Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Forward (F) and Reverse (R) Primer Sequences of β-actin and hTERT Used in Real-Time PCR
| Oligonucleotide | Location | Sequence | PCR product size (bp) |
|---|---|---|---|
| hTERT | |||
| Forward primer | 2165F | 5ʹCCGCCTGAGCTGTACTTTGT3ʹ | 198 |
| Reverse primer | 2362R | 5ʹCAGGTGAGCCACGAACTGT3ʹ | |
| Beta-actin | |||
| Forward primer | 787F | 5ʹTCCCTGGAGAAGAGCTACG 3ʹ | 131 |
| Reverse primer | 917R | 5ʹGTAGTTTCGTGGATGCCACA 3ʹ |
