Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Oligonucleotides used for real-time PCR analysis.
| Gene Name | Accession Number | Sequences (5′-3′) | pb |
|---|---|---|---|
| PTPRC (CD45) | NM_080921.3 | F: atgaccatgtatttgtggctta R: tgggggaaggtgttgggc |
97 |
| Endoglin (CD105) | NM_001278138.1 | F: gccagcattgtctcacttca R: atgcgcaacaagctctttct |
180 |
| RunX2 | NM_001278478.2 | F: gacaaccgcaccatggtgg R: tctggtacctctccgaggg |
160 |
| OCN | NM_199173.6 | F: gctacctgtatcaatggct R: cgatgtggtcagccaactc |
111 |
| GAPDH | AJ005371.1 | F: atggccttccgtgtccccac R: acgcctgcttcaccaccttc |
245 |
