Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Chemicals, peptides, and recombinant proteins | ||
| Nocodazole | AbMole | Cat# M3194 |
| Rapamycin | Sigma | Cat# 553210 |
| β-Estradiol | Sigma | Cat# E8875 |
| rCutSmart Buffer | New England BioLabs | Cat# B6004S |
| RsaI | New England BioLabs | Cat# R0167S |
| AluI | New England BioLabs | Cat# R0137S |
| StyI-HF | New England BioLabs | Cat# R3500S |
| MseI | New England BioLabs | Cat# R0525S |
| Certified Low Melt Agarose | Bio-Rad | Cat# 1613111 |
| S1 Nuclease | Promega | Cat# M5761 |
| dNTP Mix | Promega | Cat# U1515 |
| T4 DNA Polymerase | New England BioLabs | Cat# M0203L |
| dATP Solution | New England BioLabs | Cat# N0440S |
| Klenow Fragment (3’-5’ exo−) | New England BioLabs | Cat# M0212S |
| T4 DNA Ligase | New England BioLabs | Cat# M0202L |
| β-Agarase I | New England BioLabs | Cat# M0392S |
| UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v) | Invitrogen | Cat# 15593-031 |
| 6x Gel loading dye without SDS | New England BioLabs | Cat# B7025S |
| SYBR Gold Nucleic Acid Gel Stain | Invitrogen | Cat# S11494 |
| Formaldehyde | Fisher | Cat# F79-1 |
| Zymolyase 100T | US Biological | Cat# Z1004 |
| Nonidet P-40 substitute | Sigma | Cat# 11754599001 |
| Spermidine | Sigma | Cat# 85558 |
| MNase | Sigma | Cat# N5386 |
| RNAse A | Lucigen | Cat# MRNA092 |
| Ficoll-400 | Sigma | Cat# F4375 |
| Amaranth | Sigma | Cat# A1016 |
| Quick CIP | New England BioLabs | Cat# M0525S |
| p-Nitrophenylphosphate | Sigma | Cat# 4876 |
| p-Nitrophenol | Sigma | Cat# 241326 |
| Acid-Phenol:Chloroform, pH 4.5 (with IAA, 125:24:1) | Invitrogen | Cat# AM9720 |
| Turbo DNase | Invitrogen | Cat# AM2238 |
| RNA Loading Dye | New England BioLabs | Cat# B0363S |
| Terminal Deoxynucleotidyl Transferase | New England BioLabs | Cat# M0315S |
| [α-32P]dCTP | PerkinElmer | Cat# BLU013H500UC |
| T4 polynucleotide kinase | New England BioLabs | Cat# M0201S |
| [γ-32P]ATP | PerkinElmer | Cat# BLU502A500UC |
| Pyruvate Kinase from rabbit muscle | Sigma | Cat# P1506-5KU |
| Proteinase K, recombinant, PCR Grade | Sigma | Cat# 000000003115828001 |
| Critical commercial assays | ||
| MasterPure Yeast DNA Purification Kit | Biosearch Technologies | Cat# MPY80200 |
| SsoAdvanced Universal SYBR Green Supermix | Bio-Rad | Cat# 1725274 |
| NEBNext end repair module | New England BioLabs | Cat# E6050S |
| KAPA HiFi PCR Kit | Roche | Cat# 07958838001 |
| Qubit 1X dsDNA High Sensitivity Assay Kit | Invitrogen | Cat# Q33231 |
| High Sensitivity DNA Kit | Agilent | Cat# 5067-4626 |
| NextSeq 500/550 Mid Output Kit v2.5 (150 Cycles) | Illumina | Cat# 20024904 |
| NextSeq PhiX Control Kit | Illumina | Cat# FC-110-3002 |
| SuperScript IV First-Strand Synthesis System | Invitrogen | Cat# 18091050 |
| Deposited data | ||
| S1-seq and MNase-seq data | This paper | SRA: PRJNA821913 |
| Analysis code | This paper | https://doi.org/10.5281/zenodo.7508119 |
| Original gel image files | This paper | https://doi.org/10.5281/zenodo.7508157 |
| Experimental models: Cell lines | ||
| ExpiSf9™ Cells | Life Technologies | Cat# A35243 |
| Experimental models: Organisms/strains | ||
| Saccharomyces cerevisiae W303: LSY4376-3C: MATa fpr1::natMX RPL13A-2xFKBP12::TRP1 tor1-1::HIS3 RAD5 hml::pRS-1 hmr::pRS-2 hocs::SrfIcs leu2::PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX rad51::URA3MX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4376-4A: MATa fpr1::natMX RPL13A-2xFKBP12::TRP1 tor1-1::HIS3 RAD5 hml::pRS-1 hmr::pRS-2 hocs::SrfIcs leu2::PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX sgs1::hphMX rad51::URA3MX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4377-12B: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1::natMX RPL13A-2xFKBP12::TRP1 tor1-1::HIS3 sgs1-frb-hphMX dna2-frb-hphMX hocs::SrfIcs leu2::PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX rad51::URA3MX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4377-15A: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1::natMX RPL13A-2xFKBP12::TRP1 tor1-1::HIS3 sgs1-frb-hphMX dna2-frb-hphMX hocs::SrfIcs leu2::PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX mre11-H125N rad51::URA3MX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4518-13B: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX hocs::SrfIcs leu2::PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX rad51::URA3MX met15Δ | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4602-20C: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX hocs::SrfIcs leu2::PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX rad51::URA3MX met15Δ ku70::altNatMX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4741-8C: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX exo1::kanMX rad51::URA3MX met15Δ leu2::PlexO_4-HO-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4753-3B: MATa RAD5 hml::pRS-1 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX exo1::kanMX rad51::URA3MX met15Δ leu2::PlexO_4-HO-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX hmr::PGAL1-Citrine-TCYC1-YCRWdelta13::hisG-HOcs@chr3:295659 | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4754-3A: MATa RAD5 hml::pRS-1 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX exo1::kanMX rad51::URA3MX met15Δ leu2::PlexO_4-HO-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX hmr::hmr-e::hisG-PGAL1-Citrine-TCYC1-YCRWdelta13::hisG-hmr-i::hisG-HOcs@chr3:295659 | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4810-41D: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX leu2::PlexO_4-HO-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX his3::Citrine-HOcs-HA-TCYC1-HIS3MX met15Δ::PTDH3-mKate2-TCYC2-HOcs-MET15 exo1::kanMX rad51::URA3MX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4811-11B: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX leu2::PlexO_4-HO-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX his3::PTDH3-Citrine-hisG-HOcs-HA-TCYC1-HIS3MX met15Δ::PACT1-mKate2-TCYC2-HOcs-MET15 exo1::kanMX rad51::URA3MX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4812-5A: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX leu2::PlexO_4-HO-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX his3::PACT1-Citrine-hisG-HOcs-HA-TCYC1-HIS3MX met15Δ::mKate2-TCYC2-HOcs-MET15 exo1::kanMX rad51::URA3MX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4815-25B: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX met15Δ leu2::PlexO_4-HO-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX his3::PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1-HIS3MX exo1::kanMX rad51::URA3MX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4822-3C: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX hocs::SrfIcs leu2::PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX rad51::URA3MX met15Δ sth1-frb-natMX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4994-45D: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX hocs::SrfIcs leu2::PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX rad51::URA3MX met15Δ sth1-frb-natMX snf2-frb-HIS3MX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY4994-89A: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX hocs::SrfIcs leu2::PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX rad51::URA3MX met15Δ snf2-frb-HIS3MX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY5023-98C: MATa hocs::SrfIcs RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX met15Δ pho4::pho4-SA1234PA6 PPHO5-SrfIcs leu2::PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX rad51::URA3MX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY5038-9C: MATa hocs::SrfIcs RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX met15Δ pho4::altNatMX PPHO5-SrfIcs leu2::PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX rad51::URA3MX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY5495-6B: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX met15Δ leu2::PlexO_4-HO-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX chd1::natMX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY5495-30D: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX met15Δ leu2::PlexO_4-HO-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY5496-2C: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX met15Δ leu2::PlexO_4-HO-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX rsc2::natMX | This paper | N/A |
| Saccharomyces cerevisiae W303: LSY5501-8D: MATa RAD5 hml::pRS-1 hmr::pRS-2 fpr1Δ RPL13A-2xFKBP12::TRP1 tor1-1 sgs1-frb-hphMX dna2-frb-hphMX met15Δ leu2::PlexO_4-HO-TCYC1-PACT1-LexA-ER-B112-TCYC1-LEU2MX exo1::kanMX snf5::kanMX | This paper | N/A |
| Oligonucleotides | ||
| Oligos for in vitro assays | Eurogentec | See Table S1 |
| Primers for qPCR | Sigma | See Table S2 |
| Adapters and primers for deep-sequencing library preparation | Integrated DNA Technologies; Sigma | See Table S3 |
| Recombinant DNA | ||
| Plasmid: pCAS | Ryan et al., 2014 | Addgene Plasmid # 60847 |
| Plasmid: pRG621: pFA6a-FRB-TCYC2-hphMX | This paper | N/A |
| Plasmid: pRG638: pCAS with ZraI-XbaI for oligo-based sgRNA cloning | This paper | N/A |
| Plasmid: pRG646: pRG205MX-PlexO_4-HO-TCYC1-PACT1-LexA-ER-B112-TCYC1 | Gnügge and Symington, 2020 | Addgene Plasmid # 154815 |
| Plasmid: pRG660: pRG205MX-PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1 | Gnügge and Symington, 2020 | N/A |
| Plasmid: pRG662: pCAS with sgRNA targeting bla | This paper | N/A |
| Plasmid: pRG663: pCAS with sgRNA targeting chrIII:296712 | This paper | N/A |
| Plasmid: pRG685: PGAL1-Citrine-TCYC1 | This paper | N/A |
| Plasmid: pRG695: pCAS with sgRNA targeting nat | This paper | N/A |
| Plasmid: pRG696: pCAS with sgRNA targeting MET15 (chrXII:733,324) | This paper | N/A |
| Plasmid: pRG704: pFA6a-S. kudriavzevii PTEF1-natMX-C. glabrata TTEF1 | This paper | N/A |
| Plasmid: pRG712: pRG203MX- PlexO_4-SrfI-TCYC1-PACT1-LexA-ER-B112-TCYC1 | Gnügge and Symington, 2020 | N/A |
| Plasmid: pRG721: pRG203MX-Citrine-HOcs-HA-TCYC1 | This paper | N/A |
| Plasmid: pRG722: pRG201-PACT1-mKate2-TCYC2-HOcs | This paper | N/A |
| Plasmid: pRG723: pRG201-PTDH3-mKate2-TCYC2-HOcs | This paper | N/A |
| Plasmid: pRG726: pBluescript-hmr::PGAL1-Citrine-TCYC1-Ty1δ::hisG-HOcs@chr3:295,659 repair template | This paper | N/A |
| Plasmid: pRG727: pBluescript-hmr::(hmr-e::hisG-PGAL1-Citrine-TCYC1-hmr-i::hisG-Ty1δ::hisG-HOcs@chr3:295,659) repair template | This paper | N/A |
| Plasmid: pRG738: pRG201-mKate2-TCYC2-HOcs | This paper | N/A |
| Plasmid: pRG745: pRG203MX-PACT1-Citrine-hisG-HOcs-HA-TCYC1 | This paper | N/A |
| Plasmid: pRG746: pRG203MX-PTDH3-Citrine-hisG-HOcs-HA-TCYC1 | This paper | N/A |
| Plasmid: pRG747: pBluescript-pho4-SA1234PA6 | This paper | N/A |
| Plasmid: pRG759: pCAS with sgRNA targeting PPHO5 (chrII:431,486) | This paper | N/A |
| Plasmid: pRG778: pRG201-PTDH3-OsTIR1 | This paper | N/A |
| Plasmid: pTP391: expressing His-tagged yeast Mre11 | Bhaskara et al., 2007 | N/A |
| Plasmid: pFB-Xrs2-3xFLAG: expressing 3XFLAG-tagged yeast Xrs2 | This paper | N/A |
| Plasmid: pFB-Rad50: expressing untagged yeast Rad50 | Cannavo et al., 2013 | N/A |
| Plasmid: pFB-MBP-Sae2-His: expressing MBP and His-tagged yeast Sae2 | Cannavo et al., 2014 | N/A |
| Plasmid: pFB-MBP-YKU70-his: expressing MBP and His-tagged yeast Ku70 | Reginato et al., 2017 | N/A |
| Plasmid: pFB-YKU80-FLAG: expressing FLAG-tagged yeast Ku80 | Reginato et al., 2017 | N/A |
| Plasmid: pAttP-S: vector for plasmid-length substrate | Cannavo et al., 2014 | N/A |
| Software and algorithms | ||
| bcl2fastq 2.20.0.422 | Illumina | https://support.illumina.com/sequencing/sequencing_software/bcl2fastq-conversion-software/downloads.html |
| fastp 0.20.1 | Chen et al., 2018 | https://github.com/OpenGene/fastp |
| SAMtools 1.9 | Li et al., 2009 | http://www.htslib.org/download/ |
| Bowtie 2.3.5.1 | Langmead and Salzberg, 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| UMI-tools 1.0.0 | Smith et al., 2017 | https://github.com/CGATOxford/UMI-tools |
| R 4.2.1 | R Core Team, 2022 | https://www.r-project.org/ |
| GenomicRanges 1.48.0 | Lawrence et al., 2013 | https://bioconductor.org/packages/release/bioc/html/GenomicRanges.html |
| GenomicAlignments 1.32.0 | Lawrence et al., 2013 | https://bioconductor.org/packages/release/bioc/html/GenomicAlignments.html |
| BSgenome 1.64.0 | Pagès, 2022 | https://bioconductor.org/packages/release/bioc/html/BSgenome.html |
| Biostrings 2.64.0 | Pagès et al., 2022 | https://bioconductor.org/packages/release/bioc/html/Biostrings.html |
| Rmelting 1.12.0 | Aravind and Krishna, 2022 | https://www.bioconductor.org/packages/release/bioc/html/rmelting.html |
| Gviz 1.40.1 | Hahne and Ivanek, 2016 | https://bioconductor.org/packages/release/bioc/html/Gviz.html |
| ImageJ 1.53c | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
| Other | ||
| microTUBEs | Covaris | Cat# 520045 |
| SpeedBeads magnetic carboxylate modified particles | GE Healthcare | Cat# 65152105050250 |
| Dynabeads M-280 Streptavidin | Invitrogen | Cat# 11205D |
| Zirconia/Silica Beads 0.5 mm | BioSpec | Cat# 11079105z |
| Micro Bio-Spin P-30 Gel Columns | Biorad | Cat# 7326223 |
| Ni-NTA Agarose Resin | Qiagen | Cat# 30210 |
| ANTI-FLAG® M2 Affinity Gel | Sigma | Cat# A2220 |
| Amylose Resin | New England BioLabs | Cat# E8021L |
| Whatman® cellulose chromatography papers, 3MM Chr | Sigma | Cat# WHA3030917 |
| RNA-seq data for G2-arrested Saccharomyces cerevisiae W303 | Maya-Miles et al., 2019 | GEO: GSE125258 |
| S1-seq data for meiotic Saccharomyces cerevisiae SK1 | Mimitou et al., 2017 | SRA: PRJNA337955 |
| resection-seq data for asynchronous Saccharomyces cerevisiae BY4741 | Bazzano et al., 2021 | SRA: PRJNA703820 |
| LIFE SCIENCE TABLE WITH EXAMPLES FOR AUTHOR REFERENCE | ||
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
| Antibodies | ||
| Rabbit monoclonal anti-Snail | Cell Signaling Technology | Cat#3879S; RRID: AB_2255011 |
| Mouse monoclonal anti-Tubulin (clone DM1A) | Sigma-Aldrich | Cat#T9026; RRID: AB_477593 |
| Rabbit polyclonal anti-BMAL1 | This paper | N/A |
| Bacterial and virus strains | ||
| pAAV-hSyn-DIO-hM3D(Gq)-mCherry | Krashes et al., 2011 | Addgene AAV5; 44361-AAV5 |
| AAV5-EF1a-DIO-hChR2(H134R)-EYFP | Hope Center Viral Vectors Core | N/A |
| Cowpox virus Brighton Red | BEI Resources | NR-88 |
| Zika-SMGC-1, GENBANK: KX266255 | Isolated from patient (Wang et al., 2016) | N/A |
| Staphylococcus aureus | ATCC | ATCC 29213 |
| Streptococcus pyogenes: M1 serotype strain: strain SF370; M1 GAS | ATCC | ATCC 700294 |
| Biological samples | ||
| Healthy adult BA9 brain tissue | University of Maryland Brain & Tissue Bank; http://medschool.umaryland.edu/btbank/ | Cat#UMB1455 |
| Human hippocampal brain blocks | New York Brain Bank | http://nybb.hs.columbia.edu/ |
| Patient-derived xenografts (PDX) | Children’s Oncology Group Cell Culture and Xenograft Repository | http://cogcell.org/ |
| Chemicals, peptides, and recombinant proteins | ||
| MK-2206 AKT inhibitor | Selleck Chemicals | S1078; CAS: 1032350-13-2 |
| SB-505124 | Sigma-Aldrich | S4696; CAS: 694433-59-5 (free base) |
| Picrotoxin | Sigma-Aldrich | P1675; CAS: 124-87-8 |
| Human TGF-β | R&D | 240-B; GenPept: P01137 |
| Activated S6K1 | Millipore | Cat#14-486 |
| GST-BMAL1 | Novus | Cat#H00000406-P01 |
| Critical commercial assays | ||
| EasyTag EXPRESS 35S Protein Labeling Kit | PerkinElmer | NEG772014MC |
| CaspaseGlo 3/7 | Promega | G8090 |
| TruSeq ChIP Sample Prep Kit | Illumina | IP-202-1012 |
| Deposited data | ||
| Raw and analyzed data | This paper | GEO: GSE63473 |
| B-RAF RBD (apo) structure | This paper | PDB: 5J17 |
| Human reference genome NCBI build 37, GRCh37 | Genome Reference Consortium | http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/human/ |
| Nanog STILT inference | This paper; Mendeley Data | http://dx.doi.org/10.17632/wx6s4mj7s8.2 |
| Affinity-based mass spectrometry performed with 57 genes | This paper; Mendeley Data | Table S8; http://dx.doi.org/10.17632/5hvpvspw82.1 |
| Experimental models: Cell lines | ||
| Hamster: CHO cells | ATCC | CRL-11268 |
| D. melanogaster: Cell line S2: S2-DRSC | Laboratory of Norbert Perrimon | FlyBase: FBtc0000181 |
| Human: Passage 40 H9 ES cells | MSKCC stem cell core facility | N/A |
| Human: HUES 8 hESC line (NIH approval number NIHhESC-09-0021) | HSCI iPS Core | hES Cell Line: HUES-8 |
| Experimental models: Organisms/strains | ||
| C. elegans: Strain BC4011: srl-1(s2500) II; dpy-18(e364) III; unc-46(e177)rol-3(s1040) V. | Caenorhabditis Genetics Center | WB Strain: BC4011; WormBase: WBVar00241916 |
| D. melanogaster: RNAi of Sxl: y[1] sc[*] v[1]; P{TRiP.HMS00609}attP2 | Bloomington Drosophila Stock Center | BDSC:34393; FlyBase: FBtp0064874 |
| S. cerevisiae: Strain background: W303 | ATCC | ATTC: 208353 |
| Mouse: R6/2: B6CBA-Tg(HDexon1)62Gpb/3J | The Jackson Laboratory | JAX: 006494 |
| Mouse: OXTRfl/fl: B6.129(SJL)-Oxtrtml.1Wsy/J | The Jackson Laboratory | RRID: IMSR_JAX:008471 |
| Zebrafish: Tg(Shha:GFP)t10: t10Tg | Neumann and Nuesslein-Volhard, 2000 | ZFIN: ZDB-GENO-060207-1 |
| Arabidopsis: 35S::PIF4-YFP, BZR1-CFP | Wang et al., 2012 | N/A |
| Arabidopsis: JYB1021.2: pS24(AT5G58010)::cS24:GFP(-G):NOS #1 | NASC | NASC ID: N70450 |
| Oligonucleotides | ||
| siRNA targeting sequence: PIP5K I alpha #1: ACACAGUACUCAGUUGAUA | This paper | N/A |
| Primers for XX, see Table SX | This paper | N/A |
| Primer: GFP/YFP/CFP Forward: GCACGACTTCTTCAAGTCCGCCATGCC | This paper | N/A |
| Morpholino: MO-pax2a GGTCTGCTTTGCAGTGAATATCCAT | Gene Tools | ZFIN: ZDB- MRPHLNO-061106-5 |
| ACTB (hs01060665_g1) | Life Technologies | Cat#4331182 |
| RNA sequence: hnRNPAl_ligand: UAGGGACUUAGGGUUCUCUCUAGGGACUUAG GGUUCUCUCUAGGGA | This paper | N/A |
| Recombinant DNA | ||
| pLVX-Tight-Puro (TetOn) | Clonetech | Cat#632162 |
| Plasmid: GFP-Nito | This paper | N/A |
| cDNA GH111110 | Drosophila Genomics Resource Center | DGRC:5666; FlyBase:FBcl013041 5 |
| AAV2/1-hsyn-GCaMP6- WPRE | Chen et al., 2013 | N/A |
| Mouse raptor: pLKO mouse shRNA 1 raptor | Thoreen et al., 2009 | Addgene Plasmid #21339 |
| Software and algorithms | ||
| ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
| Bowtie2 | Langmead and Salzberg, 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| Samtools | Li et al., 2009 | http://samtools.sourceforge.net/ |
| Weighted Maximal Information Component Analysis v0.9 | Rau et al., 2013 | https://github.com/ChristophRau/wMICA |
| ICS algorithm | This paper; Mendeley Data | http://dx.doi.org/10.17632/5hvpvspw82.1 |
| Other | ||
| Sequence data, analyses, and resources related to the ultra-deep sequencing of the AML31 tumor, relapse, and matched normal | This paper | http://aml31.genome.wustl.edu |
| Resource website for the AML31 publication | This paper | https://github.com/chrisamiller/aml31SuppSite |
| PHYSICAL SCIENCE TABLE WITH EXAMPLES FOR AUTHOR REFERENCE | ||
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
| Chemicals, peptides, and recombinant proteins | ||
| QD605 streptavidin conjugated quantum dot | Thermo Fisher Scientific | Cat#Q10101MP |
| Platinum black | Sigma-Aldrich | Cat#205915 |
| Sodium formate BioUltra, ≥99.0% (NT) | Sigma-Aldrich | Cat#71359 |
| Chloramphenicol | Sigma-Aldrich | Cat#C0378 |
| Carbon dioxide (13C, 99%) (<2% 18O) | Cambridge Isotope Laboratories | CLM-185-5 |
| Poly(vinylidene fluoride-co-hexafluoropropylene) | Sigma-Aldrich | 427179 |
| PTFE Hydrophilic Membrane Filters, 0.22 μm, 90 mm | Scientificfilters.com/TischScientific | SF13842 |
| Critical commercial assays | ||
| Folic Acid (FA) ELISA kit | Alpha Diagnostic International | Cat# 0365-0B9 |
| TMT10plex Isobaric Label Reagent Set | Thermo Fisher | A37725 |
| Surface Plasmon Resonance CM5 kit | GE Healthcare | Cat#29104988 |
| NanoBRET Target Engagement K-5 kit | Promega | Cat#N2500 |
| Deposited data | ||
| B-RAF RBD (apo) structure | This paper | PDB: 5J17 |
| Structure of compound 5 | This paper; Cambridge Crystallographic Data Center | CCDC: 2016466 |
| Code for constraints-based modeling and analysis of autotrophic E. coli | This paper | https://gitlab.com/elad.noor/sloppy/tree/master/rubisco |
| Software and algorithms | ||
| Gaussian09 | Frish et al., 2013 | https://gaussian.com |
| Python version 2.7 | Python Software Foundation | https://www.python.org |
| ChemDraw Professional 18.0 | PerkinElmer | https://www.perkinelmer.com/category/chemdraw |
| Weighted Maximal Information Component Analysis v0.9 | Rau et al., 2013 | https://github.com/ChristophRau/wMICA |
| Other | ||
| DASGIP MX4/4 Gas Mixing Module for 4 Vessels with a Mass Flow Controller | Eppendorf | Cat#76DGMX44 |
| Agilent 1200 series HPLC | Agilent Technologies | https://www.agilent.com/en/products/liquid-chromatography |
| PHI Quantera II XPS | ULVAC-PHI, Inc. | https://www.ulvac-phi.com/en/products/xps/phi-quantera-ii/ |