Reagent of resource	Source	Identifier
Chemicals
EMM	MP Biomedicals	Cat# 114110012‐CF
5‐Ethynyluridine	Thermo Fisher	Cat# E10345
L‐Homopropargylglycine	Cambridge Bioscience	Cat# 11785‐50mg‐CAY
16% Formaldehyde (w/v)	Thermo Fisher	Cat#11586711
NUCLEAR‐ID Blue DNA stain	Enzo Life Sciences	Cat#ENZ‐CHM103‐0200
BSA	Sigma‐Aldrich	Cat#A7906‐100G
Triton X‐100	Sigma‐Aldrich	Cat#T9284‐100ML
PBS	Gibco	Cat#11594516
Sodium citrate	Fisher Bioreagents	Cat#BP327‐500
Critical commercial assays
Click‐iT Plus Alexa Fluor 488 Picolyl Azide Toolkit	Thermo Fisher	Cat# C10641
Click‐iT Plus Alexa Fluor 647 Picolyl Azide Toolkit	Thermo Fisher	Cat# C10643
Experimental models: organisms/strains
S. pombe: h‐ 972wt	Lab collection	PN1
S. pombe: h‐ cdc25‐22	Lab collection	PN143
S. pombe: h‐ leu1‐32::pFS181[adh1‐hENT1 leu1+] pJL218[adh1‐hsvTK his7+]	Lab collection	PN10597
S. pombe: h‐ cig1Δ::ura4+ cig2Δ::ura4+ puc1Δ::ura4+ura4‐D18	Lab collection	PN5792
S. pombe: h‐ cdc25‐22 leu1‐32::pFS181[adh1‐hENT1 leu1+] pJL218[adh1‐hsvTK his7+]	This paper	PN5998 (CB41)
S. pombe: h‐ cig1Δ::ura4+ cig2Δ::ura4+ puc1Δ::ura4+ leu1‐32::pFS181[adh1‐hENT1 leu1+] pJL218[adh1‐hsvTK his7+]	This paper	PN5999 (CB49)
S. pombe: h‐ ura4::pSMUG[EGFP‐pcn1] cig1Δ::ura4+ cig2Δ::ura4+ puc1Δ::ura4+ leu1‐32::pFS181[adh1‐hENT1 leu1] pJL218[adh1‐hsvTK his7+]	This paper	PN6000 (CB71)
S. pombe: ura4::pSMUG[EGFP‐pcn1] cig1Δ::ura4+ cig2Δ::ura4+ puc1Δ::ura4+	This paper	PN6001 (CB80)
S. pombe: h+ leu1‐32::pFS181[adh1‐hENT1 leu1+]	This paper	PN6002 (CB94)
S. pombe: h‐ pJL218[adh1‐hsvTK his7+]	This paper	PN6003 (CB96)
S. pombe: h+ leu1‐32::pNK05 [eno276P‐synCut3‐mCherry‐adh1T leu1+]	This paper	PN6004 (CB117)
S. pombe: leu1‐32::pFS181[adh1‐hENT1 leu1+] pJL218[adh1‐hsvTK his7+] [III,114483]::pNK05[eno276P‐synCut3‐mCherry‐adh1T hphMX6]	This paper	PN6005 (CB135)
Recombinant DNA
Plasmid: eno276P‐synCut3‐mCherry‐adh1T hphMX6	Nitin Kapadia	pNK05
Oligonucleotides
Tctgatttaaggatacgtagaactgcggtgag ttttccttgtgatctattatattacaatacacgggt tgtataagtagcCTCTTGCCCCTTCTAAGCTC	This work	oCB132
Ctcgttcctcagttcagttatgagctatattagtg ataggtaacattataacccagttaatacaatac ctatactcagttTATAGCGACCAGCATTCACA	This work	oCB133
Software and algorithms
FACSDiva v8.0.1	BD	https://www.bdbiosciences.com/en-eu/products/software/instrument-software/bd-facsdiva-software#Overview
FIJI (ImageJ) v2.1.0/1.53c	NIH	https://fiji.sc/
Ilastik v1.3.0‐OSX	Berg et al (2019)	https://www.ilastik.org/
R v4.1.0	R Core Team	https://www.r-project.org/
RStudio v1.4.1106	Team RStudio	https://www.rstudio.com/
Micro‐Manager v2.0	Laboratory for Optical and Computational Instrumentation at the University of Wisconsin, Madison	https://micro-manager.org/