Skip to main content
. Author manuscript; available in PMC: 2024 May 18.
Published in final edited form as: Mol Cell. 2023 Apr 18:S1097-2765(23)00239-3. doi: 10.1016/j.molcel.2023.03.026

Key resources table.

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
PA28α Antibody Cell Signaling Tech Cat#: 2408S; RRID:AB_2170937
PA28β Antibody Cell Signaling Tech Cat#: 2409S; RRID:AB_2171085
Monoclonal ANTI-FLAG® M2 antibody produced in mouse Sigma-Aldrich Cat#: F1804-200UG; RRID:AB_262044
HA-Tag (C29F4) Rabbit mAb Cell Signaling Tech Cat#: 3724S; RRID:AB_1549585
HA-Tag (6E2) Mouse mAb Cell Signaling Tech Cat#: 2367S; RRID:AB_10691311
Vinculin (E1E9V) XP® Rabbit mAb Cell Signaling Tech Cat#: 13901S; RRID:AB_2728768
GAPDH (14C10) Rabbit mAb Cell Signaling Tech Cat#: 2118S; RRID:AB_561053
DDX42 polyclonal antibody rabbit Bethyl Laboratories Cat#: 303-353A; RRID:AB_10951853
Anti-β-Actin Antibody (C4) Santa Cruz Biotechnology Cat#: sc-47778; RRID:AB_626632
β-Actin (13E5) Rabbit mAb Cell Signaling Tech Cat#: 4970S; RRID:AB_2223172
SF3B1 (D7L5T) Rabbit mAb Cell Signaling Tech Cat#: 14434S; RRID:AB_2798479
p27 Kip1 (D69C12) XP® Rabbit mAb Cell Signaling Tech Cat#: 3686S; RRID:AB_2077850
Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Tech Cat#: 7074S; RRID:AB_2099233
Anti-mouse IgG, HRP-linked Antibody Cell Signaling Tech Cat#: 7076S; RRID:AB_330924
rabbit anti-goat IgG-HRP Santa Cruz Biotechnology Cat#: sc-2768; RRID:AB_656964
InVivoMAb anti-human MHC Class I (HLA-A, HLA-B, HLA-C) Clone: W6/32 BioXCell Cat#: BE0079; RRID:AB_1107730
IRDye® 680RD Goat anti-Rabbit IgG Secondary Antibody VWR Cat#: 926-68071; RRID:AB_10956166
IRDye® 800CW Goat anti-Rabbit IgG Secondary Antibody VWR Cat#: 925-32211; RRID:AB_2651127
IRDye® 680RD Goat anti-Mouse IgG Secondary Antibody VWR Cat#: 926-68070; RRID:AB_10956588
IRDye® 800CW Goat anti-Mouse IgG Secondary Antibody VWR Cat#: 926-32210; RRID:AB_621842
PE anti-mouse H-2Kb/H-2Db Antibody BioLegend Cat#: 114608; RRID:AB_313599
PE Mouse IgG2a, κ Isotype Ctrl Antibody BioLegend Cat#: 400211; RRID:AB_326460
APC anti-mouse H-2Kb bound to SIINFEKL Antibody BioLegend Cat#: 141606; RRID:AB_11219595
APC Mouse IgG1, κ Isotype Ctrl Antibody BioLegend Cat#: 400120; RRID:AB_2888687
APC/Cyanine7 Mouse IgG1, κ Isotype Ctrl Antibody BioLegend Cat#: 400128; RRID:AB_2892538
Bacterial and virus strains
NEB 5-alpha Competent E. coli (High Efficiency) New England Biolabs Cat#: C2987H
Chemicals, peptides, and recombinant proteins
MEM Non-Essential Amino Acids Solution (100X) Thermo Scientific Cat#: 11140050
Lipofectamine 2000 Transfection Reagent Thermo Scientific Cat#: 11668019
Polybrene Santa Cruz Biotechnology Cat#: sc-134220A
Geneticin Selective Antibiotic (G418 Sulfate) Thermo Scientific Cat#: 10131035
Pladienolide B Tocris Bioscience Cat#: 60-705-00U
Desthiobiotin polyethyleneoxide iodoacetamide Santa Cruz Biotechnology Cat#: sc-300424
Tetramethylrhodamine (TAMRA) azide Synthesized in-house N/A
Biotin-PEG4-azide ChemPep Cat#: 271606
SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Scientific Cat#: 34580
Novex 4-20% Tris-Glycine Mini Gels Invitrogen Cat#: XP04205BOX
Nitrocellulose western blotting membrane, 0.45 μM GE Healthcare Amersham Cat#: 10600002
Affi-Gel 10 Gel Bio-rad Cat#: 1536046
DMSO Corning Cat#: 25-950-CQC
EDTA (0.5M, pH 8.0) Invitrogen Cat#: AM9260G
Urea Fisher Scientific Cat#: M1084871000
Iodoacetamide Sigma-Aldrich Cat#: I1149-25G
Dithiothreitol (DTT) Fisher Bioreagents Cat#: BP172-25
T ris(benzyltriazolylmethyl)amine (TBTA) TCI Cat#: T2993
Copper(II) sulfate, anhydrous Sigma-Aldrich Cat#: 451657-10G
Tris(2-carboxyethyl)phosphine HCl (TCEP) Sigma-Aldrich Cat#: 75259
Sequencing grade modified trypsin Promega Cat#: V5111
Lysyl Endopeptidase, Mass Spectrometry Grade (Lys-C) Fujifilm Wako Cat#: 125-05061
Streptavidin agarose resin Fisher Scientific Cat#: 20349
Micro bio-spin column Bio-rad Cat#: 7326204
Tween 20 Fisher Bioreagents Cat#: BP337-500
Nonidet P40 substitute (Igepal CA-630) USB Corporation Cat#: 19628
Triethylammonium bicarbonate (TEAB) buffer Sigma-Aldrich Cat#: T7408-500ML
TMT10plex Isobaric Label Reagent Set Thermo Scientific Cat#: 90406
TMT16plex Isobaric Label Reagent Set Thermo Scientific Cat#: A44520
Hydroxylamine solution Sigma-Aldrich Cat#: 467804-10ML
Formic acid, ~98%, for mass spectrometry Honeywell Fluka Cat#: 94318-250ML-F
Critical commercial assays
CellTiter-Glo® Luminescent Cell Viability Assay Promega Cat#: G7573
Caspase-Glo® 3/7 Assay System Promega Cat#: G8093
NEBNext Ultra II RNA Library Prep Kit for Illumina New England Biolabs Cat#: E7770
RNeasy Mini Plus Kits QIAGEN Cat#: 74034
eBioscience Fixable Viability Dye eFluor 780 Invitrogen Cat#: 65-0865-18; N/A
Deposited data
All raw proteomic data have been uploaded to PRIDE This study PXD029655
All RNA-sequencing data have been uploaded to GEO This study GSE185373, GSE220185, GSE220845
All uncropped gels have been uploaded to Mendeley Data This study DOI: 10.17632/r6t9f3n9wr.1
Experimental models: Cell lines
22Rv1 ATCC CRL-2505; RRID:CVCL_1045
MCF7 ATCC HTB-22; RRID:CVCL_0031
Ramos ATCC CRL-1596; RRID:CVCL_0597
THP1 ATCC TIB-202; RRID:CVCL_0006
HEK293T ATCC CRL-3216; RRID:CVCL_0063
HEK293FT Thermo Scientific R70007; RRID:CVCL_6911
KBM7 Georg Winter, CeMM, Vienna RRID:CVCL_A426
HCT-116 ATCC CCL-247; RRID:CVCL_0291
Panc 04.03 ATCC CRL-2555; RRID:CVCL_1636
Panc 05.04 ATCC CRL-2557; RRID:CVCL_1637
E.G7-Ova ATCC CRL-2113; RRID:CVCL_3505
Oligonucleotides
sgDDX42_N_sense 5’-CACCGattcctaacaggtcagtcat This study N/A
sgDDX42_N_anti 5’-AAACatgactgacctgttaggaatC This study N/A
RepDDX42N_1_P_F 5’-gcgttacatagcatcgtacgcgtacgtgtttggcttattcctaacaggtcagtatgaccgagtacaagcccacg This study N/A
RepDDX42N_1_P_R 5’-agcattctagagcatcgtaCGCGTACGTGTTTGGtccagttcatggtgccaatgGAagatccgccgccacc This study N/A
DDX42_N_seqF 5’-gcccttggggctatacacttt This study N/A
DDX42_N_seqR 5’-ccagcactgatggcaaaacc This study N/A
sgPSME1_sense 5’-CACCGccagcccgaggcccaagcca This study N/A
sgPSME2_sense 5’ CACCGaaatccagagacttacctcc This study N/A
sgControl-AAVS1_sense 5’-caccgGGGGCCACTAGGGACAGGAT This study N/A
Recombinant DNA
pLenti3.3/TR Thermo Scientific A11144
psPAX2.0 Addgene 12260
CMV VSV-G Addgene 98286
pLenti6.3 Thermo Scientific A11144
pLEX304 Addgene 25890
Software and algorithms
PRISM Version 9.0.0 GraphPad https://www.graphpad.com/features
MaxQuant (v2.0.3.1) N/A https://www.maxquant.org/
Integrated Proteomics Pipeline (IP2) Integrated Proteomics Applications, Inc http://proteomicswiki.com/wiki/index.php/IP2
FlowJo (v10.0.7) TreeStar Inc. https://www.flowjo.com/
edgeR (v3.32.1) Robinson et al., 2010 https://bioconductor.org/packages/release/bioc/html/edgeR.html
DESeq2 (v1.30.1) Love et al., 2014 https://bioconductor.org/packages/release/bioc/html/DESeq2.html
limma voom (v3.46.0) Law et al., 2014 https://bioconductor.org/packages/release/bioc/html/limma.html
ImageJ NIH https://imagej.nih.gov/ij/download.html
PyMOL (v2.5.2) Schrödinger https://pymol.org/2/
Trim_galore (v0.6.4) Martin et al., 2011 https://github.com/FelixKrueger/TrimGalore
STAR (v2.7.5) Dobin et al., 2013 https://github.com/alexdobin/STAR/
samtools (v1.9) Danecek et al., 2021 http://www.htslib.org/
bamCoverage (part of the Deeptools package; v3.3.1) Ramírez et al., 2016 https://deeptools.readthedocs.io/en/develop/index.html
featureCounts (part of the subread package; v1.5.0) Liao et al., 2014 https://subread.sourceforge.net/
ChimeraX Pettersen et al., 2021 https://www.cgl.ucsf.edu/chimerax/
Glide Schrödinger https://www.schrodinger.com/products/glide
cutadapt 3.4 Martin et al., 2011 https://cutadapt.readthedocs.io/en/v3.4/#
rMATS (v4.1.1) Shen et al., 2014 https://rnaseq-mats.sourceforge.net/rmats4.1.1/index.html
Branchpointer Signal et al., 2018 https://github.com/signalbash/branchpointer
Skipper Boyle et al., 2022 https://github.com/YeoLab/skipper
skewer Jiang et al., 2014 https://github.com/relipmoc/skewer
fastp 0.11.5 Chen et al., 2018 https://github.com/OpenGene/fastp
UMIcollaps Liu et al., 2019 https://github.com/Daniel-Liu-c0deb0t/UMICollapse
Other