. 2023 Mar 22;32:229–246. doi: 10.1016/j.omtn.2023.03.012

Table 1.

Guide strand sequences targeting the HBB mRNA

ID	Origin	Guide strand sequence (5′-3′)	Type
miR1^a	Samakoglu et al.³³	CTCCTCAGGAGTCAGATGC	shRNA
miR1m^a	Samakoglu et al.³³	TCAGGAGTCAGGTGCGCGC	shRNA
miR2^a	Dykxhoorn et al.²⁸	AACTTCTCCTCAGGAGTCA	siRNA
miR3	portals.broadinstitute.org	TCAGTGTGGCAAAGGTGCCCT	shRNA
miR3m	portals.broadinstitute.org	TGTGGCAAAGGTGCCCTGCGC	shRNA
miR4	portals.broadinstitute.org	ATAACAGCATCAGGAGTGGAC	shRNA
miR4m	portals.broadinstitute.org	CAGCATCAGGAGTGGACGCGC	shRNA
miR5	portals.broadinstitute.org	TTCATCCACGTTCACCTTGCC	shRNA
miR5m	portals.broadinstitute.org	TCCACGTTCACCTTGCCGCGC	shRNA
miR6	portals.broadinstitute.org	CAAAGAACCTCTGGGTCCAAG	shRNA
miR6m	portals.broadinstitute.org	GAACCTCTGGGTCCAAGGCGC	shRNA
miR7	portals.broadinstitute.org	CTTTCTTGCCATGAGCCTTCA	shRNA
miR7m	portals.broadinstitute.org	CTTGCCATGAGCCTTCAGCGC	shRNA
miR8	designed using the tool developed by Adams et al.²⁷	TGAAGTTCTCAGGATCCACGT	miR
miR9	designed using the tool developed by Adams et al.²⁷	TTCTTTGCCAAAGTGATGGGC	miR
miR10	Thermo Fisher Scientific	AAAGGCACCGAGCACTTTCTT	siRNA
miR11	Dykxhoorn et al.²⁸	CCAGGGCCTCACCACCAAC	siRNA

GCGC, motif added in miRm to improve the knockdown efficiency of the miRNA; CC, motif added to improve the knockdown efficiency of the miRNA; bold, matching sequence between the original miRNA (miRxx) and the modified version (miRxxm).

The miRs are designed to target only the WT β-globin mRNA. To target the β^S-globin mRNA, the nucleotides indicated in italics need to be modified to match to the SCD mutation.