Reagent/Resource | Reference or Source | Identifier or Catalog Number |
---|---|---|
Experimental Models | ||
wt (Arabidopsis thaliana) | Col‐0 | |
wt (Chlamydomonas reinhardtii) | Li et al (2016) | CC‐4533 |
uba5 (Chlamydomonas reinhardtii) | Li et al (2019) | Cre13.g582350 |
ufl1 (Chlamydomonas reinhardtii) | Li et al (2019) | Cre16.g686650 |
ire1 (Chlamydomonas reinhardtii) | Li et al (2019) | Cre08.g371052 |
c53 (Arabidopsis thaliana) | Stephani et al (2020) | At5g06830 |
pUbi::C53‐mCherry × GFP‐ATG8A/c53 (Arabidopsis thaliana) | This study | N/A |
pUbi::C53sAIM(W276A, W287A, Y304A, W335A)‐mCherry × GFP‐ATG8A/c53 (Arabidopsis thaliana) | This study | N/A |
pUbi::C53cAIM(IDWD274WDDI, IDWD285WDDI, IDWD333WDDI)‐mCherry × GFP‐ATG8A/c53 (Arabidopsis thaliana) | This study | N/A |
Arabidopsis thaliana: pUbi::C53‐GFP × c53 (Arabidopsis thaliana) | Stephani et al (2020) | N/A |
pUbi::C53sAIM(W276A, W287A, Y304A, W335A)‐GFP × c53 (Arabidopsis thaliana) | Stephani et al (2020) | N/A |
pUbi::C53cAIM(IDWD274WDDI, IDWD285WDDI, IDWD333WDDI)‐GFP × c53 (Arabidopsis thaliana) | This study | N/A |
Recombinant DNA | ||
E. coli: Destination (expression) vector | Stephani et al (2020) | N/A |
E. coli: GST‐ATG8A | Stephani et al (2020) | N/A |
E. coli: GST‐ATG8ALDS(YL50AA) | Stephani et al (2020) | N/A |
E. coli: GST‐GABARAP | Stephani et al (2020) | N/A |
E. coli: GST‐CrATG8 | This study | N/A |
E. coli: GST‐CrUFM1 | This study | N/A |
E. coli: HIS6‐CrC53 | This study | N/A |
E. coli: MBP‐CrC53 | This study | N/A |
E. coli: GST‐AtUFM1 | Stephani et al (2020) | N/A |
E. coli: GST‐HsUFM1 | This study | N/A |
E. coli: MBP‐AtC53 | Stephani et al (2020) | N/A |
E. coli: MBP‐AtC53IDR(239‐372) | Stephani et al (2020) | N/A |
E. coli: MBP‐AtC53ΔIDR(1‐239,(KGSGSTSGSG)2,373‐549) | Stephani et al (2020) | N/A |
E. coli: MBP‐HsC53 | Stephani et al (2020) | N/A |
E. coli: MBP‐HsC53IDR(263‐316) | Stephani et al (2020) | N/A |
E. coli: MBP‐HsC53ΔIDR(1‐262, (KGSGSTSGSG),317‐506) | Stephani et al (2020) | N/A |
E. coli: MBP‐AtC531A (W276A) | Stephani et al (2020) | N/A |
E. coli: MBP‐AtC532A (W287A) | Stephani et al (2020) | N/A |
E. coli: MBP‐AtC533A (W335A) | Stephani et al (2020) | N/A |
E. coli: MBP‐AtC5312A (W276A, W287A) | Stephani et al (2020) | N/A |
E. coli: MBP‐AtC5313A (W276A, W335A) | Stephani et al (2020) | N/A |
E. coli: MBP‐AtC53 23A (W287A, W335A) | Stephani et al (2020) | N/A |
E. coli: MBP‐AtC53123A(W276A, W287A, W335A) | Stephani et al (2020) | N/A |
E. coli: MBP‐AtC53sAIM(Y304A, W276A, W287A, W335A) | Stephani et al (2020) | N/A |
E. coli: MBP‐HsC53sAIM(W269A, W294A, W312A) | Stephani et al (2020) | N/A |
E. coli: MBP | Stephani et al (2020) | N/A |
E. coli: HIS6‐GABARAP | Stephani et al (2020) | N/A |
E. coli: HIS6‐AtC53 | Stephani et al (2020) | N/A |
E. coli: mCh‐AtC53 sAIM (Y304A, W276A, W287A, W335A) | This study | N/A |
E. coli: mCh‐HsC53 sAIM(W269A, W294A, W312A) | This study | N/A |
E. coli: mCh‐AtC53 | This study | N/A |
E. coli: mCh‐HsC53 | This study | N/A |
E. coli: GST | Stephani et al (2020) | N/A |
E. coli: mCherry | This study | N/A |
E. coli: MBP‐ E. coli: AtC53cAIM(IDWD274WDDI, IDWD285WDDI, IDWD333WDDI) | This study | N/A |
E. coli: MBP‐HsC53cAIM(IDWG267WDGI, IDWG292WDGI, IDWG310WDGI) | This study | N/A |
E. coli: mCh‐AtC53cAIM(IDWD274WDDI, IDWD285WDDI, IDWD333WDDI) | This study | N/A |
E. coli: mCh‐HsC53cAIM(IDWG267WDGI, IDWG292WDGI, IDWG310WDGI) | This study | N/A |
E. coli: HIS6‐HsC53 | Stephani et al (2020) | N/A |
E. coli: HIS6‐HsUFM1 | Stephani et al (2020) | N/A |
E. coli: HIS6‐AtUFM1 | Stephani et al (2020) | N/A |
E. coli: MBP‐PfC53 | This study | N/A |
E. coli: MBP‐AcC53 | This study | N/A |
E. coli: HIS6‐MBP‐3C‐AtC53 IDR (264‐341) | This study | N/A |
E. coli: HIS6‐MBP‐3C‐AtC53 IDR1A (W276A) (264‐341) | This study | N/A |
E. coli: HIS6‐MBP‐3C‐AtC53 IDR2A (W287A) (264‐341) | This study | N/A |
E. coli: HIS6‐3C‐GABARAP | This study | N/A |
E. coli: HIS6‐3C‐ATG8A | This study | N/A |
E. coli: HIS6‐3C‐AtUFM1 | This study | N/A |
E. coli: HIS6‐3C‐HsUFM1 | This study | N/A |
E. coli: HIS6‐MBP‐3C‐HsC53 IDR (263‐316) | This study | N/A |
pUbi::C53sAIM(W276A, W287A, Y304A, W335A)‐mCherry | This study | N/A |
pUbi::C53cAIM(IDWD274WDDI, IDWD285WDDI, IDWD333WDDI)‐mCherry | This study | N/A |
pUbi::C53cAIM(IDWD274WDDI, IDWD285WDDI, IDWD333WDDI)‐GFP | This study | N/A |
pUbi::C53‐mCherry | Stephani et al (2020) | N/A |
pUbi::C53‐GFP | Stephani et al (2020) | N/A |
pUbi::C53sAIM(W276A, W287A, Y304A, W335A)‐GFP | Stephani et al (2020) | N/A |
Antibodies | ||
Goat anti‐rabbit IgG HRP‐Conjugate (1:10K) | Biorad | 1706515 |
Goat anti‐mouse IgG‐HRP Conjugate (1:10K) | Biorad | 1706516 |
Rabbit anti‐mCherry (1:5K) | Abcam | ab167453 |
Goat anti‐GST HRP Conjugate (1:1K) | GE Healthcare | RPN1236 |
Rabbit anti‐GFP (1:3K) | Invitrogen | A11122 |
Mouse anti‐GFP (1:3K) | Roche | 11814460001 |
Mouse anti‐MBP (1:3K) | Sigma Aldrich | M1321‐200UL |
Rabbit anti‐ATG8A (1:1K) | Agrisera | AS14 2811 |
Rabbit anti‐C53 (1:5K) | Stephani et al (2020) | N/A |
Rabbit anti‐AtUFM1 (1:3K) | This study | N/A |
Rabbit anti‐HsUFM1 (1:3K) | Abcam | Ab109305 |
Oligonucleotides and other sequence‐based reagents | ||
Chlamydomonas reinhardtii primer: E3_P1 | This study | AGAGCTCCTGCATACCCTGA |
Chlamydomonas reinhardtii primer: E3_E1_SR | This study | CCGAGGAGAAACTGGCCTT |
Chlamydomonas reinhardtii primer: E3_E1_oMJ | This study | CAGGCCATGTGAGAGTTTGC |
Chlamydomonas reinhardtii primer: E3_P2 | This study | CTCCTCAATGAGTGTGGCAA |
Chlamydomonas reinhardtii primer: E1_P2 | This study | CACACGGACATGACTGGAAC |
Chlamydomonas reinhardtii primer: E1_P1 | This study | AGAGTTACGGCCGCAGATT |
Chemicals, enzymes and other reagents | ||
E. coli: DH5α | In‐house facility | N/A |
E. coli: Rosetta2 (DE3) pLysS | In‐house facility | N/A |
A. tumefaciens: GV3101 (pSoup) | In‐house facility | N/A |
cAIM wt peptide | Synthetized in house | EPLDFDWEIVLEEEM |
cAIM mutant peptide | Synthetized in house | EPLDFDAEIALEEEM |
AtUBA5 LIR peptide | Synthetized in house | GPLHDDNEWNISVVDD |
HsUBA5 LIR peptide | Synthetized in house | EIIHEDNEWGIELVSE |
Tunicamycin | SCBT | sc‐3506 |
DTT | Sigma Aldrich | 43815 |
Concanamycin‐A (conA) | Santa Cruz | sc‐202111A |
Gamborg B5 vitamin mixture 1000X | Duchefa | G0415.0250 |
Gamborg B5 medium (microsalt mixture) | Duchefa | M0302.0025 |
Gamborg B5 medium (including vitamins) | Duchefa | G0210.0010 |
Gamborg B5 medium (basal salt mixture) | Duchefa | G0209.0050 |
Murashige & Skoog vitamin mixture 1000X | Duchefa | M0409.0250 |
Murashige & Skoog micro salt mixture | Duchefa | M0301.0050 |
Murashige & Skoog macro salt mixture | Duchefa | M0305.0050 |
Murshige & Skoog Basal salt mixture with MES | Duchefa | M0254.0050 |
Murashige & Skoog without nitrogen | Caisson labs | MSP07 |
MES monohydrate | Applichem | A1074 |
Puromycin | Sigma Aldrich | P8833 |
L‐Glutamine | Sigma Aldrich | G7513 |
M9 Minimal media | In‐house facility | N/A |
Ammonium‐15N chloride | Sigma Aldrich | 39466‐62‐1 |
D‐Glucose (U‐13C6, 99%) | Cambridge Isotope Laboratories, Inc. | 110187‐42‐3 |
Thamine hydrochloride | Sigma Aldrich | T1270 |
Biotin | Sigma Aldrich | B4639 |
Choline chloride | Alfa Aesar | A15828 |
Folic acid | Acros Organics | 21663 |
Niacinamide | Sigma Aldrich | N3376 |
D‐Pantothenic acid hemicalcium salt | Sigma Aldrich | P2250 |
Pyridoxal hydrochloride | Alfa Aesar | A17855 |
(‐)‐Riboflavin | Sigma Aldrich | R4500 |
Ethylenedinitrilotetraacetic acid disodium salt dihydrate | Merck | 108454 |
Iron (III) chloride hexahydrate Fe (III)Cl3 ·6H2O | Merck | 103943 |
Zinc chloride ZnCl2 | Merck | 108816 |
Copper (II) chloride dihydrate Cu (II)Cl2 ·2H2O |
Sigma Aldrich | 221783 |
Cobalt (II) chloride hexahydrate Co (II)Cl2 ·6H2O |
Sigma Aldrich | S2644 |
Boric acid | Sigma Aldrich | B6768 |
Manganese (II) chloride tetrahydrate Mn (II)Cl2 ·4H2O |
Sigma Aldrich | M3634 |
GFP‐Trap | Chromotek | Gta‐20 |
Glutathion Sepharose 4 B | Cytiva | 17‐5132‐01 |
Pierce™ Glutathione Magnetic Agarose Beads | Thermo Scientific™ | 78601 |
HisTrap FF 5 ml | Cytiva | 17525501 |
HisTrap FF 1 ml | Cytiva | 17531901 |
Resource Q 6 ml | Cytiva | 17117901 |
Resource S 6 ml | Cytiva | 17118001 |
HiPrep 26/10 Desalting | Cytiva | 17508701 |
HiLoad 16/600 Superdex 75 pg | Cytiva | 28989333 |
HiLoad 16/600 Superdex 200 pg | Cytiva | 28989335 |
GFP‐Trap Magnetic Agarose | Chromotek | Gtma‐20 |
Protein A Agarose | Sigma | P2545 |
Software | ||
CLC main work bench 7 | Qiagen | N/A |
Zen Software | Carl Zeiss | N/A |
Image J (Fiji) | NIH | N/A |
Image Lab | BioRad | N/A |
iBright analysis software | Invitrogen | N/A |
Adobe Illustrator 2022 | Adobe Inc. | N/A |
RStudio 2021.09.2+382 "Ghost Orchid" Release; R version 4.1.2 | RStudio; The R Foundation for Statistical Computing | N/A |
TopSpin3.2 | Bruker | N/A |
CcpNmr3.0 | Continuum Analytics, Inc. | N/A |