Key Resources Table
| Reagents or Resource | Source | Identifier |
|---|---|---|
| Antibodies | ||
| A20 | Bethyl | A302–633A |
| Actin | CST | 4967S |
| ATG16L1 | CST | 8089 |
| COXII | abcam | ab110258 |
| FIP200 (for immunoblot) | CST | 12436 |
| FIP200 (for immunostaining) | Proteintech | 17250–1-AP |
| GABARAP | Sigma-Aldrich | MABN2303 |
| GAPDH | Sigma-Aldrich | G9545 |
| GFP | nvitrogen | A11122 |
| HA | CST | 3724s |
| HA | biolegend | 901513 |
| HA | Covance | MMS-101P |
| LC3B (for immunoblot) | CST | 2775s |
| LC3B (for immunostaining) | MBL | PM036 |
| MFN2 | House made | N/A |
| NDP52 | CST | 60732S |
| OPTN | proteintech | 10837-I-AP |
| SQSTM1 | abnova | H00008878-M01 |
| TAX1BP1 (for immunoblot) | CST | 5105S |
| TAX1BP1 (for immunostaining) | Sigma-Aldrich | HPA024432 |
| TNIP1 (for immunoblot) | Bethyl | A304–508 |
| TNIP1 (for immunostaining) | proteintech | 15104–1-AP |
| TOM20 | Santa Cruz | SC-11415 |
| TOM20 | Santa Cruz | SC-17764 |
| Ubiquitin FK2 | Biomol International |
PW8810–0500 |
| WIPI2 | abcam | ab105459 |
| Alexa Fluor 488 goat anti-rabbit IgG | Thermofisher | A11008 |
| Alexa Fluor 594 goat anti-rabbit IgG | Thermofisher | A11012 |
| Alexa Fluor 405 goat anti-mouse IgG | Thermofisher | A31553 |
| Alexa Fluor 488 goat anti-mouse IgG | Thermofisher | A21202 |
| Alexa Fluor 594 goat anti-rat IgG | Thermofisher | A11007 |
| Amersham | ECL Rabbit IgG, | HRP-linked |
| Amersham | ECL Mouse IgG, | HRP-linked |
| Chemicals, peptides and recombinant proteins | ||
| A/C heterodimerizer (Rapalog) | Takaro Bio | 635056 |
| antimycin A | Sigma-Aldrich | A8674 |
| Bafilomycin | Cayman Chemical Company |
11038 |
| DAPI | Thermofisher | 62248 |
| Oligomycin | CalBiochem | 495455 |
| Cycloheximide | Cayman Chemical Company |
14126 |
| Puromycin | Invivogen | ant-pr-1 |
| GSK8612 | MedChemExpress | HY-111941 |
| Polybrene | Sigma-Aldrich | H9268 |
| Q-VD | ApexBio | A1901 |
| FBS | R&D Systems | S11550H |
| DMEM | Thermofisher | 31053028 |
| Sodium pyruvate | Thermofisher | 11360070 |
| GlutaMax | Thermofisher | 35050061 |
| Opti-MEM | Thermofisher | 31985062 |
| 0.05% Trypsin-EDTA | Thermofisher | 25300054 |
| BamBanker | Wako | 302–14681 |
| DTT | Sigma-Aldich | D0632 |
| HBSS with calcium and magnesium | Thermofisher | 14025–092 |
| paraformaldehyde 16% solution, | Electron Microscopy Sciences |
15710 |
| polyethylenimine, (PEI 25K) | PolySciences | 23966–1 |
| XtremeGENE9 | Sigma-Aldich | 6365787001 |
| PhosSTOP | Roche | 4906845001 |
| Protease inhibitor cocktail | Roche | 11873580001 |
| Triton X-100 | Sigma-Aldrich | T9284 |
| Tween-20 | Sigma-Aldrich | P7949 |
| 3xHA peptide | Thermofisher | 26184 |
| MS grade trypsin | Promega | V5280 |
| Pierce™ MMTS | Thermofisher | 23011 |
| 1M TEAB | Thermofisher | 90114 |
| RIPA buffer | Thermofisher | 89900 |
| 4X LDS sample buffer | Thermofisher | NP0007 |
| Goat serum | VWR Scientific Products | 76230–088 |
| DAPI Fluoromount-G | SouthernBiotech | 0100–20 |
| Commercial assays | ||
| Amersham ECL Prime WB detection reagent |
GE Healthcare Life Sciences | RPN2232 |
| BCA protein assay | Thermofisher | 23228 |
| SuperSignal West Femto | Thermofisher | 1859022 |
| NEBuilderHiFi DNA assembly master mix | New England BioLabs | M5520A |
| Q5 Hot Start High-Fidelity DNA Polymerase | New England BioLabs | M0493L |
| DNA Ligation kit, Mighty Mix | Takara | 6023 |
| Gateway BP clonase | Thermofisher | 117890–20 |
| Gateway LR clonase | Thermofisher | 11–791-020 |
| GFP-TRAP magnetic beads | Chromotek | gtd-100 |
| Pierce™ Anti-HA Magnetic Beads | Thermofisher | 88837 |
| Pierce™ Glutathione Agarose | Thermofisher | 16102BID |
| S-Trap column | ProtiFi | co2-micro-10 |
| Mycoplasma Detection Kit | Invivogen | rep-mys-100 |
| Pre-treated 1.5mm coverslips | neuVitro | GG-18–1.5-pre |
| 96 well plate glass bottom | DOT Scientific Inc | MGB096–1-2-LG-L |
| Invitrogen Novex NuPAGE 4 12% Bis Tris Protein Gels |
Thermofisher | NP0321BOX |
| Experimental models: Cell lines | ||
| HeLa | ATCC | CCL-2.2 |
| 293T | ATCC | CRL-3216 |
| HeLa FIP200 KO | Vargas et al, 2019 | N/A |
| HeLa WIPI2 KO | Fischer et al, 2020 | N/A |
| HeLa A20 KO | this study | N/A |
| HeLa TNIP1 KO | this study | N/A |
| HeLa autophagy receptor 5KO | Lazarou et al, 2015 | N/A |
| HeLa TAX1BP1 KO | This study | N/A |
| HeLa ATG8 6KO | Nguyen et al, 2016 | N/A |
| Oligonucleotide | ||
| TNIP1 sgRNA GACCCCCTGGCTGAGCTCAC |
This Study | N/A |
| TAX1BP1 sgRNA AAUUGUGUACUAGCAUUCCA |
This Study | N/A |
| A20 sgRNA GGCTGAACAAGTCCTTCCTC |
This Study | N/A |
| Recombinant DNA | ||
| TNIP1 | Harvard medical school | HsCD00377161 |
| pENTR223-TNIP1 | this study | N/A |
| pENTR223-TNIP2 | this study | N/A |
| pENTR223-TNIP3 | this study | N/A |
| pENTR223-TNIP1 LIR1mut | this study | N/A |
| pENTR223-TNIP1 LIR2mut | this study | N/A |
| pENTR223-TNIP1 LIR1+LIR2mut | this study | N/A |
| pDONR223_TNFAIP3_WT | Addgene | 82238 |
| pHAGE-FLAG-HA TNIP1 WT | this study | N/A |
| pHAGE-FLAG-HA TNIP1 LIR1 mutant |
this study | N/A |
| pHAGE-FLAG-HA TNIP1 LIR2 mutant |
this study | N/A |
| pHAGE-FLAG-HA TNIP1 LIR1+LIR2 mutant | this study | N/A |
| pHAGE-FLAG-HA TNIP1 ΔAHD1 |
this study | N/A |
| pHAGE-FLAG-HA TNIP1 ΔAHD3 |
this study | N/A |
| pHAGE-FLAG-HA TNIP1 ΔAHD4 |
this study | N/A |
| pHAGE-FLAG-HA TNIP1 ΔCterminal |
this study | N/A |
| pHAGE-FLAG-HA TNIP1 ΔNterminal |
this study | N/A |
| pHAGE-FLAG-HA TNIP1 AAA | this study | N/A |
| pHAGE-FLAG-HA TNIP1 EDD | this study | N/A |
| pHAGE-FLAG-HA TNIP1 S122A | this study | N/A |
| pHAGE-FLAG-HA TNIP1 S122E | this study | N/A |
| pHAGE-FLAG-HA TNIP1 S123A | this study | N/A |
| pHAGE-FLAG-HA TNIP1 S123E | this study | N/A |
| pHAGE-FLAG-HA TNIP3 WT | this study | N/A |
| pHAGE-FLAG-HA TAX1BP1 WT | Sarraf et al, 2020 | N/A |
| pHAGE-FLAG-HA TAX1BP1 CC | Sarraf et al, 2020 | N/A |
| pHAGE-FLAG-HA TAX1BP1 ΔSKITCH |
Sarraf et al, 2020 | N/A |
| pHAGE-FLAG-HA TAX1BP1 ΔZF |
Sarraf et al, 2020 | N/A |
| pHAGE-FLAG-HA SQSTM1 | this study | N/A |
| pHAGE-FLAG-HA FIP200 ΔCterminal |
Vargas et al, 2019 | N/A |
| pHAGE-FLAG-HA FIP200 ΔNterminal |
Vargas et al, 2019 | N/A |
| pHAGE-FLAG-HA FIP200 LZ | Vargas et al, 2019 | N/A |
| pHAGE-FLAG-HA FIP200 CLAW | Vargas et al, 2019 | N/A |
| pHAGE-GFP TNIP1 WT | this study | N/A |
| pHAGE-GFP TNIP1 AAA | this study | N/A |
| pHAGE-BFP TNIP1 WT | this study | N/A |
| pHAGE-FKBP-GFP-TNIP1 WT | this study | N/A |
| pHAGE-FKBP-GFP-TNIP1 D472N | this study | N/A |
| pHAGE-FKBP-GFP-TNIP1 LIR1 mutant | this study | N/A |
| pHAGE-FKBP-GFP-TNIP1 LIR2 mutant | this study | N/A |
| pHAGE-FKBP-GFP-TNIP1 LIR1+LIR2 mutant | this study | N/A |
| pHAGE-FKBP-GFP-TNIP2 | this study | N/A |
| pHAGE-FKBP-GFP-TNIP3 | this study | N/A |
| pHAGE-FKBP-GFP-TNIP1 ΔAHD1 |
this study | N/A |
| pHAGE-FKBP-GFP-TNIP1 ΔAHD3 |
N/A | |
| pHAGE-FKBP-GFP-TNIP1 ΔAHD4 |
this study | N/A |
| pHAGE-FKBP-GFP-TNIP1 ΔAHD3+LIR2 mutant |
this study | N/A |
| pHAGE-FKBP-GFP-TNIP1 ΔCterminal |
this study | N/A |
| pHAGE-FKBP-GFP-TNIP1 ΔNterminal |
this study | N/A |
| pHAGE-FKBP-GFP-ATG16L1 | Vargas et al, 2019 | N/A |
| pHAGE-FKBP-GFP-WIPI2 | this study | N/A |
| pHAGE-FKBP-GFP-A20 | this study | N/A |
| pSpCas9-P2A-Puro | Ran et al, 2013 | N/A |
| pHAGE-mtKeima-P2A-HA-Parkin | this study | N/A |
| pHAGE-YFP-LC3B-RFP-LC3BΔG | this study | N/A |
| Software and algorithm | ||
| Fiji | Schindelin et al., 2012 | https://imagej.net/software/fiji/ |
| Prism | https://www.graphpad.com/scientificsoftware/prism/ | |
| FlowJo | Becton, Dickinson and Company; 2023 |
https://www.flowjo.com |
| SnapGene | N/A | www.snapgene.com |
| Image Lab | Biorad | https://www.bio-rad.com/enus/product/image-labsoftware?ID=KRE6P5E8Z |
| BioRender | N/A | https://app.biorender.com/user/signin |
| MATLAB 2022a | N/A | N/A |