Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (M. musculus) | immortalized podocytes | This paper; PMID:33340991 |
Cell line established and maintained in Fornoni lab | |
| Cell line (M. musculus) | immortalized tubular cells | This paper | Cell line established and maintained in Fornoni lab | |
| Genetic reagent (M. musculus) | CBA/CaxC57BL/10-H-2Kb-tsA58 | Charles River; (PMID:1711218) |
||
| Genetic reagent (M. musculus) | 129-Col4a3tm1Dec/J | Jackson Laboratory | Strain# 002908 RRID:IMSR_JAX:002908 |
|
| Antibody | anti-WT1 (rabbit polyclonal) | Santa Cruz Biotechnology | Cat# sc-192 RRID:AB_632611 |
1:300 (IF) |
| Antibody | anti-SGLT2 (mouse monoclonal) | Santa Cruz Biotechnology | Cat# sc-21537 RRID:AB_2814658 |
1:100 (IHC) 1:500 (WB) |
| Antibody | anti-SGLT2 (rabbit polyclonal) |
BiCell scientific | Cat# 20802 RRID:AB_2935905 |
1:100 (IF) |
| Antibody | anti-SYNAPTOPODIN (goat polyclonal) | Santa Cruz Biotechnology | Cat# sc-21537 RRID:AB_2201166 |
1:300 (IF) 1:1,000 (WB) |
| Antibody | anti-AQP1 (rabbit polyclonal) | Proteintech | Cat# 20333–1-AP RRID:AB_10666159 |
1:2,000 (WB) |
| Antibody | anti-CPT1A (mouse monoclonal) |
Abcam | Cat# ab128568 RRID:AB_11141632 |
1:1,000 (WB) |
| Antibody | anti-GAPDH (mouse monoclonal) |
Sigma-Aldrich | Cat# CB1001 RRID:AB_2107426 |
1:10,000 (WB) |
| Sequence-based reagent | Sglt2_F | This paper | PCR primers | ATGGAGCAACACGTAGAGGC |
| Sequence-based reagent | Sglt2_R | This paper | PCR primers | ATGACCAGCAGGAAATAGGCA |
| Sequence-based reagent | Gapdh_F | This paper | PCR primers | CCTGGAGAAACCTGCCAAGTATG |
| Sequence-based reagent | Gapdh_R | This paper | PCR primers | GGTCCTCAGTGTAGCCCAAGATG |
| Sequence-based reagent | siRNA: Sglt2 | Santa Cruz Biotechnology | Cat# sc-61540 | 20 nM |
| Sequence-based reagent | siRNA: nontargetin control | Thermo Scientific | Cat# 4390843 | 20 nM |
| Commercial kit | ApoTox-Glo Triplex assay | Promega | Cat# G6320 | |
| Commercial kit | Amplex Red Cholesterol Assay | Thermo Scientific | Cat# A12216 | |
| Commercial kit | Triglyceride Colorimetric Assay | Cayman | Cat# 10010303 | |
| Chemical compound, drug | Empagliflozin (BI 10773) | Selleckchem | Cat# S8022 | 500 nM |
| Software, algorithm | Graphpad Prism | Graphpad software | SCR_002798 |