KEY RESOURCES TABLE
| Reagent or resource | Source | Identifier |
|---|---|---|
|
| ||
| Antibodies and Flow cytometry reagents | ||
|
| ||
| Anti-mCD25- eF780 (clone PC61.5) | eBioscience/ThermoFisher | Cat# 47-0251.82 RRID: AB_1272179 |
| Anti-mCD25- Pe-Cy7 (clone PC61.5) | BD Biosciences | Cat#552880 RRID: AB_394509 |
| Anti-mCD25- PE (clone PC61) | BD Biosciences | Cat# 553866, RRID:AB_395101 |
| Anti-mCD4- BV711 (clone RM4-5) | BD Biosciences | Cat#563726 RRID: AB_2738389 |
| Anti-mCD4- PE (clone RM4-5) | BD Biosciences | Cat#553049 RRID: AB_394585 |
| Anti-mCD4- PcP Cy5.5 (clone RM4-5) | BD Biosciences | Cat#550954 RRID: AB_393977 |
| Anti-mCD4- V450 (clone RM4-5) | BD Biosciences | Cat#560468 RRID: AB_1645271 |
| Anti-mCD4- BV650 (clone RM4-5) | BD Biosciences | Cat#563647 RRID: AB_2716859 |
| Anti-mCD44-eF780 (clone IM7) | eBioscience/ThermoFisher | Cat# 47-0441-82 RRID: AB_1272244 |
| Anti-mCD44- Pe-Cy7 (clone IM7) | eBioscience/ThermoFisher | Cat#25-0441-82 RRID: AB_469623 |
| Anti-mCD44- V450 (clone IM7) | BD Biosciences | Cat#560451 RRID: AB_1645273 |
| Anti-mCD44- V500 (clone IM7) | BD Biosciences | Cat#560780 RRID: AB_1937316 |
| Anti-mCD45- APC-eF780 (clone 30-F11) | eBioscience/ThermoFisher | Cat#47-0451-80 RRID: AB_1548790 |
| Anti-mCD45.2- BV711 (clone 104) | BD Biosciences | Cat#563685 RRID: AB_2738374 |
| Anti-mCD45.2- FITC (clone 104) | BD Biosciences | Cat#553772 RRID: AB_395041 |
| Anti-mCD45.2- PE (clone 104) | BD Biosciences | Cat# 560695 RRID: AB_1727493 |
| Anti-mCD62L- APC (clone MEL-14) | BD Biosciences | Cat# 553152 RRID: AB_398533 |
| Anti-mCD62L- PE (clone MEL-14) | BD Biosciences | Cat# 553151 RRID: AB_394666 |
| Anti-mCD8α-PE (clone 53-6.7) | BD Biosciences | Cat# 553033 RRID: AB_394571 |
| Anti-mCD8α- FITC (clone 53-6.7) | BD Biosciences | Cat# 553031 RRID: AB_394569 |
| Anti-mCD8α- APC (clone 53-6.7) | BD Biosciences | Cat#553035 RRID: AB_398527 |
| Anti-mCD8α- APC-R700 (clone 53-6.7) | BD Biosciences | Cat#564983 RRID: AB_2739032 |
| Anti-mCD8α- APC-eF780 (clone 53-6.7) | eBioscience/ThermoFisher | Cat# 47-0081-82 RRID: AB_1272185 |
| Anti-mCD8α- PcP Cy 5.5 (clone 53-6.7) | BD Biosciences | Cat#551162 RRID: AB_394081 |
| Anti-mTbet- PE (clone 4B10) | eBioscience/ThermoFisher | Cat# 12-5825-82 RRID: AB_925761 |
| Anti-mTbet- PercpCy5.5 (clone 4B10) | eBioscience/ThermoFisher | Cat# 45-5825-82 RRID: AB_953657 |
| Anti-mFoxp3- PC7 (clone FJK-16S) | eBioscience/ThermoFisher | Cat# 25-5773-82 RRID: AB_891552 |
| Anti-mIFNγ- APC (clone XMG1.2) | eBioscience/ThermoFisher | Cat#17-7311-82 RRID: AB_469504 |
| Anti-mTCRβ- AF594 (clone H57-597) | Biolegend | Cat# 109238 RRID: AB_2563324 |
| Anti-hCD4- PcP Cy5.5 (clone OKT4) | eBioscience/ThermoFisher | Cat# 45-004842 RRID:AB_10804390 |
| Anti-hCD25- FITC (clone B1,49,9) | Beckman Coulter | Cat# IM0478U RRID: AB_130985 |
| Anti-hCD45RΑ- BV711 (Hl100) | BD Biosciences | Cat# 563733 RRID: AB_2738392 |
| Anti-hCD45RO- BV650 (clone UCHL1) | BD Biosciences | Cat# 563750 RRID: AB_2744412 |
| Anti-hCD62L- PE (clone DREG56) | Beckman Coulter | Cat# IM2214U RRID: |
| Anti-hCD62L- PE (clone DREG56) | BD Biosciences | Cat# 555544 RRID: AB_395928 |
| Anti-hCD62L- PE (clone 555544) | BD Biosciences | Cat# 555544 RRID: AB_395928 |
| Anti-hCD127- Pc7 (clone R34.34) | Beckman Coulter | Cat# A64618 RRID: AB_2833031 |
| Anti-hCD127- BV786 (clone HIL-7R-M21) | BD Biosciences | Cat# 563324 RRID: AB_2738138 |
| Anti-hFoxp3- APC (clone PCH101) | eBioscience/ThermoFisher | Cat# 17-4776-41 RRID: AB_1603281 |
| Anti-hCCR7-PeCy7 (Clone 3D12) | BD Biosciences | Cat# 557648, RRID:AB_396765 |
| InVivoMab anti-mouse CD16/CD32 (2.4G2) | BioXcell | Cat# BE0307 RRID: AB_2736987 |
| InVivoMAb anti-mouse IL-4 (clone 11B11) | BioXcell | Cat# BE0045 RRID: AB_1107707 |
| InVivoMAb anti-mouse CD3ε (clone 145-2C11) | BioXcell | Cat# BE0001-1 RRID: AB_1107634 |
| InVivoMAb anti-mouse CD28 (clone PV1) | BioXcell | Cat# BE0015-5 RRID: AB_1107628 |
| InVivoMAb anti-human CD3 (clone OKT3) | BioXcell | Cat# BE0001-2 RRID: AB_1107632 |
| InVivoMAb anti-human CD28 (clone 9.3) | BioXcell | Cat# BE0248 RRID: AB_2687729 |
| Live/Dead v506 | eBioscience/ThermoFisher | Cat#65-0866-14 |
| Live/Dead eF780 | eBioscience/ThermoFisher | Cat#65-0865-18 |
| Nile Red | Thermofisher Scientific | Cat#N1142 |
|
| ||
| Biological Samples | ||
|
| ||
| Human peripheral blood | EFS | N/A |
|
| ||
| Chemicals, Peptides, and Recombinant Proteins | ||
|
| ||
| Dimethyl α-ketoglutarate | Sigma-Aldrich | Cat#349631 |
| Dimethyl-[13C5]-α-Ketoglutarate | RTI International /NIH | N/A |
| Diethylsuccinate | Sigma-Aldrich | Cat#112402 |
| Cholesterol-Water Soluble | Sigma-Aldrich | Cat#C4951 |
| Dimethyl malonate 98% | Sigma-Aldrich | Cat#13644 |
| 3-Nitropropionic acid | Sigma-Aldrich | Cat# N5636 |
| PF-06424439 | Sigma-Aldrich | Cat#PZ0233 |
| A922500 | Sigma-Aldrich | Cat# A1737 |
| 13C5-Glutamine | Cambridge Isotope Laboratories | Cat#CNLM-1275-H-0.1 |
| 13C6-Glucose | Sigma-Aldrich | Cat#389374 |
| Di-4-AN(F)EPPTEA | Gift from Dr. Leslie Loew and then from Potentiometric Probes | Potentiometric Probes |
| Oligomycin | Sigma-Aldrich | Cat#O4876 |
| FCCP | Sigma-Aldrich | Cat#C2920 |
| Rotenone | Sigma-Aldrich | Cat#R8875 |
| Antimycin A | Sigma-Aldrich | Cat#A8674 |
| DMSO | Sigma-Aldrich | Cat#D2650 |
| Phorbol 12-myristate 13-acetate | Sigma-Aldrich | Cat#P8139 |
| Ionomycin | Sigma-Aldrich | Cat#I0634 |
| Brefeldin A | Sigma-Aldrich | Cat#B7651 |
| Murine recombinant IL12 | R&D Systems | Cat#419-ML |
| Human recombinant TGF-β1 | R&D Systems | Cat#240-B |
| ProLeukin IL-2 « Clinical grade reagent » | https://base-donnees-publique.medicaments.gouv.fr/affichageDoc.php?specid=61637983&typedoc=N | N/A |
| DNASE I | Roche (Sigma-Aldrich) | Cat#10104159001 |
| Collagenase IV | Roche (Sigma-Aldrich) | Cat#C4-28 |
| RPMI 1640 medium | Eurobio scientific | Cat#CM1RPM08-01 |
| Dulbecco’s phosphate buffered saline (PBS) | Eurobio scientific | Cat#CS1PBS01-01 |
| RPMI glutamax | Life Technologies/ThermoFisher | Cat#61870036 |
| RPMI w/o glutamine and glucose | Pan Biotech | Cat#P04-17550 |
| Penicillin/streptomycin | GIBCO-Life technologies | Cat#15140-122 |
| β-mercaptoethanol | Sigma-Aldrich | Cat#M3148 |
| FCS Eurobio scientific | Eurobio scientific | Cat# CVFSVF00-01 |
| FCS Pan Biotech | Pan Biotech | Cat# P30-5500 |
| Seahorse XF RPMI Assay Medium | Agilent Technologies | Cat#103576-100 |
| Seahorse XF Calibrant Solution | Agilent Technologies | Cat#100840-000 |
| Agilent XFe96 Extracellular Flux Assay cartridges | Agilent Technologies | Cat#102416-100 |
| Poly-D-lysine | Merck-Sigma Aldrich | Cat# Α−003-E |
| Ultima Gold liquid scintillation cocktail | Perkin Elmer | Cat#6013329 |
|
| ||
| Commercial Assays | ||
|
| ||
| CD4+ T Cell Isolation Kit, mouse | Miltenyi Biotec | Cat#130-104-454 |
| RosetteSep Human CD4+ T Cell Enrichment Cocktail |
StemCell Technologies Inc | Cat# 15062 |
| RNeasy Mini kit | QIAGEN | Cat# 74104 |
| QuantiTect™ Reverse Transcription Kit | QIAGEN | Cat# 205311 |
| QuantiTect SYBR green PCR Master mix | Roche | Cat# 04887352001 |
| Qubit® RNA HS Assay Kit | Thermo Fisher Scientific | Cat# Q32852 |
| Agilent RNA 6000 Nano kit | Agilent Technologies | Cat# 5067-1512 |
| Agilent High Sensitivity DNA Kit | Agilent Technologies | Cat# 5067-4626 |
| ERCC ExFold RNA Spike-In Mix 1 | Life Technologies | Cat# 4456740 |
| TruSeq® Stranded mRNA Library Prep for NeoPrepTM kit | Illumina | Cat# NP-202-1001 |
| Quant-iT PicoGreen dsDNA Assay Kit | Thermo Fisher Scientific | Cat# P7589 |
| Nanopore Ligation Sequencing kit | Oxford Nanopore Technology | Cat#SQK-LSK109 |
| Native barcode expansion kit | Oxford Nanopore Technology | Cat#EXP-NBD104 |
| CBA Flex Set mIFNγ | BD Biosciences | Cat#558296 RRID: AB_2869141 |
| BD CBA Flex Set mTNF | BD Biosciences | Cat#558299 RRID: AB_2869144 |
| BD CBA Flex Set mIL-17A | BD Biosciences | Cat#560283 RRID: AB_2869329 |
| BD CBA Flex Set mGM-CSF | BD Biosciences | Cat#558347 RRID: AB_2869171 |
| Mouse/Rat Soluble Protein Master Buffer Kit | BD Biosciences | Cat#558266 RRID: AB_2869126 |
| Fix/perm kit: BD Cytofix:Cytoperm Fixation: Permeabilization Kit | BD Biosciences | Cat#554714 RRID: AB_2869008 |
| Fix/perm kit: eBioscience FOXP3 /Transcription Factor staining buffer set |
eBioscience/ThermoFisher | Cat# 00-5523-00 |
|
| ||
| Experimental Models: Cell Lines | ||
|
| ||
| 24JK-ERB | P. Darcy/ M. Kershaw | (Yong et al., 2016) |
|
| ||
| Experimental Models: Organisms/Strains | ||
|
| ||
| C57BL/6J | Charles River | Cat# 632C57BL/6J |
| Ly5.1-C57BL/6J | Charles River | Cat# 494C57BL/6J-Ly5.1 |
| FoxP3.GFP reporter mouse line | B. Malissen | (Wang et al., 2008) |
| RAG2 KO- C57BL/6J | E. Verhoeyen | (Hao and Rajewsky, 2001) |
| ERBB2-CAR Tg | P. Darcy/ M. Kershaw | (Yong et al., 2015) |
|
| ||
| Oligonucleotides | ||
|
| ||
| FoxP3 (foxp3) Forward 5′- GGCCCTTCTCCAGGACAGΑ- 3′ |
IDT | Custom order |
| FoxP3 (foxp3) Reverse 5′- GCTGATCATGGCTGGGTTGT- 3′ |
IDT | Custom order |
| IFNγ (IFNγ) Forward 5′- TGGCTCTGCAGGATTTTCATG- 3′ |
IDT | Custom order |
| IFNγ (IFNγ Reverse 5′- TCAAGTGGCATAGATGTGGAAGAΑ- 3′ |
IDT | Custom order |
| Tbet (tbx21) Forward 5′-CAACAACCCCTTTGCCAAAG −3′ |
IDT | Custom order |
| Tbet (tbx21) Reverse 5′-TCCCCCAAGCAGTTGACAGT −3′ |
IDT | Custom order |
| GM-CSF (csf2) Forward 5′-TTTACTTTTCCTGGGCATTG-3′ |
IDT | Custom order |
| GM-CSF (csf2) Reverse 5′-TAGCTGGCTGTCATGTTCAA-3′ |
IDT | Custom order |
| TNF (tnf) Forward 5′-CATCTTCTCAAAATTCGAGTGACAΑ−3′ |
IDT | Custom order |
| TNF (tnf) Reverse 5′-GGGAGTAGACAAGGTACAACCC-3′ |
IDT | Custom order |
| GZMB (gzmb) Forward 5′-TGCTGACCTTGTCTCTGGCC-3′ |
IDT | Custom order |
| GZMB (gzmb) Reverse 5′-TAGTCTGGGTGGGGAATGCΑ−3′ |
IDT | Custom order |
| HPRT (hprt) Forward 5′-CTGGTGAAAAGGACCTCTCG-3′ |
IDT | Custom order |
| HPRT (hprt) Reverse 5′-TGAAGTACTCATTATAGTCAAGGGCΑ−3′ |
IDT | Custom order |
| ABCG1 (abcg1) Forward 5′-CTTTCCTACTCTGTACCCGAGG-3′ |
IDT | Custom order |
| ABCG1 (abcg1) Reverse 5′- CGGGGCATTCCATTGATAAGG-3′ |
IDT | Custom order |
| ABCA1 (abca1) Forward 5′- AAAACCGCAGACATCCTTCAG-3′ |
IDT | Custom order |
| ABCA1 (abca1) Reverse 5′- CATACCGAAACTCGTTCACCC-3′ |
IDT | Custom order |
| Cas9-crRNA guides: see Table S7 | IDT | Custom order |
|
| ||
| Software and Algorithms | ||
|
| ||
| FlowJo (version 10) | BD Biosciences | https://www.flowjo.com/ |
| Prism (version 8) | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ |
| Wave (version 2) | Agilent Technologies | https://www.agilent.com/en/product/cell-analysis/real-time-cell-metabolic-analysis/xf-software/seahorse-wave-desktop-software-740897 |
| Agilent ATP Assay Report Generator | Agilent Technologies | https://www.agilent.com/en/products/cell-analysis/xf-real-time-atp-rate-assay-report-generator?productURL=https%3A%2F%2Fwww.agilent.com%2Fen%2Fproduct%2Fcell-analysis%2Freal-time-cell-metabolic-analysis%2Fxf-software%2Fseahorse-xf-real-time-atp-rate-assay-report-generators-740902 |
| Xcalibur 2.2 | ThermoFisher | https://assets.thermofisher.com/TFS-Assets/CMD/Product-Guides/Xcalibur-2-2-SP1-Release-Notes.pdf |
| LCquan 2.7 | ThermoFisher | https://assets.thermofisher.com/TFS-Assets/CMD/manuals/LCquan-Admin-2-7.pdf |
| TraceFinder 4.1 | ThermoFisher | https://www.thermofisher.com/fr/fr/home/industrial/mass-spectrometry/liquid-chromatography-massspectrometry-lc-ms/lc-ms-software/lc-ms-data-acquisition-software/tracefinder-software.html |
| FCAP Array V3.0.1 | BD Biosciences | Cat#655100 https://www.bdbiosciences.com/en-us/products/instruments/software-informatics/instrument-software/fcap-array-software-v3-0.652099 |
| WebGestalt (WEΒ-based GEne SeT AnaLysis Toolkit) |
WebGestalt | http://www.webgestalt.org |
| GSEA | Broad Institute | https://www.gsea-msigdb.org/gsea/index.jsp |
| STAR (version 2.5.2a) | Encode/Stanford University | https://github.com/alexdobin/STAR/releases/tag/2.5.2a |
| BioConductor | (Huber et al., 2015) | https://www.bioconductor.org |
| Megalodon | (Liu et al., 2021) | https://github.com/nanoporetech/megalodon |
| ImageJ (with custom GP plugin) | NIH | https://imagej.nih.gov/ij/download.html |