| Primary antibodies and dyes flow cytometry |
|
| CD45-APCCy7 |
Biolegend |
RRID: AB_312981 |
| CD45-PE |
Biolegend |
RRID: AB_2563598 |
| CD45-BUV563 |
BD Bioscience |
RRID: AB_2870209 |
| CD45-AF700 |
Biolegend |
RRID: AB_493715 |
| CD45.2-APC |
Biolegend |
RRID: AB_389211 |
| CD45.1-Biotin |
Biolegend |
RRID: AB_313493 |
| CD11b-PECy7 |
Biolegend |
RRID: AB_312799 |
| CD11b-BV421 |
Biolegend |
RRID: AB_10897942 |
| CD11b-APCCy7 |
Biolegend |
RRID: AB_830642 |
| CD11b-BB515 |
BD Biosciences |
RRID: AB_2665392 |
| CD11b-APC |
Biolegend |
RRID: AB_312795 |
| CD11b-PerCPCy5.5 |
Biolegend |
RRID: AB_2129374 |
| CD11c-APCCy7 |
Biolegend |
RRID: AB_830649 |
| CD11c-BV421 |
Biolegend |
RRID: AB_10897814 |
| CD11c-PECy7 |
Biolegend |
RRID: AB_493568 |
| Ly6C-FITC |
Biolegend |
RRID: AB_1186135 |
| Ly6C-PE |
Biolegend |
RRID: AB_1186132 |
| Ly6C-APCCy7 |
Biolegend |
RRID: AB_10640120 |
| Ly6G-FITC |
Biolegend |
RRID: AB_1236494 |
| Ly6G-APC |
Biolegend |
RRID: AB_2227348 |
| Gr-1-PerCPCy5.5 |
Biolegend |
RRID: AB_893557 |
| NK1.1-FITC |
Biolegend |
RRID: AB_313393 |
| NK1.1-PerCPCy5.5 |
Biolegend |
RRID: AB_2132707 |
| CD43-FITC |
Biolegend |
RRID: AB_10960745 |
| CD43- PerCPCy5.5 |
Biolegend |
RRID: AB_2286556 |
| CD44-FITC |
Biolegend |
RRID: AB_312957 |
| CD44-PE |
Biolegend |
RRID: AB_312959 |
| F4/80-APC |
Biolegend |
RRID: AB_2832549 |
| F4/80-Biotin |
Biolegend |
RRID: AB_893501 |
| F4/80-BV605 |
Biolegend |
RRID: AB_2562305 |
| CX3CR1-PECy7 |
Biolegend |
RRID: AB_2565700 |
| CX3CR1-APC |
Biolegend |
RRID: AB_2564492 |
| MERTK-BV421 |
Biolegend |
RRID: AB_2832533 |
| I-A/I-E(MHC-M)-PECy7 |
Biolegend |
RRID: AB_313327 |
| I-A/I-E(MHC-II)-BV650 |
Biolegend |
RRID: AB_2565975 |
| I-A/I-E(MHC-II)-BUV805 |
BD Biosciences |
RRID: AB_2873247 |
| Siglec-F-APC |
Biolegend |
RRID: AB_2750237 |
| CD115-BV421 |
Biolegend |
RRID: AB_2562667 |
| CD206-AF488 |
Biolegend |
RRID: AB_10900445 |
| CD207-PECy7 |
Biolegend |
RRID: AB_2876490 |
| FOLR2-APC |
Biolegend |
RRID: AB_2721313 |
| FOLR2-PE |
Biolegend |
RRID: AB_2721344 |
| CD38-PECy7 |
Biolegend |
RRID: AB_2275531 |
| CD64-PE |
Biolegend |
RRID: AB_10612740 |
| TMEM119-PE |
Invitrogen |
RRID: AB_2848262 |
| P2RY12-Biotin |
Biolegend |
RRID: AB_2749906 |
| cKit-BB515 |
BD Biosciences |
RRID: AB_2738826 |
| CD93-APC |
Biolegend |
RRID: AB_2275868 |
| EpCAM-BV711 |
Biolegend |
RRID: AB_2632775 |
|
| Primary antibodies immunofluorescence |
|
| Rabbit Iba1 |
Cell signaling |
RRID: AB_2820254 |
| Rabbit CD206 |
Cell signaling |
RRID: AB_2892682 |
| Rat CD206-AF488 |
Biolegend |
RRID: AB_10900445 |
| Rat MHC2-AF647 |
Biolegend |
RRID: AB_493526 |
| Rat EpCAM-AF647 |
Biolegend |
RRID: AB_1134104 |
| Rat CD38-AF647 |
Biolegend |
RRID: AB_2073334 |
| Mouse GFAP-AF594 |
Cell signaling |
RRID: AB_10998775 |
| Mouse GFAP-AF488 |
Invitrogen |
RRID: AB_10598515 |
| Rabbit CRYBB1 |
Cell signaling |
Cat# 95666 |
| Rabbit Olig2 |
MilliporeSigma |
RRID: AB_570666 |
| Mouse APC(CC-1) |
MilliporeSigma |
RRID: AB_2057371 |
| Mouse NeuN-AF488 |
MilliporeSigma |
RRID: AB_2149209 |
| Rat CD45-AF488 |
Biolegend |
RRID: AB_493531 |
| Rat CD45-AF647 |
Biolegend |
RRID: AB_2876569 |
| Rat CD34-eFluor 660 |
Invitrogen |
RRID: AB_10596826 |
| Rat GFP-AF488 |
Biolegend |
RRID: AB_2563288 |
|
| Secondary antibodies immunofluorescence |
|
| Donkey anti-rat IgG AF647 |
Life technologies |
RRID: AB_2896338 |
| Chicken anti-rat IgG AF488 |
Life technologies |
RRID: AB_2535873 |
| Donkey anti-rabbit IgG AF647 |
Life technologies |
RRID: AB_2536183 |
| Donkey anti-rabbit IgG AF488 |
Life technologies |
RRID: AB_2535792 |
| Donkey anti-rabbit IgG AF555 |
Life technologies |
RRID: AB_162543 |
| Goat anti-mouse IgG AF555 |
Life technologies |
RRID: AB_2535844 |
| Goat anti-mouse IgG1 AF488 |
Life technologies |
RRID: AB_2535764 |
|
| Chemicals, peptides, and recombinant proteins |
|
| EDTA |
Corning |
Cat# 46-034-Cl |
| Triton X-100 |
Sigma |
Cat# T8787 |
| Tween 20 |
Fisher Bioreagents |
Cat# BP337 |
| Paraformaldehyde 32% |
Electron Microscopy Science |
Cat# 15714-S |
| NP-40 Substitute |
Sigma |
Cat# 74385 |
| 5% Digitonin |
Thermo Fisher |
Cat# BN2006 |
| DL-Dithiothreitol solution (DTT) |
Sigma |
Cat# 646563 |
| RNase inhibitor |
Promega |
Cat# N2515 |
| 4’,6-Diamidino-2-Phenylindole, Dihydrochloride (DAPI) |
Sigma |
Cat# D9542 |
| Tris-HCl (pH 7.4) |
Sigma |
Cat# T2194 |
| NaCl |
Sigma |
Cat# 59222C |
| MgCl2 |
Sigma |
Cat# M1028 |
| Tamoxifen diet (500 mg tamoxifen/Kg chow) |
Envigo |
Cat# TD.130857 |
| Streptavidin BV421 |
Biolegend |
Cat# 405225 |
| Streptavidin AF488 |
Biolegend |
Cat# 405235 |
| Zombie Aqua Fixable Viability Kit |
Biolegend |
Cat# 423102 |
| 2.4G2 CD16/32 Fc block from 197 hybridomas |
ATCC |
Cat# HB-197 |
|
| Critical commercial assays |
|
| Chromium Next GEM Single Cell 3’ Kit v3.1 |
10× Genomics |
PN-1000268 |
| Chromium Next GEM Chip G Single Cell Kit |
10× Genomics |
PN-1000120 |
| Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Bundle |
10× Genomics |
PN-1000283 |
| Chromium Next GEM Chip J Single Cell Kit |
10× Genomics |
PN-1000234 |
| Single Index Kit N Set A |
10× Genomics |
PN-1000212 |
| Dual Index Kit TT Set A |
10× Genomics |
PN-1000215 |
| NovaSeq6000 |
Illumina |
S4 Flow Cell |
|
| Deposited data |
|
| Single cell transcriptomic and ATAC sequencing data |
This paper |
GEO: GSE213020
|
|
| Experimental models: Organisms/strains |
|
|
C57BL/6J mice |
Jackson laboratory |
JAX:000664 |
|
Flt3-Cre mice |
Benz et al.54
|
MGI: 4462354 |
|
Rosa26-STOP-EYFP mice (Ai2) |
Madisen et al.91
|
JAX:007920 |
|
Rosa26-STOP-tdTomato mice (Ai14) |
Madisen et al.91
|
JAX: 007908 |
| Smad4-flox mice |
Yang et al.92
|
JAX: 017462 |
|
Lyz2-CreEr2 mice |
Canli et al.57
|
JAX: 032291 |
|
Nur77GFP mice |
Zikherman et al.93
|
MMRRC: 012015 |
|
Zbtb46GFP mice |
Satpathy et al.43
|
JAX: 027618 |
|
Crybb1 knock-out mice |
This paper |
Colonna F2-12-3-13 |
|
Crybb1-tdTomato mice |
This paper |
Colonna F2-13-2-7 |
|
Crybb1-Cre mice
|
This paper |
Colonna F2-13-2-6 |
|
| Oligonucleotides |
|
|
Crybb1 gRNA exon1: AGCACCAGGAACCATGTCCCNGG |
This paper |
N/A |
|
Crybb1 gRNAs exon3: GTGACCGGCTCATGTCCTTCNGG; GTGGGTACTCGCCCTTCTCCNGG |
This paper |
N/A |
|
Crybb1-Cre Fwd. primer: AGACAATAGCAGGCATGCTGG |
This paper |
N/A |
|
Crybb1-Cre Rev. primer: GGATCAGTACAGCCCAGCTC |
This paper |
N/A |
|
Crybb1 knock-out Fwd. primer: GGGTGGCCTTTGAGCAATCT |
This paper |
N/A |
|
Crybb1 knock-out Rev. primer: ACGTCACATCTTCCCCCAAA. |
This paper |
N/A |
|
| Software and algorithms |
|
| Cell Ranger v2.0.0 and v6.0.0 |
10× Genomics |
https://support.10xgenomics.com/single-cell-gene-expression/software/overview/welcome
|
| R project 4.1.3 |
http://www.r-project.org/
|
RRID: SCR_001905 |
| Rstudio |
https://posit.co
|
RRID: SCR_000432 |
| Seurat v4.1.1 |
Hao et al.94
|
RRID: SCR_007322 |
| ArchR v1.0.1 |
Granja et al.95
|
http://www.archrproject.com/
|
| Deposited algorithms |
This paper |
https://doi.org/10.5281/zenodo.7558104
|
| ImageJ/Fiji |
Schneider et al.96
|
RRID: SCR_002285 |
| Imaris V8.3 |
Bitplane |
RRID: SCR_007370 |
| ANY-maze Video Tracking Software |
Stoelting |
RRID: SCR_014289 |
|
| Other |
|
| PBS |
Corning |
Cat# 21-040-CM |
| DMEM |
Gibco |
Cat# 11965-084 |
| RPMI |
Sigma |
Cat# R8758 |
| HBSS |
Gibco |
Cat# 14185-052 |
| HEPES |
Corning |
Cat# 25-060-Cl |
| Bovine calf serum (BCS) |
Cytiva |
Cat# SH30072.04 |
| BSA |
Rockland |
Cat# BSA-1000 |
| 10X red blood cells (RBC) lysis buffer |
Biolegend |
Cat# 420302 |
| Percoll |
GE Healthcare |
Cat# 17089101 |
| Collagenase-D |
Sigma |
Cat# 11088882001 |
| Collagenase-II |
Gibco |
Cat# 17101015 |
| Collagenase-IV |
Sigma |
Cat# C4-22-1G |
| Liberase TM |
Sigma |
Cat# 5401127001 |
| Hyaluronidase |
Sigma |
Cat# H1115000 |
| Dispase-II |
Gibco |
Cat# 17105-041 |
| DNase-I |
Sigma |
Cat# 10104159001 |
| Tomato-lectin Dylight 649 |
Vector Laboratories |
Cat# DL-1178 |
| Tomato-lectin Dylight 488 |
Vector Laboratories |
Cat# DL-1174-1 |
| Superfrost glass slides |
Fisher Scientific |
Cat# 12-550-15 |
| Prolong Glass anti-fade mounting media |
Thermo Fisher |
Cat# P36980
|
| Fluoromount-G mounting media |
SouthernBiotech |
Cat# 0100-01 |
| Nuclei Buffer |
10× Genomics |
PN-2000207 |
| Ultra-Pure BSA |
Thermo Fisher |
Cat# AM2616 |
| Nuclease-free water |
Invitrogen |
Cat# AM9937 |
