Skip to main content
. 2023 Apr 28;12:e82991. doi: 10.7554/eLife.82991

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene (human) LINE-1 retinitis pigmentosa (L1RP; LINE-1; L1) 10.1093/hmg/8.8.1557; 10.1016 /j.cell.2013.10.021; 10.7554/eLife.30094
Gene (synthetic) HaloTag Promega G7711
Gene (synthetic) EGFP antisense intron retrotransposition reporter (GFP-AI) 10.1093/nar/28.6.1418
Gene (synthetic) mNeonGreen2 (mNG2) 10.1038 /s41467-017-00494-8
Strain, strain background (Escherichia coli) BL21(DE3) Sigma-Aldrich 69450 Used for recombinant protein expression
Strain, strain background (Escherichia coli) DH10B Thermo Fisher Scientific EC0113 Used for molecular cloning
Cell line (human) HeLa rtTA2S-M2 (HeLa M2) 10.1093/nar/gkp108; 10.1016 /j.jmb.2006.10.009; 10.7554/eLife.30058 RRID:CVCL_WN71 Cells were routinely tested for mycoplasma and were negative.
Recombinant DNA reagent L1 reporter construct with wild-type ORF1 (pLH2035; plasmid) This paper L1 reporter construct with wild-type ORF1-GGGGS-HaloTag
and GFP-AI engineered into the L1RP sequence driven
by a Tet-On promoter on a
pCEP-puro episomal plasmid backb one
Recombinant DNA reagent L1 reporter construct with wild-type ORF1 tagged with mNeonGreen2 (pLH2060; plasmid) This paper L1 reporter construct with wild-type ORF1-
GGGGS-mNeonGreen2 engineered
into the L1RP sequence driven by a Tet-
On promoter on a pCEP-puro episomal
plasmid backbone
Recombinant DNA reagent L1 reporter construct with ORF1 K3A/K4A (pLH2042; plasmid) This paper pLH2035 with ORF1 mutations K3A and K4A
Recombinant DNA reagent L1 reporter construct with ORF1 R261A (pLH2043; plasmid) This paper pLH2035 with ORF1 mutation R261A
Recombinant DNA reagent L1 reporter construct with ORF1 StammerDel (pLH2040; plasmid) This paper pLH2035 with deletion of residues M91,
E92, and L93 in ORF1
Recombinant DNA reagent L1 reporter construct with ORF1 StammerAAA (pLH2041; plasmid) This paper pLH2035 with ORF1 mutations M91A,
E92A, and L93A
Recombinant DNA reagent L1 reporter construct with ORF1 StammerAEA (pLH2046; plasmid) This paper pLH2035 with ORF1 mutations M91A and L93A
Recombinant DNA reagent Human ORF1p purification construct (pMT538; plasmid) 10.1002/art.41054; 10.1016 /j.cell.2013.10.021 Full length synthetic human ORF1p from
ORFeusHS with an N-terminal HIS6-TEV
sequence in a pETM11 backbone such
that cleavage leaves only an N-glycine scar
Recombinant DNA reagent Human ORF1p K3A/K4A purification construct (pLH2075; plasmid) This paper pMT538 with ORF1p mutations K3A and K4A
Recombinant DNA reagent Human ORF1p R261A purification construct (pLH2076; plasmid) This paper pMT538 with ORF1p mutation R261A
Recombinant DNA reagent Human ORF1p StammerAAA purification construct (pLH2037; plasmid) This paper pMT538 with ORF1 mutations M91A,
E92A, and L93A
Recombinant DNA reagent Human ORF1p StammerAEA purification construct (pLH2077; plasmid) This paper pMT538 with ORF1 mutations M91A and L93A
Sequence-based reagent T7_L1RP_F (oSS0133; forward primer for the amplicon used to generate IVT 2-kb L1 RNA) This paper PCR primers TAATACGACTCACTATAGGGGCCGCTCTAGCCCTGGAAT
Sequence-based reagent L1RP_R (oSS0121; reverse primer for the amplicon used to generate IVT 2-kb L1 RNA) This paper PCR primers TGATTTTGCAGCGGCTGGTACCGGTTGTTCCTTTCCATGTTTAGCGCT
Commercial assay or kit HaloTag Ligand JF549 Promega GA1111
Commercial assay or kit HaloTag Ligand JF646 Promega GA1121
Commercial assay or kit SiR-DNA Cytoskeleton CY-SC007
Chemical compound, drug Hoechst 33342 Thermo Fisher Scientific 62249
Software, algorithm NIS-Elements Nikon
Software, algorithm FlowJo BD Biosciences
Software, algorithm FIJI 10.1038/nmeth.2019
Software, algorithm Prism 9 GraphPad
Software, algorithm RStudio Posit