REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
HRP-conjugated goat anti-human IgA+IgG+IgM (H+L) antibody	Jackson	Code#109-035-064; RRID: AB_2337583
Rabbit monoclonal anti-H. pylori antibody (clone EP279)	Cell Marque	Cat#AC-0247; RRID: AB_2936230
Rabbit polyclonal anti-H. suis antibody	This paper	N/A
HRP-conjugated goat anti-rabbit antibody	Agilent Technologies	Code#P0448; RRID: AB_2617138
Bacterial and virus strains
H. suis SNTW101c	Rimbara et al.9	N/A
H. pylori TN2GF4	Matsui et al.39	N/A
H. suis 13 strains isolated from gastric biopsy specimens of subjects	This paper	See Table S1
H. pylori 17 strains isolated from gastric biopsy specimens of subjects	This paper	See Table S1
Biological samples
Gastric biopsy specimens from subjects	This paper	N/A
Serum specimens from subjects	This paper	N/A
Chemicals, peptides, and recombinant proteins
H. pylori eradication triple-combination drug VONOSAP Pack 400 (vonoprazan 40 mg, amoxicillin 1500 mg, and clarithromycin 400 mg)	Takeda Pharmaceutical	YJ Code# 6199104X1023
H. pylori eradication triple-combination drug VONOSAP Pack 800 (vonoprazan 40 mg, amoxicillin 1500 mg, and clarithromycin 800 mg)	Takeda Pharmaceutical	YJ Code# 6199104X2020
Critical commercial assays
DNeasy Blood & Tissue Kits	Qiagen	Cat#69504/69556
Nextera XT DNA Library Prep Kit	Illumina	Illumina advantage product Cat#TG-131-1096
ELISA enzyme substrate KPL SureBlue TMB Microwell Peroxidase Substrate (1-Component)	Sera Care Life Sciences	Material#5120-0075
Nunc-Immuno 96-well microtiter plate	Thermo Fisher Scientific	Cat#439454
NHPH agar plate	This paper	N/A
Brucella broth	BD	BD BBLTM -211088
Skirrow	Oxoid	Cat#OXSR0069E
Vitox	Oxoid	Cat#R663090
Dent	Oxoid	Cat#OXSR0147E
Helicobacter-selective agar plate	Nissui Pharmaceutical	Cat#51035
Histofine antigen-retrieval solution	Nichirei Biosciences	Code#414251F/414252F
Master mix	IDT	Code#1055770
Deposited data
Whole-genome sequences of H. suis 13 strains (GenBank/ENA/DDBJ accession number)	This paper	See Table S1
The 23S-rRNA gene sequences of H. pylori 16 strains (GenBank/ENA/DDBJ accession number)	This paper	See Table S1
The 23S-rRNA gene sequences of Helicobacter 21 type strains (GenBank/ENA/DDBJ accession number)	This paper	See Table S2
Sequence typing (ST) assignment	This paper	PubMLST https://pubmlst.org/organisms/helicobacter-suis
Oligonucleotides
H. suis hsvA targeting probe-based real-time PCR primer sequence: NHP194003_11930_forward: 5′-CTGGTAATGCATCA TTAGAAGCAAA-3′	Rimbara et al.9	N/A
H. suis hsvA targeting probe-based real-time PCR primer sequence: NHP194003_11930_reverse: GATGGGCGCTTCTGGTTTA	Rimbara et al.9	N/A
H. suis hsvA targeting probe-based real-time PCR probe sequence: NHP194003_11930_probe: 56-FAM/TGTACACAC/ZEN/CAAACAGATG AGCCGT/3IABkFQ	IDT Rimbara et al.9	N/A
NHPH 16S rRNA gene targeting probe-based real-time PCR primer sequence: NHPH_16S_F: CAAGTCGAACGATGAAGCCTA	This paper	N/A
NHPH 16S rRNA gene targeting probe-based real-time PCR primer sequence: NHPH_16S_R: ATTTGGTATTAATCACCATTTCTAGT	This paper	N/A
NHPH 16S rRNA gene targeting probe-based real-time PCR probe sequence: NHPH_16S_probe: 56-FAM/TTACTCACC/ ZEN/CGTGCGCCACTAATC/3IABkFQ	IDT This paper	N/A
H. pylori 651 bp DNA fragment of the 23S rRNA gene targeting colony PCR primer sequence: F3: CCGTAGCGAAAGCGAGTCT	This paper	N/A
H. pylori 651 bp DNA fragment of the 23S rRNA gene targeting colony PCR primer sequence: R3: CCCGACTAACCCTACGATGA	This paper	N/A
Software and algorithms
ClustalW ver. 2.1	Open source	http://www.clustal.org/clustal2/
Shovill v1.1.0.	Open source	https://github.com/tseemann/shovill
Roary version 3.13.0	Open source	https://github.com/sanger-pathogens/Roary
RAxML-NG v. 1.1	Open source	https://github.com/amkozlov/raxml-ng
pyani 0.2.12	Open source	https://github.com/widdowquinn/pyani
GraphPad Prism 9.4.1	GraphPad Software	https://www.graphpad.com/scientific-software/prism/
Other
H. suis hsvA targeting probe-based real-time PCR protocol	Rimbara et al.9	N/A
NHPH 16S rRNA gene targeting probe-based real-time PCR protocol	This paper	N/A
H. pylori 651 bp DNA fragment of the 23S rRNA gene targeting colony PCR protocol	This paper	N/A