FIG. 1.

Schematic representation of the PCR primer binding sites in the bmp chromosomal region. The sequence of this region was created on the basis of sequences of bmpD from B. burgdorferi JD1 (accession no. U35450) (17) and bmpC, -A, and -B genes from B. burgdorferi 297 (accession no. U49938) (2) using the program Primer 3 Output (Center for Genome Research). Position 1 corresponds to nucleotide 396706, and position 5000 corresponds to nucleotide 391707 on the B. burgdorferi B31 chromosomal map (6). The relative locations of primer binding sites are indicated by arrows. W primer pairs are for amplification of the entire indicated coding sequence, and P primer pairs are for amplification of partial regions of the indicated coding sequence. All primers with the suffix (+) are plus-strand primers, and those with the suffix (−) are minus-strand primers (i.e., reverse complement of the gene sequences). Primer sequences (5′→3′) for the indicated regions were as follows. bmpD: 7(+), GAATGGCTGAAGCAAATAAAGC(W); 8(−), CAAATCAGCTCAATAAAAATC (W); 19(+), CTGATGATGGCAAGTCGGAG(P); 20(−), ACGCCTATACCAGAAAGCCC (P). bmpC: 15(+), GGCAAGGGCATATGTTTAAAAGATTTATTTTTATTA (W); 16(−), CGCAGATCTCCCCTTTACAAACAAAGC (W); 1(+), GATGAGGCAATGACTGAGGA (P); 2(−), GCAGCGTCATAAACTCCAAGACC (P). bmpA: 9(+), TGTAAAGGGGAAATAGTTTATG (W); 10(−), TTCAAACAAAACCAATGTG (W); 21(+), CCAAGGTTGCGGCTCTTC (P); 22(−), CTTCTACCAGCTTCAAGGTCAG (P). bmpB: 11(+), AAACACATTGGTTTTGTTTG (W); 12(−), TCTTTCTATTTCAAAAGTTTATAAC (W); 23(+), TGGTGATGATGTTCAGATTCC (P); 24(−), TTTGCTGCCTCAATAACACC (P). bmpD to bmpC: 3(+), AGGCCGCAAAAGAGTTGGG; 4(−), GCTACCATGAGCCAAAACACC. bmpC to bmpA: 5(+), TGATCGGGGGTTAAAGGAAGG; 6(−), TGAAGAGCCGCAACCTTGGC. bmpA to bmpB: 13(+), GGCCTTAAAGAAGGAGTTGTGGG; 14(−), CCAAATCAAGTCTGAGCC.