Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (human) | LINE-1 retinitis pigmentosa (L1RP; LINE-1; L1) | 10.1093/hmg/8.8.1557; 10.1016 /j.cell.2013.10.021; 10.7554/eLife.30094 | ||
| Gene (synthetic) | HaloTag | Promega | G7711 | |
| Gene (synthetic) | EGFP antisense intron retrotransposition reporter (GFP-AI) | 10.1093/nar/28.6.1418 | ||
| Gene (synthetic) | mNeonGreen2 (mNG2) | 10.1038 /s41467-017-00494-8 | ||
| Strain, strain background (Escherichia coli) | BL21(DE3) | Sigma-Aldrich | 69450 | Used for recombinant protein expression |
| Strain, strain background (Escherichia coli) | DH10B | Thermo Fisher Scientific | EC0113 | Used for molecular cloning |
| Cell line (human) | HeLa rtTA2S-M2 (HeLa M2) | 10.1093/nar/gkp108; 10.1016 /j.jmb.2006.10.009; 10.7554/eLife.30058 | RRID:CVCL_WN71 | Cells were routinely tested for mycoplasma and were negative. |
| Recombinant DNA reagent | L1 reporter construct with wild-type ORF1 (pLH2035; plasmid) | This paper | L1 reporter construct with wild-type ORF1-GGGGS-HaloTag and GFP-AI engineered into the L1RP sequence driven by a Tet-On promoter on a pCEP-puro episomal plasmid backb one |
|
| Recombinant DNA reagent | L1 reporter construct with wild-type ORF1 tagged with mNeonGreen2 (pLH2060; plasmid) | This paper | L1 reporter construct with wild-type ORF1- GGGGS-mNeonGreen2 engineered into the L1RP sequence driven by a Tet- On promoter on a pCEP-puro episomal plasmid backbone |
|
| Recombinant DNA reagent | L1 reporter construct with ORF1 K3A/K4A (pLH2042; plasmid) | This paper | pLH2035 with ORF1 mutations K3A and K4A | |
| Recombinant DNA reagent | L1 reporter construct with ORF1 R261A (pLH2043; plasmid) | This paper | pLH2035 with ORF1 mutation R261A | |
| Recombinant DNA reagent | L1 reporter construct with ORF1 StammerDel (pLH2040; plasmid) | This paper | pLH2035 with deletion of residues M91, E92, and L93 in ORF1 |
|
| Recombinant DNA reagent | L1 reporter construct with ORF1 StammerAAA (pLH2041; plasmid) | This paper | pLH2035 with ORF1 mutations M91A, E92A, and L93A |
|
| Recombinant DNA reagent | L1 reporter construct with ORF1 StammerAEA (pLH2046; plasmid) | This paper | pLH2035 with ORF1 mutations M91A and L93A | |
| Recombinant DNA reagent | Human ORF1p purification construct (pMT538; plasmid) | 10.1002/art.41054; 10.1016 /j.cell.2013.10.021 | Full length synthetic human ORF1p from ORFeusHS with an N-terminal HIS6-TEV sequence in a pETM11 backbone such that cleavage leaves only an N-glycine scar |
|
| Recombinant DNA reagent | Human ORF1p K3A/K4A purification construct (pLH2075; plasmid) | This paper | pMT538 with ORF1p mutations K3A and K4A | |
| Recombinant DNA reagent | Human ORF1p R261A purification construct (pLH2076; plasmid) | This paper | pMT538 with ORF1p mutation R261A | |
| Recombinant DNA reagent | Human ORF1p StammerAAA purification construct (pLH2037; plasmid) | This paper | pMT538 with ORF1 mutations M91A, E92A, and L93A |
|
| Recombinant DNA reagent | Human ORF1p StammerAEA purification construct (pLH2077; plasmid) | This paper | pMT538 with ORF1 mutations M91A and L93A | |
| Sequence-based reagent | T7_L1RP_F (oSS0133; forward primer for the amplicon used to generate IVT 2-kb L1 RNA) | This paper | PCR primers | TAATACGACTCACTATAGGGGCCGCTCTAGCCCTGGAAT |
| Sequence-based reagent | L1RP_R (oSS0121; reverse primer for the amplicon used to generate IVT 2-kb L1 RNA) | This paper | PCR primers | TGATTTTGCAGCGGCTGGTACCGGTTGTTCCTTTCCATGTTTAGCGCT |
| Commercial assay or kit | HaloTag Ligand JF549 | Promega | GA1111 | |
| Commercial assay or kit | HaloTag Ligand JF646 | Promega | GA1121 | |
| Commercial assay or kit | SiR-DNA | Cytoskeleton | CY-SC007 | |
| Chemical compound, drug | Hoechst 33342 | Thermo Fisher Scientific | 62249 | |
| Software, algorithm | NIS-Elements | Nikon | ||
| Software, algorithm | FlowJo | BD Biosciences | ||
| Software, algorithm | FIJI | 10.1038/nmeth.2019 | ||
| Software, algorithm | Prism 9 | GraphPad | ||
| Software, algorithm | RStudio | Posit |