Table 1.
Strains, primers, genetically engineered yeast in the study.
| Strains | Description | Source |
|---|---|---|
| D. tabescens CPCC 401429 | Melleolides producing strain | [4] |
| E. coli Trans T1 | F-φ80 lac ZΔM15 Δ(lacZYA-arg F) U169 endA1 recA1 hsdR17(rk-,mk+) supE44λ- thi -1 gyrA96 relA1 phoA | Transgen |
| S. cerevisiae BJ5464 | (MATα ura3-52 his3-Δ200 leu2- Δ1 trp1 pep4::HIS3 prb1 Δ1.6R can1 GAL | [29] |
| BJ-CK | S. cerevisiae BJ 5464, carrying plasmid YET | This study |
| BJ-DtSTS9 | S. cerevisiae BJ 5464, carrying plasmid YET-DtSTS9 | This study |
| BJ-DtSTS10 | S. cerevisiae BJ 5464, carrying plasmid YET-DtSTS10 | This study |
| Plasmids | Description | Source |
| YET | tryptophan auxotrophic expressing plasmid of yeast | [29] |
| YET-DtSTS9 | YET expressing plasmid with gene DtSTS9 | This study |
| YET-DtSTS10 | YET expressing plasmid with gene DtSTS10 | This study |
| Primers | Sequence | Size (bp) |
| DtSTS9-F | atacaatcaactatcaactattaactatatcgtaataccatatgacactatctacagca | 963 bp |
| DtSTS9-R | cttgataatggaaactataaatcgtgaaggcatgtttaaacttataatcccagctcgct | |
| DtSTS10-F | atacaatcaactatcaactattaactatatcgtaataccatatgactttatctacttcg | 1005 bp |
| DtSTS10-R | cttgataatggaaactataaatcgtgaaggcatgtttaaacctatatgccaagctcgct |