| Antibodies |
|
| Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (D13.14.4E) antibody |
Cell Signaling Technology |
Cat# 4370, RRID: AB_2315112 |
| Phospho-Rb (Ser807/811) (D20B12) antibody |
Cell Signaling Technology |
Cat# 8516, RRID: AB_11178658 |
| Rb (4H1) antibody |
Cell Signaling Technology |
Cat# 9309, RRID: AB_ 823629 |
| p16 (H-156) antibody |
Santa Cruz Biotechnology |
Cat# sc-759, RRID: AB_632105 |
| p21 antibody |
BD Biosciences |
Cat# 556430, RRID: AB_396414 |
| Ki-67 (8D5) antibody |
Cell Signaling Technology |
Cat# 9449, RRID: AB_2797703 |
| p27 Kip1 (D69C12) XP Rabbit monoclonal antibody |
Cell Signaling Technology |
Cat# 3686, RRID: AB_2077850 |
| Anti-MCM6 antibody [EPR17686] |
Abcam |
Cat# ab201683, RRID: AB_2924827 |
| Anti-β-Actin monoclonal antibody |
Sigma-Aldrich |
Cat# 5316, RRID: AB_476743 |
| Anti-Raf-B antibody (F-7) |
Santa Cruz Biotechnology |
Cat# sc-5284, RRID: AB_626760 |
| Anti-HA High Affinity; Rat monoclonal antibody (clone 3F10) |
Roche |
Cat# 11867423001, RRID: AB_390918 |
| Anti-mouse IgG, HRP-linked antibody |
Cell Signaling Technology |
Cat# 7076, RRID: AB_330924 |
| Anti-rabbit IgG, HRP-linked Antibody |
Cell Signaling Technology |
Cat# 7074, RRID: AB_2099233 |
| Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 |
Thermo Fisher Scientific |
Cat# A-11034, RRID: AB_2576217 |
| Goat anti-Rat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 |
Thermo Fisher Scientific |
Cat# A-11077, RRID: AB_2534121 |
| Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 |
Thermo Fisher Scientific |
Cat# A-21235, RRID: AB_2535804 |
|
| Bacterial and virus strains |
|
| CSII-EF1-H2B-mTurquoise (lentiviral) |
Spencer et al.21
|
N/A |
| CSII-EF1-mVenus-hGeminin (1–110) (lentiviral) |
Sakaue-Sawano et al.19
|
N/A |
| CSII-EF1-mCherry-dE2F PIP (lentiviral) |
This work |
N/A |
| CSII-EF1-mVenus-dE2F PIP (lentiviral) |
This work |
N/A |
| LV-EKAREN5-NLS (lentiviral) |
Addgene |
Plasmid#167818 |
| LIX402-BRAFV600E-HA-Puro (lentiviral) |
This work |
N/A |
|
| Chemicals, peptides, and recombinant proteins |
|
| Hoeschst 33342, Trihydrochloride, Trihydrate |
Thermo Fisher Scientific |
Cat# H3570 |
| SCH772984, ERK inhibitor |
MedChem Express |
Cat# HY-50846 |
| Doxycycline hyclate |
Sigma-Aldrich |
Cat# D9891-5G |
| SMARTpool: siGENOME Non-targeting siRNA control pools |
Horizon Discovery |
Cat# D-001206-14-05 |
| SMARTpool: siGENOME Human CDKN1A siRNA |
Horizon Discovery |
Cat# M-003471-00-0005 |
| SMARTpool: siGENOME Human CDKN2A siRNA |
Horizon Discovery |
Cat# M-011007-03-0005 |
| SMARTpool: ON-TARGETplus CDKN2B siRNA |
Horizon Discovery |
Cat# L-003245-00-0005 |
| SMARTpool: siGENOME Human CDKN1B siRNA |
Horizon Discovery |
Cat# M-003472-00-0005 |
|
| Critical commercial assays |
|
| Lipofectamine 2000 Transfection Reagent |
Thermo Fisher Scientific |
Cat# 11668027 |
| Senescence Associated β-Galactosidase staining kit |
Cell Signaling Technology |
Cat# 9860 |
| Click-iT™ Cell Reaction Buffer Kit |
Thermo Fisher Scientific |
Cat# C10269
|
| Click-iT™ EdU (5-ethynyl-2’-deoxyuridine) |
Thermo Fisher Scientific |
Cat# A10044 |
| Click-iT™ Alexa Fluor® 647 Azide, Triethylammonium Salt |
Thermo Fisher Scientific |
Cat# A10277 |
|
| Deposited data |
|
| Raw and processed RNA-seq data |
GEO (Gene Expression Omnibus) |
GEO: GSE180210
|
| Results of RNA-seq analysis used to generate main and supplemental figures in the manuscript |
Synapse database |
https://www.synapse.org/#!Synapse:syn21411369/files/
|
|
| Experimental models: Cell lines |
|
| Human: RPE hTERT |
S.J. Elledge Lab (Harvard Medical School) |
N/A |
| Human: RPE + tet-BRAFV600E-HA |
This work |
N/A |
| Human: RPE + H2B-mTurquoise + Venus-dE2F PIP |
This work |
N/A |
| Human: RPE + tet-BRAFV600E-HA + EKAREN5 + mCherry-dE2F PIP |
This work |
N/A |
| Human: RPE + EKAREV-NLS |
This work |
N/A |
|
| Oligonucleotides |
|
| CDKN2B PrimeTime qPCR primers |
Integrated DNA Technologies |
Hs.PT.58.25069372.g |
| CDKN1B PrimeTime qPCR primers |
Integrated DNA Technologies |
Hs.PT.58.45564663 |
| CDKN2A PrimeTime qPCR primers |
Integrated DNA Technologies |
Hs.PT.58.40743463.g |
| EGR1 PrimeTime qPCR primers |
Integrated DNA Technologies |
Hs.PT.58.40805543.g |
| DUSP4 PrimeTime qPCR primers |
Integrated DNA Technologies |
Hs.PT.58.18820216 |
| p21 forward qPCR primer: TGTCACTGTCTTGTACCCTTG |
Purvis et al.45
|
N/A |
| p21 reverse qPCR primer: GGCGTTTGGAGTGGTAGAA |
Purvis et al.45
|
N/A |
| HPRT forward qPCR primer: GTATTCATTATAGTCAAGGGCATATC |
This paper |
N/A |
| HPRT reverse qPCR primer: AGATGGTCAAGGTCGCAAG |
This paper |
N/A |
|
| Recombinant DNA |
|
| pPB-CAG-EKAREV-NLS (piggyBac) |
Komatsu et al.26
|
N/A |
| pCMV-hyPBase |
Komatsu et al.26
|
N/A |
|
| Software and algorithms |
|
| Scripts for analysis of RNA sequencing data |
This work |
https://github.com/clemenshug/erk_senescence
|
| Software for automatic segmentation and quantification of immunofluorescence images |
Salmeen et al.46
|
N/A |
| Software for automatic segmentation, and quantification of fluorescent reporter cells following live imaging |
Cappell et al.47
|
https://github.com/scappell/Cell_tracking
|
| p53 Cinema Single Cell Tracking |
Reyes et al.48
|
https://github.com/balvahal/p53CinemaManual
|
| EllipTrack |
Tian et al.49
|
https://github.com/tianchengzhe/elliptrack
|
