Generating Zebrafish RNA-Less Mutant Alleles by Deleting Gene Promoters with CRISPR/Cas9

Abstract

Danio rerio (zebrafish), traditionally used in forward genetic screens, has in the last decade become a popular model for reverse genetic studies with the introduction of TALENS, zinc finger nucleases, and CRISPR/Cas9. Unexpectedly, homozygous frameshift mutations generated by these tools frequently result in phenotypes that are less penetrant than those seen in embryos injected with antisense morpholino oligonucleotides targeting the same gene. One explanation for the difference is that some frameshift mutations result in nonsense-mediated decay of the gene transcript, a process which can induce expression of homologous genes. This form of genetic compensation, called transcriptional adaptation, does not occur when the mutant allele results in no RNA transcripts being produced from the targeted gene. Such RNA-less mutants can be generated by deleting a gene’s promoter using a pair of guide RNAs and Cas9 protein. Here, we present a protocol and use it to generate alleles of arhgap29b and slc41a1 that lack detectable zygotic transcription. In the case of the arhgap29b mutant, an emerging phenotype did not segregate with the promoter deletion mutation, highlighting the potential for off-target mutagenesis with these tools. In summary, this chapter describes a method to generate zebrafish mutants that avoid a form of genetic compensation that occurs in many frameshift mutants.

1. Introduction

Clustered regularly interspaced short palindromic repeats (CRISPR) guide RNAs combined with CRISPR-associated 9 (Cas9) protein is a robust tool for genetic engineering in cell lines and animal model systems, and its application in gene therapy is already underway for several diseases [1–3]. The CRISPR/Cas9 system can introduce site-specific double-strand breaks, which are then repaired through nonhomologous end joining (NHEJ), homologous recombination, or by a potentially distinct mechanism called homology-directed repair. As in other model systems, in zebrafish NHEJ is robust, but leads to small insertions or deletions (indels) in DNA sequence. CRISPR/Cas9-mediated mutagenesis in zebrafish was first applied to generate indels in exons, leading to frameshifts and premature stop codons [4–8]. Additionally, pairs of guide RNAs (gRNAs), which are used to direct the Cas9 endonuclease to specific locations in the genome, were used to generate larger deletions, 7–50 kilobases long, that were targeted albeit with imprecise edges [9, 10]. Later homologous recombination and homology-directed repair, which are distinguished functionally by the length of the homology arms in the template used to invoke them, were deployed to generate more accurate editing of genomic DNA [11–13]. Two improvements in the use of CRISPR/Cas9-mediated gene editing in zebrafish were, first, the discovery that delivery of Cas9 in protein form, rather than as mRNA, facilitated more rapid double-strand breaks [14, 15]. Second, it was found that chemically modifying the gene-targeting CRISPR RNA (crRNA) to protect it from cellular RNases increased the efficiency of generating double-strand breaks [16, 17].

The emergence of gene-targeting technologies led to multiple laboratories making the same puzzling observation; the phenotype of a targeted mutant was often less severe than that in embryos injected with antisense morpholino oligonucleotides (MO) targeting the identical gene [18]. In some instances, this phenomenon probably reflects the MO disrupting expression of an unintended gene (i.e., off-target effect) [19]. In other instances, it reflects increased expression of genes homologous to the targeted one that occurs in frameshift mutants, but not in the corresponding “morphants” [20]. The elevated expression of the homologs depends on the incomplete gene transcripts that result from nonsense-mediated decay; the underlying mechanism, which remains poorly understood, is called transcriptional adaptation [20]. A means to avoid transcriptional adaptation, and consequently to reveal the function of the targeted genes, is to generate loss-of-function alleles that yield no transcript, i.e., RNA-less alleles [20]. This chapter describes the use of CRISPR/Cas9 to make RNA-less alleles in zebrafish. We targeted the arhgap29b and slc41a1 genes. The former is of interest to our group because of the association of its ortholog to orofacial cleft [21–23], and the other because it encodes a magnesium transporter that may be important in differentiation of dopaminergic neurons [24]. We used pairs of gRNAs to generate promoter-less mutations of each gene (separately) and showed that levels of the corresponding mRNA in homozygous mutants are, in one case (slc41a1), undetectable, and in the other (arhgap29b), are very low and we presume reflect residual maternal deposits. Interestingly, a phenotype emerged in the progeny of fish heterozygous for the arhgap29b promoter-deletion that did not segregate with this mutation. This suggests the CRISPR/Cas9 reagents yielded an off-target mutation in addition to the intended one. Collectively, promoter-deletion is an approach in using CRISPR/Cas9 gene editing to generate null alleles in zebrafish, which overcomes the challenge of transcriptional adaptation that results from earlier methods of employing this technology. Nonetheless the potential for off-target effects of CRISPR/Cas9 technology remains a challenge to the field.

2. Materials

1. Alt-R^® CRISPR-Cas9 tracrRNA.

2. Gene-specific crRNA; IDT (sequences are provided in Table 1).

3. IDTE (1× TE Solution pH 7.5); IDT.

4. Duplex buffer; catalog # 1072570; IDT.

5. SP Cas9 protein.

6. DNA lysis buffer: 10 mM Tris–HCl, pH 8, 1 mM EDTA—pH 8, 0.01% SDS, 100 mM NaCl, and 0.1 mg/ml Proteinase K (see Note 1). Store at −20° C.

7. PCR screening primers (sequences are provided in Table 2 and see Note 2).

8. PCR reagents (PCR buffer, dNTPs, Taq polymerase).

9. 1% Tricaine: Dissolve 0.5 g of tricaine in 50 ml of fish water (see Note 3). Store at room temperature (RT).

10. PBST: 1× PBS with 0.1% Tween-20.

11. Trizol reagent.

12. Turbo DNA-free kit.

13. High-capacity cDNA reverse transcription kit.

14. Gene-specific RT-PCR primers (sequences are provided in Table 3 and see Note 2).

15. iTaq Universal SYBR Green Supermix.

Table 1.

crRNA sequences and their scores

Gene	Guide	Sequence	PAM	On-target score	Off-target score
arhgap29b	Left guide	ATTTCAAGCTTTCAAGTACT	GGG	84	75
	Right guide	TAACGTGACTGTTTCAATCG	TGG	71	91
slc41a1	Left guide	TTCTTGGACTACTACGAGAA	AGG	59	93
	Right guide	GAGAAGGACGTTTCCTTAAG	TGG	65	92

Table 2.

Primers used for screening

Primers used for screening		Sequences	Amplicon length
arhgap29b	Forward primer	GCAATATAATGTCCTTCGGCTAA	WT-420 bp, Het-420 bp and 368 bp, Mut-368 bp
	Reverse primer	GGTTACGTGACTGCCTTTGTC
	Internal forward primer	GCTAGCAGCGCTAAAGTTCAT
slc41a1	Forward primer	CAGCTTTCGGAAGCACTTAGG	WT-498 bp, Het-498 bp and 198 bp, Mut-198 bp
	Reverse primer	CCAGCAGGAAAGGGATCAAAAC
	Internal reverse primer	GGCTGTCAACTCCGATCAGT

Table 3.

Primers used for qPCR

Primers for qPCR	Forward qPCR primer sequence	Reverse qPCR primer sequence
arhgap29b	CATGTACTGCTCCAAACGGC	CTCCGGGCCTTCTCGTATTC
slc41a1	AGCCAGTCGTATCTCCACCT	TTCACACCAGACCCAAAGAA
beta actin	CGAGCAGGAGATGGGAACC	CAACGGAAACGCTCATTGC

3. Methods

3.1. Establish the Promoter(s) Sequence of the Gene of Interest

1. Identify the promoter of the gene of interest by using the corresponding trimethylation at histone H3, lysine 4 (H3K4me3), and/or Assay for Transposase-Accessible Chromatin sequencing (ATAC-seq) data and load them on the UCSC genome browser (see Notes 4, 5, 6, and 7) (Figs. 1a and 2a).

2. Having identified the promoter region, look for the guide RNAs (gRNAs) positioned within 1 kb sequences on either side of the H3K4me3 and/or ATAC-seq peak (see Note 8).

Fig. 1.

RNA-less allele of arhgap29b in zebrafish embryos. (a) H3K4me3 data from whole embryos, and ATAC seq data, from isolated periderm, around the presumed transcription start site of arhgap29b (inferred from the Refseq gene model). There is broad H3K4me3 signal over the transcription start site; by contrast, the ATAC seq signal is much narrower. These marks were used to determine where to target the guide RNAs (gRNAs). gRNAs and primer sequences used for screening are marked with a block and arrow, respectively. The blue region highlights the deleted fragment after CRISPR/Cas9 targeting. (b) Agarose gel electrophoresis of zebrafish embryos from F2 generated by crossing F1 fish in which the arhgap29b promoter was targeted. Gel shows a wild-type (420 bp) and mutant-specific (368 bp) bands. The mutant band was sequenced, and a BLAT search on the UCSC browser showed clear deletion of the promoter region due to arhgap29b-specific gRNAs, highlighted in blue in panel a. (c) Bar graph of relative levels of arhgap29b mRNA in a pool of WT and a pool of mutant embryos from F2, generated by CRISPR/Cas9 targeting as described in a and analyzed by qPCR. Expression levels of arhgap29b are normalized to expression of beta-actin. Bars represent the mean and standard deviation of three independent experiments. P value determined by student’s t-test

Fig. 2.

RNA-less allele of slc41a1 in zebrafish embryos. (a) H3K4me3 data from whole embryos at the presumed transcription start site of slc41a1 (inferred from the refseq gene model). Guide RNAs (gRNAs) and primers sequences used for screening are marked with a block and arrow, respectively. The blue region highlights the deleted fragment after CRISPR/Cas9 targeting. (b) Agarose gel electrophoresis of zebrafish embryos from F2 generated by crossing F1 fish in which the slc41a1 promoter was targeted. Gel shows a wild-type (498 bp) and mutant-specific (198 bp) bands. The mutant band was sequenced, and a BLAT search on the UCSC browser showed clear deletion of the promoter region due to slc41a1-specific gRNAs, highlighted in blue in panel a. (c) Bar graph of relative levels of slc41a1 mRNA in a pool of wild-type and a pool of mutant embryos, generated by CRISPR/Cas9 targeting as described in a and analysed by qRT-PCR. Expression levels of slc41a1 are normalized to expression of beta-actin. Bars represent the mean and standard deviation of three independent experiments. P value determined by student’s t-test

Once these sequences are identified, they can be uploaded to a gRNA design webtool of your choice (see next section).

3.2. Design gRNAs (See Note 9)

1. For the sequence upstream of the promoter, which we will refer to as the “left crRNA,” download 1 kb of target sequence from the region to the left of the promoter locus (i.e., defined by the region of open chromatin or island of H3K4me3 signal) to be deleted. (We use “left” and “right” here, rather than upstream and downstream, because the promoter may be pointed in either direction.) This sequence should be in FASTA format and can be obtained from the UCSC genome browser.

2. Design gRNAs with an appropriate gRNA design webtool. We used the “Custom Alt-R^® CRISPR-Cas9 guide RNA” design tool available on the IDT website and selected “Danio rerio” as the species from the dropdown menu. (https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM).

3. Enter the sequence or upload it as a text file. We entered the left-hand target sequence in FASTA format.

4. Select a desired crRNA sequence among the several suggested by the algorithm. We selected a crRNA sequence with high on-target and high off-target scores. In the IDT gRNA design tool platform, the higher off-target scores have a lower risk of targeting nonspecific sequences (see Note 10). Ideally this will be located outside of the H3K4me3 signal but in the two cases presented here the crRNAs were not completely outside of the H3K4me3 signal at all developmental stages assessed.

5. Repeat this process using 1 kb of target sequence to the right of the promoter to identify the sequence for the “right crRNA.”

6. Use a PCR primer design tool (e.g., Primer3) to design PCR primers that flank the desired sequence to be removed. We place the primer at least 50 bp from the gRNAs to assure the primer site is not deleted during nonhomologous end joining.

3.3. Prepare sgRNAs and RNP Complexes for Injection into Embryos

1. Gene-specific crRNAs and tracrRNA from IDT are available in different quantities. We ordered two nanomoles of each crRNA and five nanomoles of the generic tracrRNA. Starting with these amounts, we resuspended crRNAs and tracrRNAs in 20 μl and 50 μl of IDTE buffer, respectively (1× TE buffer, pH 7.5), which yielded a final concentration of 100 μM in both cases. These were stored at −80° C (see Note 11).

2. Generate separate solutions for the left and right crRNAs, each consisting of tracrRNA and the specific crRNA at a final concentration of 10 μM each. Pipette 2.5 μl of 100 μm tracrRNA and 2.5 μl of 100 μM crRNA into 20 μl of IDT duplex buffer.Vortex gently and briefly centrifuge the solutions.

3. Generate a single gRNA (sgRNA) for each crRNA by annealing the tracrRNA and crRNA; heat the solution from step 2 at 95 °C for 5 min and gradually allow it to cool to RT on the benchtop. This can be stored at −20 °C for 6 months and −80 °C for 1 year (see Note 12).

4. SpCas9 protein was supplied at 61 μM concentration. Pipette 1 μl of this stock into 3 μl of Cas9 dilution buffer for a final concentration of 15 μM. Make several 1 μl aliquots of 15 μM Cas9 and store at −80 °C.

3.4. Inject Embryos with gRNA

1. The night before the injection, set up zebrafish crosses by placing 2–3 wild-type males and 2–3 wild-type females in a tank separated by a divider (see Note 13).

2. On the morning of the injection, pull out the divider and wait for the eggs. It may take 30–40 min before eggs are laid. Pipette 1 μl of the “left” sgRNA, 1 μl of the “right” sgRNA, 1 μl of 15 μM Cas9 protein, 1 μl of phenol red into a micro-centrifuge tube, and 1 μl of nuclease-free water to final volume of 5 μl, and store on ice (see Note 14). Pipette to mix. This yields a final concentration of 2 μM for each sgRNA and 3 μM for Cas9 protein.

3. Incubate at RT for 5–10 min to allow ribonucleoprotein complexes to form.

4. Inject 5 nl of RNP complex to each embryo at the 1–4 cell stage. Inject at least 100 embryos; leave at least 10–20 embryos uninjected as controls.

5. Incubate injected and uninjected embryos in fish water at 28 °C incubator (see Note 15).

3.5. Genotype F0 Embryos

1. 24 h after injection, randomly select 10 injected embryos and 4–5 uninjected embryos, dechorionate them, and place them individually in PCR tubes (we use strips of 8 tubes). Continue to incubate remaining embryos; if mutagenesis was successful, these animals can be used for breeding.

2. Perform a crude preparation of genomic DNA by adding 20 μl of DNA lysis buffer to each embryo in a PCR tube. Place the tubes in a thermal cycler and incubate at 55 °C for 50 min followed by 95 °C for 10 min. Store the DNA at 4 °C.

3. Genotype embryos by PCR with 1 μl of genomic DNA using PCR primers that flank the intended deletion (Table 2). Run the program on a thermal cycler with the following steps: 1 cycle: 95 °C for 5 min; 35 cycles: 95 °C for 20 s, 55 °C for 30 s, 72 °C for 30 s; 1 cycle: 72 °C for 5 min. Run the PCR product on a 2.5% agarose gel and look for the mutant-specific band size. Excise the mutant-specific band at the predicted size and confirm by sequencing (see Notes 16 and 17) (Figs. 1a, b and 2a, b).

4. Check the efficiency of the CRISPR/Cas9-mediated deletion with a three-primer PCR (see Notes 16 and 17) (Table 2, Figs. 1a, b, and 2a, b).

3.6. Generate and Raise F1 Fish

1. After confirming the intended promoter deletion is present in F0 embryos, raise the remaining F0 animals to breeding age. The efficiency of mutagenesis in the embryos can be used to predict how many F0 adults will be needed to achieve germline transmission of the mutation (see Note 18).

2. If desired, one can confirm the mutation is present in somatic tissue of F0 fish by clipping a fin at 1 month or older, harvesting genomic DNA from the fin, and performing PCR on the DNA with genotyping primers (see Note 19). For fin clipping, anesthetize the fish in a petri dish using anesthetizing solution (0.01% tricaine in fish water, see Note 20). Once, anesthetized (may take 20–60 s), use a spoon to place fish on parafilm and excise the caudal fin lobe. Lyse with the same protocol mentioned in Subheading 3.5, step 2. Once clipped, place the fish back into its tank with fish water (see Note 20).

3. To identify F0 fish that transmit mutations, cross individual mutant F0 fish to wild-type fish and screen pools of F1 embryos for the promoter mutation. Make 5 pools of 5 randomly selected F1 embryos at 24 hours post fertilization (hpf) each, make a crude genomic DNA preparation from each pool, and screen the DNA by PCR for the deletion. Confirm the presence of the mutation by sequencing the PCR band. If the mutation is detected, raise the remaining F1 embryos to adulthood.

4. At 1–2 months of age, genotype the F1 animals by fin clip and PCR and continue to raise those harbouring the mutation.

3.7. Generate F2 Embryos and Assess if Those with Abnormal Phenotypes Harbour the Targeted Promoter Mutation

1. Cross F1 carriers then observe and record phenotypes in F2 embryos, looking for a consistent phenotype in approximately one-fourth of the clutch (Fig. 3) (see Note 21).

2. Score the genotype of individual F2 embryos in each phenotypic class (see Notes 22 and 23) (Fig. 3).

Fig. 3.

Phenotypes of arhgap29b mutant embryos. Mutant embryos from the in-cross of F1 carriers of the arhgap29b allele in which the promoter has been deleted show different phenotypes. In contrast to (a, c, e) sibling embryos with a normal phenotype, (b, d, f) those with a phenotypically abnormal phenotype show (b) severe edema near the heart, (d) a bubble below the eye, and (f) poor blood circulation. Scale bar in a is 200 μm which corresponds to panels b–d; scale bar in e is 500 μm, which corresponds to panel f. (g) Homozygous mutant genotypes were recorded from both groups (embryos with normal phenotype and abnormal phenotype) suggesting the abnormal phenotype is an off-target effect

3.8. Determine mRNA Levels of the Targeted Gene

1. Cross 2 fish from the F1 (or later) generation that are heterozygous carriers of the intended mutation. Raise F2 embryos to 3 days postfertilization (or another stage, depending when the expression level of the targeted gene is known to be high). Cut the embryos in half and place head and tail portions into individual PCR tubes with proper labeling. For DNA isolation, add 20 μl of DNA lysis solution to the tubes containing tails and for RNA isolation, add 30–50 μl of Trizol reagent to the tubes containing heads (or the reverse, depending where the transcript is expressed at highest levels). Store tubes containing heads at −80 °C.

2. Perform a genotyping screen using the DNA preparation from tail samples with the appropriate primers for each sample, as described in Subheading 3.5, steps 2 and 3.

3. Based on the results of the genotyping screen, pool a minimum of 20–30 heads with the homozygous mutant genotype into a single 1.5 ml tube for RNA isolation. Homogenize the heads and bring the final volume up to 1 ml with Trizol reagent. Process the same number of wild-type embryos as a control.

4. Perform RNA isolation according to the manufacturer’s standard protocol.

   1. Briefly, incubate the homogenized embryo heads at RT for 5 min. Add 200 μl of chloroform/per 1 ml of Trizol reagent and vortex vigorously for 15–20 s. Allow samples to stand at RT for 10–15 min.
   2. Centrifuge the resulting mixture at 13,500 × g for 15 min at 4 °C. Centrifugation separates the mixture into three phases: a red organic phase (containing protein), an interphase (containing DNA), and a colorless upper aqueous phase (containing RNA).
   3. Carefully transfer the aqueous phase to a new tube and add an equal volume of isopropanol (500 μl); mix the tubes by inverting them up and down. Allow samples to stand at RT for 10 min, then centrifuge at 13,500 × g for 10 min at 4 °C (see Note 24).
   4. Discard the supernatant carefully and wash the RNA pellet by adding 1 ml of 75% ethanol followed by centrifugation at 13,500 × g for 5 min at 4 °C.
   5. Remove the supernatant, air-dry the pellet, and dissolve in 20 μl of nuclease-free water. Measure the quantity of RNA on a spectrophotometer (e.g., Nanodrop 2000, Thermo-Fisher) and store at −80 °C, or proceed immediately to the next step.

5. Perform DNase treatment of RNA samples from step 4e. Add 1 μl of DNase1 for a maximum of 10 μg RNA, 3 μl of Turbo DNase buffer, and bring the final volume to 30 μl with nuclease-free water. Incubate the tubes at 37 °C for 30 min. Add 3 μl of inactivation reagent provided in the kit, mix well by pipetting, and incubate at RT for 5 min (see Note 25). Flick the tubes occasionally for intermittent mixing. Centrifuge the tubes at 13,500 × g for 90 s at RT. Transfer 20–25 μl of supernatant to a fresh 1.5 ml tube (see Note 26). Measure the quantity of DNase-treated RNA. Store at −80 °C.

6. Carry out first-strand cDNA synthesis from RNA samples using a high-capacity cDNA reverse transcription kit as per the manufacturer’s protocol. Use 1 μg of RNA for cDNA synthesis in a total reaction volume of 20 μl. Store the cDNA samples at −20 °C.

7. Perform qPCR using SybrGreen qPCR master mix. For a single reaction, use 5 μl of 2× SybrGreen, 0.2 μl of gene-specific forward and reverse primers (2 μM each, Table 3), and 1 μl of cDNA in a total reaction volume of 10 μl. Each reaction should be performed in triplicate. Prepare the master mix accordingly.

8. Simultaneously set up the reaction for housekeeping genes (e.g., actb1). Run the final reaction in a real-time PCR machine as per the manufacturer’s protocol.

9. Analyze the data using a suitable quantitation algorithm for real-time PCR (see Note 27). Calculate mean values with their standard deviations with respect to replicate experiments, and analyze for statistical significance of differences using a t-test (see Note 28).