Skip to main content
. 2023 Feb 26;2(2):100089. doi: 10.1016/j.cellin.2023.100089

Table 1.

Oligos used in this study.The oligo location is referring to the exon number in the RefSeq NM_003017.5 for human SRSF3 and NM_013663.5 for mouse Srsf3. RACE, rapid amplification of cDNA ends; NB, Northern blot.

Name Sequence (5′-3′) Genome Chromosome position Strand Location Assay
oVM238 TTTTTCACCATTCGACAGTT hg38 chr6:36598897-36598878 exon 3 5′ RACE/NB
oJR56 TCTCTTGAAACAGTGACACAAAGGTG hg38 chr6:36602126-36602151 + exon 7 3′ RACE
oMA28 TTCTGAGTGGTCCATAATAGC mm10 chr17:29036354–29036334 exon 2 5′ RACE/NB
oLLY531 GGCACGTGATATCAAGAATTGTTACT mm10 chr17:29041610–29041635 + exon 7 3′ RACE
oMA229 CGAGATCCTGGGTTCAAAAG mm10 chr17:29032786–29032767 exon 1 NB
oLLY537 TTCCACTCTTACACGGCAGC mm10 chr17:29038520–29038501 exon 3 NB