Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in this study
| Primer | 5′–3′ |
|---|---|
| AgSDH1-F | tctgccgctgagagaaaaga |
| AgSDH1-R | agtaagcacgtacggttgga |
| AgSDH2-F | agtcgatccagccatacctg |
| AgSDH2-R | gctcgttgttccaccagtac |
| AgGLR1-F | acttggttattggaggcgga |
| AgGLR1-R | tgctgatgtcgacttcctgt |
| AgILV2-F | gcatcgcggctcatcaatat |
| AgILV2-R | gcccagcatatctacggact |
