% humidified (Sigma-Aldrich). Every 3–4 days, cells were passaged using 0.25% trypsin-EDTA (Invitrogen). Albumin was conjugated with fatty acids (FA), EPA, and DHA to make them soluble and mimic the in vivo environment. A 2:1 FA/BSA ratio of lipid-free bovine serum albumin (BSA) medium was used to seed the cells. The gene expression profile of ATP synthase 6 gene, which is predominantly linked to mitochondrial function, was quantified using real-time reverse transcription–polymerase chain reaction (RT-PCR) (energy production). The following primers were created using Sigma-Aldrich for real-time PCR.

F-ATP synthase 6 CAGTGATTATAGGCTTTCGCTCTAA

R-ATP synthase 6 CAGGGCTATTGGTTGAATGAGTA

Probe VIC-AGCCCACTTCTT ACCACAAGGCACA-T AMRA

Antioxidant activity

DPPH assay (free radical scavenging activity)

The total capacity of the PUFAs (EPA and DHA) to scavenge free radicals was calculated at the absorption maximum of 515 nm, which stabilizes the DPPH radical.[20] In the present study, 2.4 mg of DPPH was dissolved in 100 ml of methanol to prepare DPPH radical solution. To 3.995 ml of methanolic DPPH, a test solution (5:l EPA and DHA) was added. The mixture was vigorously mixed and left at room temperature in the dark for 30 minutes. At 515 nm, the reaction mixture's absorbance was spectrophotometrically quantified. Additionally, the absorption of the DPPH radical in the absence of antioxidant or “blank” was evaluated. Three copies of each determination were made. This equation was used to determine the ability to scavenge the DPPH radical.

where, A_y represents blank absorbance at t = 0, A_x represents antioxidant absorbance at t = 30 min. The ascorbic acid (as standard antioxidant) and percentage of scavenging activity (DPPH) were plotted for calculation for DHA and EPA antioxidant activity.

Adipocyte cell viability assay

By assessing cell survival and lipid buildup in the adipocyte cells, the anti-diabetic potential of EPA and DHA was examined. Adipocyte vitality was determined using the MTT assay, which uses 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium.[21] With growing media, the MTT stock solution (100 ml; 5 mg/ml in PBS) was used to prepare a working solution by diluting 10 times. A cell MTT assay was performed on 3T3-L1 pre-adipocyte cell lines to determine the adipocytes’ percentage viability. At a cell density of 2.0 x10⁴/well in 96-well plates, cells were treated for 48 hours at 37 °C with DHA and EPA at 50 mg/ml concentrations. As a common agent for lysing adipocytes, propylene glycol monomethyl ether acetate (PMA) was used in this study. After the incubation period, the solutions were taken out; 100 μl of DMSO was added to each well, and they were left in the incubator for an additional five minutes. 3T3-L1 pre-adipocyte cell lines that had been exposed to EPA and DHA were treated with MTS and PMA for three hours at 37°C, and absorbance was measured at 570 nm.

Determination of percentage lipid accumulation

The total lipid content of 3T3-L1 pre-adipocyte cells that had been cultured for 48 hours in the presence of PUFAs, EPA, and DHA was assessed using the Hepatic Lipid Accumulation/Steatosis Assay Kit in the current investigation. The current investigation used PUFAs with a 50 g/ml concentration of EPA and DHA. In the current investigation, chloroquine (25 M) was utilized as a positive control.[22] The following day, cells were exposed to either vehicles or various chloroquine dosages for three days. Cells were stained with Oil Red O in accordance with the product's instructions after this incubation. Oil Red O was extracted and the absorbance at 490 nm was measured to determine the amount of lipid buildup.

ATP synthase 6 expression profile

RNA extraction

Total RNA was prepared from grown 3T3-L1 pre-adipocyte cells, both treated and untreated with PUFAs, EPA, and DHA. Thermo Fisher Scientific, Inc.'s TRIzol reagent was used to extract 5 mg of total RNA from human 3T3-L1 pre-adipocytes in accordance with the manufacturer's instructions. A TURBO DNA-free kit from Invitrogen (Thermo Fisher Scientific, Inc.) was used to treat all RNA samples with DNase before reverse transcription to cDNA.[23] Before use, the cDNA samples were kept at 20°C.

RT-qPCR

Quantitative reverse transcription PCR (RT-qPCR) was used to assess the expression profile of mitochondrial DNA-coded ATP synthase 6. ATP synthase 6 standard dilutions were kept at 1:10 and 1:20 copies/l and utilized as calibration curves in RT-qPCR experiments. A Fast-Start DNA Master plus SYBR Green 1 kit was used to conduct RT-qPCR. SYBR Green 1 probe, cDNA (10 ng), forward and reverse primers (50 ng/μl each), and nuclease-free water were all included in the reaction mix, which had a final volume of 10 μl. Applied Biosystems 7900HT Fast Real-Time PCR System was used for all experiments, and the following thermocycling parameters were used: 95°C for 10 min, 95°C for 15 s, and 60°C for 60 s for a total of 40 cycles. The copy counts of the ATP synthase 6 encoded by mitochondrial DNA were converted to concentrations, and the data were expressed relative to that of β-actin.

RESULTS AND DISCUSSION

Antioxidant potential of EPA and DHA

Two significant occurrences are associated with mitochondrial dysfunction: the first is an excess of free radicals (ROS and RNS) and the second is an aberrant expression of genes (ATP synthase). PUFAs, EPA, and DHA play a function in controlling oxidative potential in this study. Using the DPPH assay, mitochondrial oxidative stress was assessed. Tert-butyl hydroperoxide was used to generate oxidative stress in 3T3-L1 pre-adipocyte cells. EPA and DHA were administered to the cells separately, and the total cytoplasm was then obtained by lysing the cells. The antioxidant potential of EPA and DHA is represented by a comparison of the data in Table 1. EPA reported a slightly higher antioxidant capacity (50.51% DPPH inhibition), as seen in Table 1 and Figure 1, while DHA reported a significant %DPPH inhibition of 49.72% and 50.51%, respectively. Tatsumi et al.[23] used immortalized mouse Schwann cells to demonstrate the antioxidant activity of EPA and DHA and came to the conclusion that Nrf2 and Ho-1 were the mechanisms through which EPA and DHA's antioxidant capability was mediated. In conjunction with astaxanthin, Saw et al.[24] also showed that PUFAs, EPA, and DHA had antioxidant action, with the Nrf2-ARE pathway still being involved.

Table 1.

Antioxidant potential of EPA and DHA. The antioxidant activity was determined using DPPH radical scavenging assay

Conc. µg/ml	Ascorbic Acid		DHA		EPA
	Absorbance	%DPPH Inhibition	Absorbance	%DPPH Inhibition	Absorbance	%DPPH Inhibition
Blank	0	0	0	0	0	0
5	0.902	3.632479	0.1853	5.77	0.1942	5.25
10	0.837	10.57692	0.1334	11.21	0.1287	10.75
15	0.729	22.11538	1.6509	15.87	1.4146	15.21
20	0.604	35.47009	0.6232	21.76	0.5956	20.60
25	0.483	48.39744	0.1563	27.44	0.1374	25.20
30	0.371	60.36325	1.7860	41.21	1.8352	40.65
40	0.209	77.67094	1.2311	49.72	1.1042	50.51
50	0.073	92.20085	1.5622	29.43	1.6185	30.26

Figure 1.

Antioxidant activity of EPA and DHA determined via %DPPH inhibition analysis. Ascorbic acid was used here as a positive control to evaluate antioxidant activity

Anti-diabetic potential of PUFAs, EPA, and DHA

An assay for measuring the viability of adipocyte cells was used to test the PUFA, EPA, and DHA's anti-diabetic potential. Adipocyte cell viability was assessed using the MTT assay with PMA, a common cell lysing agent. Table 2 shows a standard curve for PMA, indicating that it causes the largest amount of 3T3-L1 pre-adipocyte cell lysis at 120 g/ml, or 89.50%, and 10.50% viability [Figure 2]. The MTT assay was used to measure the amount of 3T3-L1 pre-adipocyte cell lysis brought on by PUFAs, EPA, and DHA. A comparison of the viability and cell lysis of 3T3-L1 pre-adipocytes is shown in Table 3. According to the data in the table, the highest reported DHA concentration for 3T3-L1 pre-adipocyte cell lysis was 90 g/ml (61.55%), while the highest reported EPA concentration was 58.74%. Both PUFAs were revealed to have much lower capacity for cell lysis of 3T3-L1 pre-adipocytes compared to PMA. The amount of cell lysis was then examined for 3T3-L1 pre-adipocyte cells treated with DHA and EPA, and the results showed 38.45% and 41.26%, respectively. The existence of adipocytes is linked in higher risk of obesity-related illnesses, such as diabetes. As a result, the study involved treating 3T3-L1 pre-adipocytes with EPA and DHA. Considerably lysing cells imply that the studied PUFAs have anti-diabetic potential. Through glycemic control, Telle-Hansen et al.[25] showed that PUFAs (omega 3) had antidiabetic potential. Adipocytes are fat reserves, and a lot of them increase glucose levels in the blood by quickly oxidizing stored fat or fatty acids. Additionally, the size of adipocytes as well as their quantity both increase the risk of obesity and disorders linked to it, such as diabetes.[26] Guadarrama-López et al.[27] showed that a lower PUFA level triggered systemic inflammation: another risk factor for diabetes.

Table 2.

Standard absorbance reaction using propylene glycol monomethyl ether acetate (PMA) for complete lysis of 3T3-L1 pre-adipocytescell lines

Conc. of PMA (µg/ml)	Absorbance at 570 nm	% Lysis	% Viability
15	0.252	17.65	82.35
30	0.274	31.74	68.64
60	0.332	46.54	54.46
90	0.354	72.24	27.76
120	0.397	89.50	10.50
Untreated	0.419	0	100
Blank	0	0	100

Figure 2.

Percentage survival of 3T3-L1 pre-adipocyte cell lines under treatment of PMA and DHA and EPA

Table 3.

Standard absorbance reaction using various concentrations of DHA and EPA for % survival and inhibition of 3T3-L1 pre-adipocyte cell lines

Conc. Of PUFAs (µg/ml)	DHA			EPA
	Absorbance at 570 nm	% Lysis	% Viability	Absorbance at 570 nm	% Lysis	% Viability
15	0.227	10.15	89.85	0.218	09.21	90.79
30	0.243	21.27	78.73	0.232	19.34	80.66
60	0.287	37.68	62.32	0.268	36.11	63.89
90	0.324	61.55	38.45	0.352	58.74	41.26
120	0.368	46.22	53.78	0.312	44.78	55.22
Untreated	0.398	0	100	0.371	0	100
Blank	0	0	100	0	0	100

Determination of percentage lipid accumulation

Diabetes and other obesity-related human disorders are also associated with lipid buildup in adipocyte cells. Increased lipid buildup in adipocytes increases the chance of developing diabetes as well as vascular problems, namely high blood pressure. The overall lipid profile of 3T3-L1 pre-adipocyte cells treated with PUFAs, EPA, and DHA is summarized in Table 4. The treatment of the 3T3-L1 pre-adipocyte cells with EPA and DHA dramatically lowers the total lipid content of the cells in 48 hours, which is an interesting finding. The results demonstrate a similar trend of reducing total lipid content in 3T3-L1 pre-adipocyte cells treated with EPA and DHA. The study also indicates that EPA at 90 g/ml for 48 hours significantly reduced the total lipid content of 3T3-L1 pre-adipocytes compared to DHA [Figure 3]. Guadarrama-López et al. showed that a higher PUFA, EPA, and DHA concentration lowered total lipid content in brown and white adipose tissues.[27] The exposure of omega–3 PUFAs was also demonstrated by the study. The number of adipocytes and their size were both markedly reduced by EPA and DHA [Table 4]. Similar to how EPA and DHA precisely govern and control the size and number of adipocyte cells, Lecchi et al.[28] and Liu et al.[29] reported large doses of omega–3 PUFAs. There is increasing evidence from studies and clinical data that taking supplements of EPA and DHA lowers blood pressure, with systolic blood pressure being affected more noticeably than diastolic blood pressure. Higher cholesterol levels are clearly a significant risk factor for vascular problems, including hypertension.[29] More specifically, rather than the total lipid profile, greater cholesterol levels increase the risk of raised blood pressure.[30] In the current investigation, EPA, DHA, and omega-3 PUFA supplementation both dramatically reduced the number of adipocytes, their size, and the total amount of lipid present, as well as showed anti-hypertensive effect. The risk of hypertension is further increased by mitochondrial malfunction brought on by oxidative stress, which is unable to regulate lipid metabolism/oxidation.

Table 4.

Total lipid content in the 3T3-L1 pre-adipocytes cells treated with EPA and DHA

Conc. of PUFAs (µg/ml)	DHA		EPA
	Absorbance at 490 nm	% Lipid Accumulations	Absorbance at 490 nm	% Lipid Accumulations
15	0.362	87.55	0.414	84.62
30	0.885	63.20	0.911	61.80
60	1.211	43.58	1.355	41.36
90	3.221	28.56	3.520	19.74
120	2.358	32.51	2.588	25.54

Figure 3.

A comparative analysis of DHA and EPA in regulating lipid accumulations. The results show that 3T3-L1 pre-adipocyte cells supplemented with DHA and EPA reduce the percentage of lipid accumulations, which minimizes the risk of diabetes and hypertension

ATP synthase 6 gene expression profile

The expression of various mitochondrial genes, including ATP synthase 6, is impacted or downregulated by oxidative stress, as shown in Figure 4. In this study, 3T3-L1 pre-adipocytes that had received supplements expressed more ATP synthase 6 than untreated cells. A crucial enzyme involved in the synthesis of energy in mitochondria and encoded by mitochondrial DNA is ATP synthase 6. The expression profile of ATP synthase 6 was found to be changed or aberrant in conditions such as cancer, diabetes, oxidative stress, autoimmune disorders, and inflammation. In 2000, Guan et al. found that cancer patients have ATP synthase 6 that was downregulated.[31]

Figure 4.

3T3-L1 pre-adipocytes that had received supplements expressed more ATP synthase 6 than untreated cells

According to Guan et al.,[32] ATP synthase 6 was downregulated to treat diabetes mellitus. By downregulating the ATP synthase 6 gene, Guo et al.[33] showed how oxidative stress triggers neuroinflammation. Inflammation continues to be a major risk factor for diabetes mellitus, which is a complex disease. Most of the genes encoded by mitochondrial DNA are changed and linked to a breakdown in energy balance under stress, more specifically mitochondrial stress. Lack of energy under these circumstances causes systemic inflammation. Stress from oxidative processes and a loss of energy balance prevent the body from using energy generated from other sources.^[34–36] According to reports, impaired protein, lipid, and carbohydrate metabolism significantly increase the risk of vascular problems, most notably high blood pressure.[37] Stress and impaired carbohydrate, lipid, and protein metabolism raise the levels of circulating lipids like cholesterol, which causes blood pressure to rise.[38,39] Oxidative stress is a major factor in the development of diabetes and hypertension, and taking supplements of PUFAs like EPA and DHA can help prevent these conditions. EPA and DHA both work well to lower stress levels.

CONCLUSION

In addition to producing energy, mitochondria are also important for lipid metabolism. Improper lipid metabolism and abnormal energy balance are associated with mitochondrial dysfunction. Numerous disorders, including metabolic syndromes and systemic inflammation, share the hallmark of oxidative stress. Numerous metabolic disorders, such as diabetes mellitus, hypertension, systemic inflammation, cancer, and cardiovascular diseases, are at high risk of development due to oxidative stress. Diabetes and, in a less direct way, hypertension are both tightly related to systemic inflammation. Multiple metabolic pathways linked to anabolic and catabolic bioactive chemicals are activated by an increase in plasma lipid levels. Adipocytes are important cells involved in metabolism as well as storing lipids. Adipogenesis depends critically on the ratio of viable to non-viable adipocytes, which puts vascular disorders like hypertension at risk. Lipid buildup in adipocytes increases the chance of the person developing human disorders like hypertension. While mitochondria are a crucial sub-cellular organelle for metabolism, lipids are largely processed by oxidation. Higher plasma concentrations cause mitochondrial oxidative stress, which leads to the production of ROS, which in turn causes systemic inflammation. As a result, a compromised mitochondrial function changes lipid metabolism (breaking lipid homeostasis), leading to systemic inflammation which is one of the major risk factors of diabetes, and fat buildup which is a risk factor of hypertension. In addition to regulating lipid homeostasis, PUFAs, particularly the essential omega–3 fatty acids EPA and DHA, can restore mitochondrial function. While antioxidant and anti-diabetic qualities still exist, they are linked to mitochondrial processes, and EPA and DHA have a number of physiological functions.

Abbreviations: PUFAs = Polyunsaturated fatty acid; RONS = Reactive oxygen and nitrogen species; ROS = Reactive oxygen species; RNS = Reactive nitrogen species; EPA = Eicosapentenoic acid; DHA = Docosahexaenoic acid; COX = Cyclooxygenase; LOX = Lipoxygenase; MS = Mitochondrial stress; ER = Endoplasmic stress; SPMs = Specialized pro-resolving mediators, MTT = 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide;DPPH = 2,2-diphenyl-1-picrylhydrazyl, PMA = Propylene glycol monomethyl ether acetate, Nrf2 = Nuclear factor erythroid 2–related factor 2; MetS = Metabolic syndrome

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.