Pharmacognosy, phytochemistry, and molecular studies of an important medicinal herb Achillea millefolium L.

Abstract

Background:

Achillea millefolium L. is traditionally important medicinal herb used for the treatment of various ailments from the centuries. Recent studies showed its biological activities on hay fever, hepato-biliary disorders, and as appetite enhancing drug. It is also reported to be used for the treatments of skin inflammations, wounds, cuts, and abrasions.

Aim:

To investigate preliminary pharmacognostical, phytochemical, and molecular parameters of aerial parts of the drug.

Materials and methods:

A. millefolium was identified and collected from the Himalaya region. The material is properly dried, macro-and microscopic evaluation, phytochemical and molecular studies as per the standard quality control and WHO guidelines.

Results:

The leaves are pinnately lobed, inflorescence compound corymbose. Nonglandular trichomes are uni-seriate, multicellular, and smooth walled; glandular trichomes are bicellular, present throughout the aerial parts. The endodermis is evident in the stem and leaf mesophyll is equifacial. The partial genome sequence analysis showed similarity toward studied species, which can clearly distinguish it from other species of the genus Achillea. The best chromatographic separation was observed with ascentis express C18, 2.7 μm, 100 mm × 4.6 mm. The flavonoids and phenolic acids have shown maximum absorbance at 330 nm. The system suitability parameters such as theoretical plate, tailing factor, and resolution met the acceptance criteria with United States pharmacopeia (USP).

Conclusion:

The findings of this study will be helpful for the precise identification of the raw drug of A. millefolium from its closely allied species.

Introduction

Achillea millefolium L. is commonly known as yarrow or Milfoil belongs to Asteraceae. It is a high altitude, alpine plant shows circumboreal distribution within the northern hemisphere includes Asia, Europe, and North America.[1] Within India, it has been recorded in the Himalayan region of Jammu and Kashmir, Himachal Pradesh, Uttaranchal at an altitude range of 1050–3600 m.[2] The genus name “Achillea” is derived from mythical Greek word “Achilles” and specific epithet “millefolium” refers to many segments of its foliage or leaves.[3] It is commonly called as Biranjasipha and Gandana in Sanskrit, Bhut Kesi in Hindi, and Chopandiga in Kashmiri.[4,5] Yarrow plant has been used for its medicinal properties from the ancient times and used as a wound-healing herb in the folk and traditional system of medicine for over the hundreds of years. Due to its remarkable medicinal properties, the aerial parts are reported as a bitter tonic, used to treat gastrointestinal disorders by supporting proper bile flow; stimulates blood circulation for high blood pressure and decoction of the whole plant is used for treating the bleeding piles and kidney disorders.[6] It was also used as an herbal tea in South Africa for treatment of arthritis and related ailments, general detoxification, diabetes, nausea, and dizziness.[7]

It is also described that the flower tops or inflorescences are the medicinally active parts having mild stimulant effect and used to treat various allergic mucus problems such as hay fever disorders.[6] Fresh leaves are chewed for acute toothache[8] and used as mouthwash to promote healing of cuts in mouth and for tooth cleaning.[9] In folk, it is consumed as herbal tea for treating gastrointestinal disorders, headache, hepato-biliary disorders, and as appetite-enhancing drug.[10,11] Externally, it is applied as a lotion or ointment for skin inflammations, wounds, cuts, and abrasions.[12] Yarrow plant and its extracts also have a promising benefit for antimicrobial and antioxidant properties in pharmaceutical and cosmetic products.[13] It is also considered as safe food supplement[14] and it has been introduced as a new source of dyeing the wool and found to have good agronomic potential as a natural dye in Iran.[15] Yarrow is described as “Neglected panacea,” where this herbal medicine has emerged as the focus of numerous scientific studies evaluating and reviewing the plant’s ethnobotany, reported phytochemistry, and related bioactivity.[16]

There are opportunities for substitution or adulteration of the raw ingredients of the herbal products in powder form may be intentional or unintentional or long supply chain from the harvesting site to the market. For that reason, the correct recognition of plants used for medicinal purposes in association to their naturalness and adulteration-free as well as a secure application has now progressively focused.[17] Molecular identification technology such as deoxyribonucleic acid (DNA) barcoding has been recognized as important and reliable tool for the identification of medicinal plants. ITS marker is the most efficient for identifying species based on the “best close match” sequence similarly, the trnH-psbA + ITS combination also demonstrated satisfactory results.[18] Hence, the current study selected these two markers and standardized the molecular identification technique.

A. millefolium contains variety of phytoconstituents such as terpenes, tannins, alkaloids, sterols, vitamins, flavonoids, and phenolic acids.[19] Among all the Phyto-compounds, the raw material is rich in flavonoids and phenolic acids. There are many flavonoid glycosides and aglycones reported in this plant. The flavonoid glycoside includes vicenine, vitexin and sweticin.[20] Many Achillea species have reported rich source of flavones, flavonoids, and lignans.[21]

Upon literature reviews, there are many studies on phytochemical, pharmacological, immunological, biological, and other therapeutic activities which revealed the presence of many active components. However, detailed studies on pharmacognosy and molecular identification are limited for the identification of the actual authentic plant used as active raw material in herbal industry. Establishment of pharmacognostical parameters such as macroscopic and microscopic studies will help in identifying and authenticating the true drug and diagnostic characters are useful for further standardization of authentic drug and reduces the possibilities of adulteration to differentiate it with adulterants and admixtures. The present study was performed and standardized the authentication of A. millefolium raw material through pharmacognostical, molecular techniques, and phytochemical studies.

Materials and methods

The aerial parts of A. millefolium were collected from the various locations [Table 1] and taxonomically identified plants [Figure 1],[22,23] and the herbarium specimen was reposited at foundation for revitalization of local health traditions (FRLHT) Herbarium and Raw Drug Repository, Bangalore, Karnataka, India with a voucher number “123417.” The collected aerial parts are chopped and sun dried. Dried material was used as a reference sample for pharmacognostical characterization such as organoleptic, macroscopic, histochemical, phytochemical, and molecular identification and establishment.

Table 1.

Geographical locations of Achillea millefolium collection

Location	GPS coordinates	Altitude (m)
Solang Valley, Manali, Himachal Pradesh	N32° 19.776’ E77° 09.287’	2643
Parashar, Mandi District, Himachal Pradesh	N31° 45.319’ E77° 06.034’	2586
Tihri, Mandi District, Himachal Pradesh	N31° 48.396’ E77° 04.450’	2151

GPS: Global positioning system

Figure 1.

Achillea millefolium – Habitat

DNA barcoding was carried out as described in quality control methods.[24,25]

Organoleptic, macroscopic, and microscopical observations

Organoleptic characters such as color, odor, and taste were recorded from the dried raw materials of taxonomically authenticated plants. Macroscopic characters such as nature, texture, and external features were also noted. Hand sections were carried out to record the microscopic features, followed by histochemical studies performed with various stains such as safranin, toluidine blue, and Lugol’s iodine solutions. The microscopic features were recorded, and the images were captured using Olympus BX53 bright field microscope.

Molecular identification studies

The collected reference sample was subjected for isolation and DNA barcoding. Total genomic DNA was isolated from dried plant material using a NucleoSpin® Plant II DNA Kit (MACHEREY-NAGEL, Germany) and protocol followed as per the manual. Polymerase chain reaction (PCR) amplifications of ITS and PsbA-trnH followed as per the canadian centre for dna barcoding (CCDB) protocols were carried out on a Proflex polymerase chain reaction (PCR) system (Applied Biosystems, USA) using 12 μl of 2X PCR Taq mixture (Himedia MBT-061), 5 μl of genomic DNA, 2 μl (10 picomoles) of each forward and reverse primers and the reaction volume make up to 25 μl using molecular biology grade water. After the amplification, the product is tested for its confirmation. The PCR conditions for rbcL: 94°C for 1 min, followed by 35 cycles of 94°C for 30 s, 55°C for 20 s and 72°C for 50 s, and a final step at 72°C for 5 min. PsbA-trnH: 94°C for 1 min, followed by 35 cycles of 94°C for 30 s, 60°C for 20 s and 72°C for 50 s, and a final step at 72°C for 5 min [Table 2].

Table 2.

Primers used for DNA barcoding of Achillea millefolium

Primer region	Sequence (5’- 3’)
ITS2 (White et al.,1990)	Forward primer: 5’- GGAAGGAGGAGTCGTAAAAG-3’ Reverse primer: 5’- TCCTCCGCTTATTGATATGC-3’
PsbA-trnH (Tate and Simpson, 2003)	Forward primer: 5’- GTTATGCATGAACGTAATGCTC-3’ Reverse primer: 5’- CGCGCATGGTGGATTCACAATCC-3’

Visualization of polymerase chain reaction product

Five microliter of the PCR product was mixed with 6X loading buffer (ML 015-Himedia) and loaded on 2% Agarose gel in Tris-acetate EDTA buffer along with 10 kb DNA ladder (Fermentos). Electrophoresis was carried out at 110V for 60 min and photograph was taken under Ultraviolet (UV) Gel documentation unit (Syngene, USA). Successful amplified products were analyzed for Sanger sequencing at Eurofins Genomics Private Limited, Bangalore.

Evaluation of sequence

The chromatographic traces (*. ab1files) obtained after sequencing were converted in to FAST All’ (FASTA) format and edited by using ExPASy Translator tool. The edited sequences were screened using Basic Local Alignment Search Tool (BLAST) algorithm to identify the closest matching sequence of ITS-2 and PsbA-trnH region in the nucleotide database of GenBank, national centre for biotechnology information (NCBI) and by barcode of life data (BOLD) systems database.[26]

Phytochemical analysis

Chemicals and reagents

The chemicals used for the study were high-performance liquid chromatography (HPLC) grade. Trifluoroacetic acid was procured from Merck Life Science Pvt. Ltd, Acetonitrile from Fischer Scientific, Methanol from Standard Reagents Pvt. Ltd., Ethanol from Honyon Intl, Inc. Ethyl acetate, Butanol, and Formic acid were procured from Rankem. The standard of Rutin hydrate (CAS Number: 207671–50-9) was procured from Sigma Aldrich.

Phytochemical studies

The aerial parts of A. millefolium were dried, powdered, and extracted with hydro alcohol which was filtered and concentrated to dry extract. The extract subjected to phytochemical analysis revealed the presence of flavonoids which were quantified by UV-visible (UV-VIS) spectrophotometer.[27] Flavonoids give yellow color when treated with aluminium chloride reagent. The standard and sample stock solutions of 0.05 mg/ml and 2 mg/ml respectively were prepared in methanol and 2 ml each of these solutions were pipetted out into two different volumetric flasks of 10 ml capacity. To these 1 ml of aluminium chloride reagent was added and made the volume to 10 ml with ethanol. The solutions were mixed well, and the absorbance was measured against the prepared reagent blank at 410 nm. The method validation for the quantification of flavonoids was performed. The physico-chemical analysis such as total ash, loss on drying, acid insoluble ash, water, and methanol extractive values were assessed using the WHO guidelines for the quality control of herbal drugs.[28]

Loss on drying

Ten gram of powdered sample was transferred in a tared evaporating dish and dried at 105°C for 5 h and weighed. The process was continued until concordant result was observed.

Total ash

Two gram of powdered material was weighed in a previously weighed silica crucible and incinerated, gently at first, and gradually increased the temperature to 675°C ± 25°C until free from carbon.

Acid insoluble ash

The ash obtained was treated with 25 ml of 2M hydrochloric acid and boiled for 5 min. The insoluble matter was collected in a Gooch crucible, washed with hot water and ignite at 600°C ± 25°C.

Water soluble extractive value

Five gram of powdered material was macerated with 100 ml of chloroform-water mixture in a closed flask for 24 h, continuously shaken for 6 h and allowed to stand for 18 h. The solution was filtered, and 25 ml of the filtrate was dried completely in a tared flat-bottomed shallow dish at 105°C and weighed which gives the percentage of water-soluble extractive value.

Alcohol soluble extractive value

Five gram of powdered material was macerated with 100 ml of absolute alcohol in a closed flask for 24 h. It was continuously shaken for 6 h and kept still for 18 h. The solution was filtered, and 25 ml of the filtrate was transferred into a flat-bottomed flask and dried at 105°C and weighed which gives the alcohol soluble extractive value.

High-performance liquid chromatography analysis

A method coupling HPLC with photo diode array detector (PDA) was used for the separation and identification of flavonoids and phenolic acids. Different mobile phase compositions were chosen to obtain the chromatogram with good separation. Analytical reversed phase Shimadzu HPLC equipped with a PDA detector, SIL-20 ACHT auto sampler, DGU-20A5 degasser, LC-20 AD pump, CBM-20 A system controller, CTO-10ASvp oven and LC solutions software was used.

Thin-layer chromatography fingerprint

The thin-layer chromatography (TLC) fingerprint was performed for the identification of flavonoids and phenolic acids in the extract. The sample of dry extract 50 mg/ml in methanol was spotted on precoated silica gel 60F 254 plates (Merck) using CAMAG Linomat V sample applicator. The mobile phase employed was ethyl acetate: butanol: formic acid: water in the ratio 5:3:1:1. The plate was developed and visualized under UV 254 nm, 366 nm before dipping and dipped with aluminium chloride solution and observed at 366 nm.

Results and Discussion

Organoleptic and macroscopical characters

Dried aerial parts such as stem pieces, leaves, and inflorescence stalks with flower heads were studied. [Figure 2] In bulk, color of dried reference sample varies from green to brown to mild black with faintly aromatic odor and slightly bitter taste. Stems are herbaceous, about 5 mm thick, cylindrical, and slightly angular at cut ends due to longitudinal streaks. They are branched with hollow or soft-spongy pith, easily breakable while handling and the broken ends shows fibrous fracture. The surface is dull, rough, pubescent and longitudinally streaked. Leaves are several times pinnately lobed, highly fragile and crumpled. Pinnatisected leaves with leaf blades are linear to lanceolate in outline with entire margin and acute tip. Inflorescence constitutes peduncle and floral heads. Peduncle is compound corymbose type with numerous branches. The youngest flowers are attached at the inflorescence top with short stalk and the oldest flowers are at the base with long stalk. Peduncle has numerous longitudinal ridges or streaks and sometimes longitudinally shrunken with fibrous fracture and smooth texture. Flower heads are up to 0.5–0.7 mm in length with involucre of bracts.

Figure 2.

Authentic sample of A.millefolium aerial parts

Microscopical characters

Transverse section of stem

Transverse section of stem shows circular outline with ridges and furrows.[Figure 3] It is composed of epidermis, cortex, vasculature, and central pith. Outermost epidermis is single layered, made of square to rectangular shaped cells, covered with cuticle and covering or nonglandular trichomes. Trichomes measure around 300–600 μ in length, unbranched, uni-seriate, multi-cellular, smooth walled with bulbous basal cell, 4–6 short stalk cells and one long terminal cell with pointed tip. Cortex is differentiated into outer collenchyma and inner parenchyma. Collenchyma is 3–5 layered and multilayered below the ridges. Parenchyma is 6–8 layered, made of simple, regularly arranged round to polygonal shaped thin-walled cells. The outermost layer of vascular bundles is represented by a distinct layer of endodermis followed by pericycle. Pericycle is the discontinuous circle of grouped, lignified, thick-walled fibers with clearly visible lumen, followed by the vascular region, composed of outer phloem and inner xylem. Phloem is narrow, made of small sized, thin-walled round to polygonal shaped cells. Xylem shows vessels, fibers, parenchyma cells and rays. Rays are uniseriate or sometimes biseriate. Pith occupied a major portion, made of thin walled, round to polygonal-shaped parenchyma cells or sometimes hollow. Stem epidermal peel shows numerous covering trichomes and very few glandular trichomes. [Figure 4]

Figure 3.

Transverse section of stem stained with toluidine blue shows outer epidermis (ep) with trichome (tr), cortex (co), endodermis (en), xylem (xy), phloem (ph) and pith (pi)

Figure 4.

Epidermal peel of leaf stained with toluidine blue shows nonglandular trichomes (marked arrow)

Cross section of pinnatisect leaf

It shows “T” shaped outline, with upper and lower epidermis, enclosing the ground tissue and vascular bundle. [Figure 5] Epidermis is single layered, square-shaped cells covered with cuticle and shows trichomes similar as in stem and presence of a few glandular trichomes. The ground tissue is differentiated into outer 2–3 layered compactly packed collenchyma cells and inner loosely arranged thin-walled parenchyma cells with intercellular spaces. Vascular bundles are three in number, one main bundle in the middle and other two accessory bundles in each corner. Each vascular bundle has a discontinuous group of sclerenchymatous bundle cap cells on both the surfaces. Leaf epidermal peel shows both nonglandular and glandular trichomes. Glandular trichomes are represented as dark round bodies and stomata is anomocytic type with slightly wavy epidermal cells. [Figure 6]

Figure 5.

Cross section of compound leaf stained with toluidine blue shows outer epidermis (ep), inner ground tissue (gt) and central vascular bundle (vb)

Figure 6.

Epidermal peel of leaf stained with toluidine blue shows glandular trichome (marked arrow)

Transverse section of peduncle

It is circular in outline with ridges and furrows; it shows outer epidermis, cortex, vascular region, and central hollow pith [Figure 7]. The epidermis is single layered, made of round to polygonal shaped cells with long unicellular, unbranched, covering or nonglandular trichomes. The cortex in ridges is made of patches of collenchyma cells and followed by parenchyma cells. In grooves, the cortex is differentiated into collenchyma and parenchyma cells. Stele is as similar as in stem but, it has shown broader pith.

Figure 7.

TS of peduncle stained with toluidine blue shows outer epidermis (ep) with trichomes (tr), vascular bundle (vb) and parenchymatous and partially hallow pith (pi)

Elongated terminal celled, nonglandular, multicellular trichomes with a bulbous basal cell was similarly reported in the earlier studies.[29,30] Glandular trichomes are uni-or bi-seriate with short or indistinct base and bicellular head, similarly, reported in Achillea clypeolata.[31] Bi-cellular stalk cells and single head cell;[29] biseriate glandular trichome.[30] Leaf cells are isobilateral, with palisades composed of 1–3 layers[25] and single-layered palisade is also reported,[29] whereas mesophyll is equifacial, 6–8 layered and indistinct, as similarly observed in American Pharmacopoeia.[31] The endodermis is single layered and distinct which is similarly observed as evident in Achillea sivasica.[32] Calcium oxalate crystals are absent as similarly reported earlier,[33] whereas contradictorily reported by another author, where they are present.[34]

Powder microscopy

Powder is greenish to greenish brown to brown in color with soft and coarse texture. It shows vascular elements, simple thin-walled parenchyma cells from cortex and pith, thick-walled cells and trichomes are abundantly seen everywhere. Vessels with spiral thickening [Figure 8a], scalariform thickening [Figure 8b], fibers [Figure 8c], thick-walled lignified pericyclic fibers [Figure 8d], unbranched, uniseriate, multicellular nonglandular trichomes [Figure 8e], thin-walled parenchyma cells [Figure 8f], and ray cells [Figure 8g] are observed from the stem. Some of the other cell components like epidermal peeling shows stomata and epidermal cells [Figure 8h] and piece of involucral bract are also observed here and there [Figure 8i].

Figure 8.

(a-i). Powder microscopy of A. millefolium showing vessels (vs), fibers (fb), trichomes (tr), parenchyma (pa), ray cells (ry), epidermis (ep) and involucral bract (ib) elements. A. millefolium: Achillea millefolium

Molecular identification studies

Partial aligned sequences were subjected for NCBI blast, and BOLD database analysis and the results are illustrated in Table 3.

Table 3.

Confirmation of Achillea millefolium by ITS2 and PsbA-trnH partial sequence analysis

Name of the primer	Length of the sequence	Species matching in reference database
		NCBI	BOLD
ITS2 (ribosome genome)	493 base pairs	A. millefolium -99.13%	A. millefolium- 100%
PsbA-trnH (chloroplast genome)	713 base pairs	A. millefolium -98.00%	Not applicable

A. millefolium: Achillea millefolium, BOLD: Barcode of Life Data System, NCBI: National Center for Biotechnology Information

The isolated genomic DNA from the species of A. millefolium and PCR amplification of the ITS and PsbA-trnH. PCR amplification of ITS and PsbAtrnH markers was successful, and we have got an expected sizes of 650 and 450 base pairs, respectively. The ITS region consists of ITS1, 5.8S rDNA and ITS2. The ribosomal sites of 5.8S rRNA and 28S rRNA are highly conserved. From the sequence analysis in NCBI BLAST, it was observed that the gene ITS showed 100% homologus sequence similarity towards A. millefolium as well as in BOLD database. To confirm this results another marker PsbA-trnH is also showed a similarity of 98.89% when compared with NCBI database. Both the genes result analysis clearly distinguishes A. millefolium species from the other species such as Achillea ptarmica and Achillea alpinia [Table 4]. For accurate identification of the plant species, DNA-based methods have several advantages over morphological and chemical analysis, because it depends on genotypes rather than phenotypes. Hence, the results would not be affected by the environmental factors and age of the plant materials. The present investigation proves that DNA Barcoding is a consistent method to differentiate the closely related species of Achillea.

Table 4.

Partial aligned sequences of ITS2 and PsbA-trnH

Name of partial sequence	Forward sequence
Partial sequence (ITS2)	>A. millefolium ITS2 gene Forward sequence CCCTTGGGACTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACAC GTAAAAACAA CT GAGCGTCGAGTGGATTAAGCGTTTG TTTGATCCTCTCGATGCTTTGTCGATGTGC ATTTACTTGTGTTCTTTTTAGGACCTGGTGAATGTGTCATTGAC GCA ATAACAACCCCCGGCACAA TGTGTGCCAAGGAAAACTAAACTTGAGAAGGCTTGTTTCATGTTGCCCCGTTCGCGGTGCGCTCATGGAATG TGGCTTCTTTTTAATTACAAACGACTCTC GGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAG CAAAATGCGATACTTGGTGTGAATTGCAGAATCC CGTGAACCATCGAGTTTTTGAACGCAAG TTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGT CACGCATCGCGTCGCCCCCAACAA ATATCTGTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGTGTGGTTGGCCAAAATAAGAGTCCC TTCGATGG ACACACGAACTAGTGGTGGTCGTA AAAACCCTCGTTCTTTGTTCTGTGTTAGTCGCA AGGAAAAACTCTTCAGATACCCCCAACGCGTTGTCTTAGG ATGACGCTTCGACCGCGACCC CAGGTCAGGCGGGACTACCCGCTGAG TTTAAGCATATCATAAACCCGGGAAGAAAAA
Partial sequence (PsbA-trnH)	>A. millefolium PsbA-trnH gene Forward sequence AAACGGATGTGCATCGCCATGTCGCGAGCTCCTCTACAATGGATAAGACTTTGGTC TGATTGTATAGGAGTTTTTGAACTAATAAAAAAGGAGCA ATAGCTTTCCTCTTGTTTTATCAAGAGG GCGTTATTGCTCCTTTTTTTATTTAGTACTATTTGCCTTGCACAGTTTCTTTAAAAATAATAAGGACTTT TTATAGTTTGGTTTGATTCGTGTGTT TTCGCTTTGTATTCATTTATATTATAGGTTTGTATATTCT ATTCCAAATTTTTTATGAAGTTTTATTTCCAATTCAATTTCAAAACAAAATCTATCAAAATTTAATTTTT GCTATTACTTTTATTTCATAAATAAA AAAGAAATAATATGCTCTTTTTTATGTTGAGGTAAAAATAT AGATAATACTATACTAGATAGATATATAGTAGAGGGGCGGATGTAGCCAAGTGGATCAAGG CAGT GGATTGTGAATCCCCCCACACACACCC CGAAA

A. millefolium: Achillea millefolium

Phytochemical studies

The physico-chemical analyses performed include loss on drying, total ash, acid insoluble ash, and extractive values [Table 5]. The percentage of water and methanol extractive value provided the yield of active principle in the respective solvent. The result revealed that the phytoconstituents are more soluble in water than methanol. The amount of inorganic material in the form of sand and other adulterant along with the plant was determined by the ash value. The minimum and maximum ash value observed was 7.9% and 8.3%, respectively. The estimation of moisture content in the sample is a significant tool for determining the possibility of degradation due to high moisture content. The minimum and maximum percentage of moisture content observed was 9.1% w/w and 9.9 w/w.

Table 5.

Physio-chemical parameters of Achillea millefolium aerial parts

Parameter	Values (% w/w)
Loss on drying	9.50±0.40
Total ash	8.03±0.23
Acid insoluble ash	1.33±0.25
Water extractive value	18.50±1.35
Methanol extractive value	6.47±0.31

The hydromethanolic dry extract revealed the presence of flavonoids which were quantified using Rutin as standard. The percentage yield of flavonoids observed was 3.7% w/w quantified by validated UV-VIS spectrophotometric method. The HPLC method carried out in this study was aimed at developing a chromatographic system, capable of resolving flavonoids and phenolic acids. In the HPLC method development, many trials have conducted using different solvent systems and columns. The chromatographic separation was achieved using 0.1% trifluoroacetic acid in water and 100% acetonitrile as the mobile phase using linear gradient elution (0–10 min, B conc. 10%–30%, 15–18 min, B conc. 30%–40%, 18–22 min, B conc., 40%–80%, 22–26 min, B conc. 80%, 28–30, B conc. 10%) at a flow rate of 1.0 ml/min with a column temperature of 35°C. The phenolic acids and flavonoids peaks were well resolved at 330 nm.

The best separation was with Ascentis Express C18 (100 × 4.6) mm, particle size: 2.7 μ. The flavonoids and phenolic acids have shown maximum absorbance at 330 nm [Figure 9]. The system suitability parameters such as theoretical plate, tailing factor, and resolution met the acceptance criteria. The phenolic compounds and flavonoids were eluted at the retention time of 5.68, 6.28, 7.19, 9.38, 19.557, 20.267 and 12.636, 14.156, 14.409, 14.967, 15.198, 18.149, 20.781, and 21.408, respectively [Figures 10 and 11].

Figure 9.

Sample chromatogram of A. millefolium hydro methanolic extract. A. millefolium: Achillea millefolium

Figure 10.

UV spectrum of phenolic acids in A. millefolium hydro methanolic extract. UV: Ultraviolet, A. millefolium: Achillea millefolium

Figure 11.

UV spectrum of flavonoids in A. millefolium hydro methanolic extract. UV: Ultraviolet, A. millefolium: Achillea millefolium

The TLC fingerprint of sample is represented [Figure 12]. At UV-366 nm before spray of aluminium chloride, dark blue quenching bands represent phenolic acids and yellow bands after spray represents flavonoids. Among the sample collected from various locations and the supplier were analyzed & compared for macroscopic, microscopic, molecular, and phytochemical studies.

Figure 12.

TLC Fingerprint of A. millefolium hydro-methanolic extract. TLC: Thin-layer chromatography

The medicinal plants with rich secondary metabolites are of great medicinal values and have been broadly used as a drug in the pharmaceutical industry. The phytoconstituents particularly plant phenolics constitute (phenolic acids and flavonoids) a major group of compounds that act as primary antioxidants. The presence of phenolic acids and flavonoids revealed that A. millefolium aerial part could be used as a promising natural antioxidant. The knowledge of phytomarkers is the preliminary approach to identify novel secondary metabolites in the botanical ingredient and its extract. The sample research carried out by the researchers about A. millefolium in the recent past has revealed the importance of this plant to use as a drug. The present study revealed the pharmacognosy and phytochemistry of A. millefolium to explore its therapeutic potential and research opportunities. The proposed developed HPLC method demonstrated high specificity at 330 nm detection of phenolic compounds and flavonoids in the extracts of A. millefolium and this method can be applied for the routine identification. The analytical data of phytoconstituents in this plant are the basic approach for the identification and quantification of phenolic compounds and rich flavonoids. The phenol exhibits a higher or lower absorption in the UV region due to the presence of conjugated double and aromatic bonds. Phenolic acids with the benzoic acid carbon framework have their maxima in the 200–290 nm range and cinnamic acid derivatives. Additional conjugation shows a broad absorbance band from 270 to 360 nm.[35] The UV spectra of most flavonoids consists of two major absorption maxima, one of which occurs in the range 240–285 nm and other in the range 300–400 nm,[36] from UV-spectral data it is concluded that peaks eluted at the retention time of 5.68, 6.28, 7.19, 9.38, 19.557 and 20.267 belongs to phenolic acids of cinnamic acid derivatives and peaks at 12.636, 14.156, 14.409, 14.967, 15.198, 18.149, 20.781, and 21.408 belongs flavonoids. The results were in lined with the international council for harmonisation’s (ICH) guidelines.[37] The quantitative method developed was fruitfully applied for the analysis of flavonoids in A. millefolium extract. The proposed HPLC method depicts the identification of phenolic acids and flavonoids which are well resolved at 330 nm. Further, this method can be applied for the standardization of multicomponent herbal remedies with A. millefolium extract. The present study will enable to open a window in search of phytomarkers as bioactive compounds.

Conclusion

Assessing the safety and efficacy of herbal medicines remain problematic with inadequate or inconsistent methods being used for their precise identification. The identification of A. millefolium is difficult to establish based on morphological traits alone. Hence, the samples of A. millefolium was collected from taxonomically identified plants and systematically standardized for their authenticity parameters based on Pharmacognostic evaluation, DNA Barcoding analysis and Phytochemical studies. The results of this work are useful in the precise identification of A. millefolium.

Financial support and sponsorship

This work is supported by R & D Center, Himalaya Wellness Company, Makali, Tumakuru Road, Bengaluru, Karnataka, India, Pin 562162.

Conflicts of interest

There are no conflicts of interest.