Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | U2OS | ATCC | HTB-96 | NA |
| Strain, strain background (Escherichia coli) | BL21(DE3) | Sigma-Aldrich | CMC0015 | Electrocompetent cells |
| Transfected construct (human) | siRNA to APEX1 (ON-TARGETplus SMARTpool) |
Dharmacon/Horizon Discovery Lts. and Li et al., 2022 | L-010237-00-0005 | Transfected construct (human) |
| Sequence-based reagent (oligonucleotides) | 70 nt FAM-ssDNA structure | This study and Lin et al., 2020 | Oligo#1 | FAM-5'-TCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGT-3' |
| Sequence-based reagent (oligonucleotides) | 60 nt Biotin-labeled top strand | This study | Oligo#2 | Biotin-5'-GGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGC-3' |
| Sequence-based reagent (oligonucleotides) | 10 nt top strand | This study | Oligo#3 | 5’-TGCAGGCATG-3' |
| Sequence-based reagent (oligonucleotides) | 100 nt bottom strand | This study | Oligo#4 | 5'-CATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCC- 3' |
| Sequence-based reagent (oligonucleotides) | 10 nt Biotin-labeled top strand | This study | Oligo#5 | Biotin-5'-GGGTAACGCC-3' |
| Sequence-based reagent (oligonucleotides) | 70 nt Biotin-ssDNA structure | This study | Oligo#6 | Bioin-5'- ACAGCTATGACCATGATTACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGA-3' |
| Sequence-based reagent (oligonucleotides) | 10 nt Biotin-ssDNA structure | This study and Ha et al., 2020 | Oligo#7 | Bioin-5'-GGTCGACTCT-3' |
| Sequence-based reagent (oligonucleotides) | 20nt Biotin-ssDNA structure | This study and Ha et al., 2020 | Oligo#8 | Bioin-5'- GGTCGACTCTAGAGGATCCC-3' |
| Sequence-based reagent (oligonucleotides) | 40 nt Biotin-ssDNA structure | This study and Ha et al., 2020 | Oligo#9 | Bioin-5'- GGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTC-3' |
| Sequence-based reagent (oligonucleotides) | 60 nt Biotin-ssDNA structure | This study and Ha et al., 2020 | Oligo#10 | Bioin-5'-GGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAAC-3' |
| Sequence-based reagent (oligonucleotides) | 80 nt Biotin-ssDNA structure | This study | Oligo#11 | Bioin-5'- GGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCT-3' |
| Antibody | Anti-Xenopus APE1 (Rabbit polyclonal) | Lin et al., 2020 | IB (1:2000) | |
| Antibody | Anti-Xenopus ATRIP (Rabbit polyclonal) | Willis et al., 2013 | IB (1:2000) | |
| Antibody | Anti-Xenopus RPA70 (Rabbit polyclonal) | Acevedo et al., 2016 | IB (1:5000) | |
| Antibody | Anti-Xenopus RPA32 (Rabbit polyclonal) | Acevedo et al., 2016 | IB (1:5000) | |
| Antibody | Anti-Chk1-P-S345 (Rabbit monoclonal) | Cell Signaling Technology | Cat#2348 | IB (1:2000) |
| Antibody | Anti-Chk1-P-S317 (Rabbit monoclonal) | Cell Signaling Technology | Cat#12302 | IB (1:1000) |
| Antibody | Anti-Chk1 (Mouse monoclonal) | Santa Cruz Biotechnology | Cat#sc-8408 | IB (1:2000) |
| Antibody | Anti-GST (Mouse monoclonal) | Santa Cruz Biotechnology | Cat#sc-138 | IB (1:5000) |
| Antibody | Anti-His (Mouse monoclonal) | Santa Cruz Biotechnology | Cat#sc-8036 | IB (1:1000) |
| Antibody | Anti-human APE1 (Mouse monoclonal) | Santa Cruz Biotechnology | Cat#sc-17774 | IB (1:2000) |
| Antibody | Anti-PCNA (Mouse monoclonal) | Santa Cruz Biotechnology | Cat#sc-56 | IB (1:4000) |