| sgRNA | Forward Primer | Reverse Primer |
|---|---|---|
| mink1 CR1 | gcaaccaaactgcactcctg | cccagagaacagctttttggg |
| mink1 CR2 | gcaaccaaactgcactcctg | cccagagaacagctttttggg |
| mink1 CR3 | agctgaaatacgaagcccgt | tgatggtgtctgcactccaa |
| hmga2 CR1 | ccatcccacagtgaggcatt | gaggagcagctcagcctatc |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.