Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers
| Primer | Sequence (5′-3′) | Annealing temperature (℃) | GC (%) | Fragment (bp) |
|---|---|---|---|---|
| GAPDH (upstream:) | GGAAGCTTGTCATCAATGGAAATC | 62.4 | 57.1 | 168 |
| GAPDH (downstream:) | TGATGACCCTTTTGGCTCCC | 62 | 55 | |
| MTF1 (upstream:) | GGCAAAGCCTTCCTTACCTCT | 60 | 52.38 | 201 |
| MTF1 (downstream:) | ACTGAGTGTGGTGAAGTATTTGCTG | 61.49 | 44 |
GAPDH glyceraldehyde-3-phosphate dehydrogenase, GC gastric cancer, MTF1 metal regulatory transcription factor 1
