Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2023 May 24;18(5):e0281159. doi: 10.1371/journal.pone.0281159

Genomic architecture and evolutionary relationship of BA.2.75: A Centaurus subvariant of Omicron SARS-CoV-2

Atia Basheer 1,*, Imran Zahoor 1, Tahir Yaqub 2
Editor: Chandrabose Selvaraj3
PMCID: PMC10208454  PMID: 37224159

Abstract

In this study, we explored the genomic architecture and phylogenomic relationship of BA.2.75, a subvariant of Omicron SARS-CoV-2. A set of 1468 whole-genome sequences of BA.2.75, submitted by 28 countries worldwide were retrieved from GISAID and used for finding genomic mutations. Moreover, the phylogenetic analysis of BA.2.75 was performed by using 2948 whole-genome sequences of all sub-variants of Omicron along with the Delta variant of SAS-CoV-2. We detected 1885 mutations, which were further grouped into 1025 missense mutations, 740 silent mutations, 72 mutations in non-coding regions, 16 in-frame deletions, 02 in-frame insertions, 8 frameshift deletions, 8 frameshift insertions and 14 stop-gained variants. Additionally, we also found 11 characteristic mutations having a prevalence of 81–99% and were not observed in any of the previously reported variant of SARS-CoV-2. Out of these mutations K147E, W152R, F157L, E210V, V213G, G339H were found in the NTD, and G446S & N460K in the RBD region of the Spike protein, whereas S403L and T11A were present in the NSP3, and E protein respectively. The phylogenetic relationship of this variant revealed that BA.2.75 is descended from the Omicron sub-variant BA.5. This evolutionary relationship suggests that the surge of BA.5 infections can reduce the severity of the infections accredited to BA.2.75. These findings would also improve our knowledge and understanding that how genetic similarities in different variants of SARS-CoV-2 can prime the immune system to fight off the infection caused by one subvariant, after defeating the other.

Introduction

The Omicron variant of SARS-CoV-2 was first identified in Botswana, and South Africa in the early November 2021. On November 24, 2021, it was reported to the World Health Organization (WHO) and eventually declared as a variant of concern (VOC) on November 26, 2021 [1]. Though Omicron replicates about 70-times faster than the delta variant in the bronchi of infected individuals, but there are some evidences that it is less severe than previous strains/variants, especially when compared to the delta variant [2]. However, it continued to spread rapidly into multiple sub-lineages which differ significantly from the previously reported variants of SARS-CoV-2. From a global pandemic perspective, the Omicron variant has shown super transmissibility by rapidly replacing the Delta variant which had been the dominant epidemic variant in many countries until the end of 2021 [3]. And by August 8, 2022, over 2 million Omicron sequences had been submitted to GISAID which were further categorized into different sub-lineages, such as BA.1, BA.1.1, BA.2, BA.2.12.1, BA.2.3, BA.2.9, BA.3, BA.4, BA.5. and BA.2.75 [4]. These sub-lineages also exhibited distinct capabilities of transmission and immune evasion. However, since February 2022, BA.2, which appeared more transmissible has become the most dominant and transmissible strain in many countries, such as South Africa, United Kingdom and India by rapidly replacing BA.1 and BA.1.1 [5]. Likewise, BA.2.12.1 subvariant of Omicron SARS-CoV-2 also showed enhanced transmissibility and became the dominant variant in United States in the early months of 2022 [3].

Moreover, the BA.2.75, first detected in India, is an emerging sub-lineage of the Omicron variant which has also been reported from a large number of countries, worldwide. Its rapid spread and transmission are being monitored by the WHO and CDC, jointly [6]; and it has been unofficially declared as a Centaurus variant [7]. As emergence of this variant is a very recent development, so comprehensive information about it is not available. However, according to the available information, the symptoms of this subvariant are very similar to that of the common cold, and it has very high transmissibility [8].

The SARS-CoV-2 is constantly mutating and leading to the emergence of new variants which are usually more contagious than Wuhan-Hu-1 [9, 10]. However, the likelihood of high or low severity of different variant varies which make it hard to predict their ultimate consequences. According to the latest statistics, the newly emerged sub-lineage Omicron BA.2.75 has become the dominant variant globally [11]. It has multiple mutations in the Spike protein which perhaps enhance its transmissibility and infectivity by enabling it to bind more efficiently to the host cell receptors. It is further speculated that the mutations of BA.2.75 may reduce the abilities of the antibodies to bind or neutralize the virus. Hence, there are growing concerns that this virus can spread very quickly by evading the immunity produced through vaccination or prior infections [3]. Hence, there is an urgent need to explore and understand the genomic architecture of BA.2.75 not only to find out its characteristic mutations which differentiate it from other sub-variants but also to figure out some pathways to initiate the host immune response and develop some protective immunity against it.

Methods

For this study, whole-genome sequences of 1675 global samples of BA.2.75 subvariant of Omicron SARS-CoV-2 were retrieved from GISAID (Global Initiative on Sharing Avian Influenza Data) [12], on 8th August 2022. The first genome of BA.2.75 sub-variant of Omicron SARS-CoV-2 was submitted to GISAID in May 2022, and up till 8th August 2022, 1675 cases of this variant had been sequenced and submitted to GISAID. These sequences were submitted to GISAID by the 28 countries including India (1127), USA (78), Singapore (42), Japan (37), United Kingdom (32), Canada (31), Australia (26), Nepal (16), Denmark (13), Israel (11), Austria (9), Indonesia (8), New Zeeland (6), Germany (6), Luxembourg (4), South Korea (4), France (4), Thailand (2). Italy (2), Peru (2), Chile (1), Martinique (1), Turkey (1), Slovakia (1), Cambodia (1), China (1) and Slovenia (1). The retrieved genomic sequences were aligned through MAFFT (v7.480) by using L-INS-I alignment and setting data type as nucleic acids with a gap extended penalty of 0.123 and opening penalties of 1.53 [13]. The Wuhan-Hu-1 sequence (NC_045512.2) was used as a reference genome while aligning the sequence data. The alignment of the genomic sequences led to the removal of 207 low quality sequences and the resulting file was left with a set of 1468, high coverage, genomic sequences GISAID considers genomes with length of >29,000 nucleotides as complete and assigns them the high coverage label when there are less than 1% of undefined bases. For the remaining 1468 good quality genome sequences, all the relevant information including their unique identifiers, collection & submission date, and submitting lab information are shown in supplementary materials (S1 Table). The aligned and filtered sequence file was used as an input to the Coronapp web application to obtain the nucleotide variations [14]. All the mutations found in the structural, non-structural, and accessory proteins were mapped on the SARS-CoV-2 genome by using the Corona Antiviral Research Database (CoV-RDB) [15]. Additionally, the CoV-RDB [15] was also used for the comparison of BA.2.75 mutations with other sub-variants of Omicron SARS-CoV-2. The amino acid sequence of Spike protein was downloaded from the GenBank [16]. However, the three-dimensional (3D) structures of Spike protein used in this work was extracted from the Protein Data Bank (https://www.rcsb.org/), denoted as 6VYB, and its 3D-structured graph highlighting mutations was developed by using PyMOL [17].

For the construction of the phylogenetic tree, 2948 whole-genome sequences of different variants of SARS-CoV-2 retrieved from the GISAID database were used. And the phylogenetic tree was constructed by using the NextStrain’s Augur pipeline [18]. Sequences were again aligned to the SARS-CoV-2 reference genome (NC_045512.2) by using MAFFT [19] and a time-resolved phylogenetic tree was constructed with IQ-Tree [20] and TreeTime [21] under the generalized time reversible (GTR) substitution model [22] and was visualized with auspice [18].

Results

In total, we detected 1885 mutations, which were categorized as 1025 amino acids changing (missense) mutations, 740 silent mutations, 72 mutations in the non-coding regions, 16 in-frame deletions, 44 frameshift deletions, 2 in-frame insertions, 8 frameshift deletion, 8 frameshift insertions, and 10 stop-gained variants (Table 1, Fig 1). Out of these mutations, 605 were present in the ORF1ab which transcribes into 16 non-structural proteins (NSPs). However, among theORF1ab proteins, NSP3 had the largest number of missense (207) and silent mutations (165) (Table 1, Fig 2) which is also common with the mutation pattern of earlier reported variants of SARS-CoV-2 [23]. The second largest number of mutations, among the NSPs, were found in the NSP2 protein which had 79 missense and 41 silent mutations followed by RdRp protein (57 missense, 60 silent and 1 frameshift deletion) (Table 1, Fig 2). In case of NSP3 G489S, T241I, S403L, and T183I had 99% frequency while the prevalence of P822S mutation was 98% (Table 2). However, P314L, T492I and P132H mutations present in the RdRp, NSP4 and NSP5 protein respectively were the most common (100% prevalence) missense mutations which were present in all the global samples. Likewise, T1121I mutation in NSP15, R392C in Helicase, G662S in RdRp and L264F & L438F in NSP4 had 99% incidence globally. However, T327I in NSP4, N118S in NSP8, had 97% incidence while T19I in NSP9 had 95% incidence globally, whereas S106del in NSP6 had 72% prevalence (Table 2).

Table 1. Details of mutations found in different proteins of BA.2.75 variant of Omicron SARS-CoV-2.

Protein Missense Silent SNP Non-coding region Mutation In-frame Frameshift Stop gained Total
deletion Insertion Deletion Insertion
E 5 6 - - - - - - 11
M 23 29 - - - - - - 52
N 89 48 - 3 - - - 140
NSP1 26 14 - 4 - 1 - - 45
NSP2 79 41 - 1 - - - - 121
NSP3 207 165 - - - - - - 372
NSP4 46 34 - - - - - - 80
NSP5 19 32 - - - - - - 51
NSP6 26 21 - 1 - - - - 48
NSP7 2 10 - - - - - - 12
NSP8 11 13 - - - - - - 24
NSP9 10 13 - - - - - - 23
NSP10 7 7 - - - - - - 14
RdRp 54 60 - - - 1 - - 115
Helicase 37 39 - - - - - - 76
NSP14 41 29 - - - - - - 70
NSP15 19 16 - - - - - - 35
NSP16 21 11 - 2 - - - 1 35
ORF3a 51 25 - 1 - - - - 77
ORF6 11 9 - - - 1 - 5 26
ORF7a 24 7 - - - 1 - 1 33
ORF7b 8 3 - - - 1 2 2 16
ORF8 24 13 - 1 - 1 2 3 44
ORF10 5 2 - - - - - 1 8
S 180 93 - 3 2 2 4 1 285
5’UTR 0 0 33 - - - - - 33
3’UTR 0 0 39 - - - - - 39
Total 1025 740 72 16 2 8 8 14 1885
Open in a new tab

Fig 1. Stacked bar-chart of mutations percentages observed in different proteins of the BA.2.75 subvariant of Omicron SARS-CoV-2.

Fig 1

Open in a new tab

Fig 2. Pictorial view of 23 mutations present in the Non-structural proteins of BA.2.75 subvariant of Omicron SARS-CoV-2.

Fig 2

Open in a new tab

Table 2. Major mutations found in the genome of BA.2.75 variant of Omicron SARS-CoV-2.

Sr. No Genomic Change Protein Amino acid change Type of mutation Global %
1. 23403A>G S D614G Missense 100
2. 23525C>T S H655Y Missense 100
3. 23599T>G S N679K Missense 100
4. 23604C>A S P681H Missense 99
5. 25000C>T S D1146D Silent 99
6. 22577GG>CA S G339H Missense 99
7. 22775G>A S D405N Missense 97
8. 22331G>A S G257S Missense 97
9. 24469T>A S N969K Missense 97
10. 24424A>T S Q954H Missense 96
11. 23948G>T S D796Y Missense 96
12. 12741C>T S T19I Missense 95
13. 23854C>A S N764K Missense 95
14. 22942T>G S N460K Missense 94
15. 22786A>C S R408S Missense 93
16. 22898G>A S G446S Missense 93
17. 23013A>C S E484A Missense 92
18. 22992G>A S S477N Missense 92
19. 22882T>G S N440K Missense 92
20. 22995C>A S T478K Missense 92
21. 22190A>G S I210V Missense 92
22. 22200T>G S V213G Missense 92
23. 22674C>T S S371F Missense 91
24 23075T>C S Y505H Missense 91
25. 23063A>T S N501Y Missense 91
26 23055A>G S Q498R Missense 89
27. 22679T>C S S373P Missense 89
28. 22813G>T S K417N Missense 88
29. 22686C>T S S375F Missense 88
30. 22033C>A S F157L Missense 88
31. 22016T>C S W152R Missense 86
32. 22688A>G S T376A Missense 86
33. 22001A>G S K147E Missense 81
34. 21633TACCCCCTG S L24 Deletion 78
35. 21987G>A S G142D Missense 56
36. 23283A>T S D574V Missense 17
37. 22720A>G S K386K Silent 6
38. 21641G>T S A27S Missense 6
39. 27807C>T ORF7b L17L Silent 100
40. 27527C>T ORF7a P45L Missense 5
41. 27259A>C ORF6 M19M Silent 99
42. 27382GAT>CTC ORF6 D61L Missense 99
43. 25416C>T ORF3a F8F Silent 100
44. 26060C>T ORF3a T223I Missense 100
45. 2911T>C ORF3a T64T Silent 99
46. 12880C>T NSP9 I65I Silent 99
47. 12741C>T NSP9 T19I Missense 95
48. 12444A>G NSP8 N118S Missense 97
49. 12140A>G NSP8 T17A Missense 5
50. 11288TCTGGTTTT NSP6 S106 Deletion 72
51. 11296T>G NSP6 F108L Missense 14
52. 11224C>T NSP6 V84V Silent 9
53. 11288T>A NSP6 S106T Missense 6
54. 11291G>A NSP6 G107S Missense 6
55. 10449C>A NSP5 P132H Missense 100
56. 10447G>A NSP5 R131R Silent 100
57. 10198C>T NSP5 D48D Silent 95
58. 10029C>T NSP4 T492I Missense 100
59. 9344C>T NSP4 L264F Missense 99
60. 9866C>T NSP4 L438F Missense 99
61. 9424A>G NSP4 V290V Silent 98
62. 9534C>T NSP4 T327I Missense 97
63. 8937C>T NSP4 A128V Missense 2
64. 3037C>T NSP3 F106F Silent 99
65. 4184G>A NSP3 G489S Missense 99
66. 28344C>T NSP3 T24I Missense 99
67. 2911T>C NSP3 T64T Silent 99
68. 3927C>T NSP3 S403L Missense 99
69. 3796C>T NSP3 V359V Silent 99
70. 4321C>T NSP3 A534A Silent 98
71. 5183C>T NSP3 P822S Missense 98
72. 4586C>T NSP3 D622D Silent 76
73. 2710C>T NSP2 L635L Silent 3
74. 20055A>G NSP15 E145E Silent 99
75. 19955C>T NSP15 T112I Missense 99
76. 18163A>G NSP14 I42V Missense 99
77. 18583G>A NSP14 V182I Missense 24
78. 16887C>T NSP13 R392C Missense 99
79. 16887C>T NSP13 Y217Y Silent 3
80. 15714C>T NSP12b L749L Silent 100
81. 14408C>T NSP12b P314L Missense 100
82. 15451G>A NSP12b G662S Missense 99
83. 670T>G NSP1 S135R Missense 98
84. 28311C>T N P13L Missense 100
85. 28881GGG>AAC N RG203KR Missense 99
86. 28344C>T N T24I Missense 99
87. 29510A>C N S413R Missense 99
88. 28362GAGAACGCA N E31 Deletion 72
89. 28363A>T N G30G Silent 10
90. 28370A>G N S33G Missense 6
91. 28367C>T N R32C Missense 2
92. 26709G>A M A63T Missense 99
93. 26858C>T M F112F Silent 99
94. 26577C>G M Q19E Missense 94
95. 26612A>T M T30T Silent 4
96. 26270C>T E T9I Missense 100
97. 26275A>G E T11A Missense 99
98. 241C>T 5’UTR 241 extragenic 77
99. 44C>T 5’UTR 44 extragenic 6
100. 204G>A 5’UTR 204 extragenic 3
101. 28271A>T 3’UTR 28271 extragenic 100
102. 29734GAGGCCACGCGGAGTACGATCGAGTG 3’UTR 29734 extragenic 59
103. 29759G>C 3’UTR 29759 extragenic 6
Open in a new tab

(Frequency of mutation ≥ 0.02).

However, among all the proteins of BA.2.75 Omicron SARS-CoV-2, Spike protein had the second highest number of mutations (180 missense, 93 silent SNPs, 3 in-frame deletions, 2 in-frame insertions, 2 frameshift deletions, 4 frameshift insertions and 1 stop-gained variant) after NSP3 (Figs 3 & 4). The occurrence of second largest number of mutations in Spike protein, after NSP3, is in agreement with the mutations pattern of the previously reported variants of SARS-CoV-2 [23, 24]. In the Spike protein, 33 mutations had a prevalence of >80% (Table 2). Out of which three missense mutations including D614G, H655Y, N679K had 100% prevalence while P681H and G339H had 99% and D405N, G257S and N969K had 97% global frequency. Likewise, the frequency of Q954H and D796Y mutations was 96% and that of T19I and N764K was 95% (Table 2).

Fig 3. Pictorial view of 36 mutations presents in the different regions of the Spike protein of BA.2.75 Omicron SARS-CoV-2.

Fig 3

Open in a new tab

Fig 4. Amino acid residues changed in response to mutations in the Spike protein of BA.2.75 Omicron SARS-CoV-2.

Fig 4

Open in a new tab

Additionally, 12 mutations in the Spike proteins including N460K, R408S, G446S, E484A, S477N, N440K, T478K, I210V, V213G, S371F, Y505H and N501Y had 91–94% prevalence (Table 2). And the following 8 mutations Q498R, S373P, K417N, S375F, F157L, W152R, T376A, K147E had an incidence of 81–89%, whereas L24del (78%), G142D (56%), D574V (17%) and L24S, & A27S (6%) had low incidence, comparatively (Table 2). Moreover, all these mutations in the Spike protein were mapped on the SARS-CoV-2 genome (Fig 3).

The comparison of all of the mutations in the Spike protein of BA.2.75 with other sub-variants including BA.1, BA.1.1, BA.2, BA2.12.1, BA.3, BA4 and BA.5 of Omicron SARS-CoV-2 is given in Table 3. Our data revealed that 5 mutations including K147E(81%), W152R(86%), F157L(88%), I210V(92%), and G339H(99%) in the NTD region and G446S(93%) and N460K(94%) in the RBD region of S protein were present with high prevalence in BA2.75 subvariants, whereas these mutations were not reported earlier for any other variant of SAR-CoV-2 (Table 3). Among the other structural proteins T9I(E), P13L(N) and T2231I, T11A(ORF3a) had 100% incidence while T11A(E), A63T (M) and S413R, T24I, RG203KR(N) and D61L(ORF6) had 99% incidence, whereas Q19E(M) and an in-frame deletion E31del(N) had 94% and 72% incidence respectively.

Table 3. Comparison of mutations present in the Spike protein of BA.2.75 with other variants of Omicron SARS-CoV-2.

Region Amino acids in reference genome Position BA.2.75 BA.1 BA.1.1 BA.2 BA.2.12.1 BA.3 BA.4 BA.5
NTD T 19 I - - I - - I I
L 24 del - - - - - - -
A 27 S - - - - - - -
G 142 D D D D D D D D
K 147 E - - - - - - -
W 152 R - - - - - - -
F 157 L - - - - - - -
I 210 V - - - - - - -
V 213 G - - - G - - -
G 257 S - - - - - - -
G 339 H D D D D D D D
RBD S 371 F L L F F L F F
S 373 P p p p p p p p
S 375 F F F F F F F F
T 376 A - - A A - A A
D 405 N - - N N N N N
R 408 S - - S S - S S
K 417 N N N N N - N N
N 440 K K K K K K K K
G 446 S - - - - - - -
N 460 K - - - - - - -
S 477 N N N N N N N N
T 478 K K K K K K K K
E 484 A A A A A A A A
Q 498 R R R R R R R R
N 501 Y Y Y Y Y Y Y Y
Y 505 H H H H H H H H
D 574 V - - - - - - -
D 614 G G G G G G G G
SD2 H 655 Y Y Y Y Y Y Y Y
N 679 K K K K K K K K
S1/S2 P 681 H H H H H H H H
ACE2 N 764 K K K K K K K K
D 796 Y Y Y Y Y Y Y Y
HR1 Q 954 H H H H H H H H
N 969 K K K K K K K K
Open in a new tab

Evolutionary analysis

For the construction of phylogenomic tree, a set of 2948 genome sequences of different variants of SARS-CoV-2, collected between December 2019 and August 2022, was retrieved from GISAID. Phylogenomic tree was constructed in the Nextstrain (https://nextstrain.org/), which assign clade 22D to the lineage BA2.75, a sub-variant of Omicron SARS-CoV-2. Moreover, it is evident from the phylogeny analysis that BA.2.75 is very close to the lineage BA.2.12.1 (22C clade), a sub-lineage of BA.2 (Fig 5). These two lineages are further clustered with lineages BA.5 and BA.4 which represent the Nextstrain clade 22B, and 22A, respectively (Fig 5).

Fig 5. The global phylogeny of SARS-CoV-2 shows the evolutionary relationships of BA.2.75 (22D Omicron) Omicron with other variants of the virus.

Fig 5

Open in a new tab

This phylogenetic tree consisted of 2948 genomes of different variants of SARS-CoV-2 genome collected between December 2019 to August 2022.

Discussion

Here we present the mutations present in the genes/proteins and in the non-coding regions of BA.2.75; a subvariant of Omicron SARS-CoV2. And relate them with the in-vitro activity of authorized MAbs against the variants reported in this study based upon the published literature. In N-terminal domain of the Spike protein, 11 mutations including T19I, L24del, A27S, G142D, K147E, W152R, F157L, I210V, V213G, G257S, and G339H were observed. All of these mutations except T19I, L24del, and G142D and A27S have very high (>80%) prevalence due to which they are most likely to be the characteristic mutations of BA.2.75 and, additionally, they were only observed in BA.2.75 variant of Omicron SARS-CoV-2 (Table 3). However, the T19I (95%) mutations is also present in BA.2, BA.4 and BA.5 while G142D (56%) mutation is present in all other subvariants of Omicron SARS-CoV-2 (Table 3) [15]. Likewise, in the RBD region of the Spike protein, following 17 mutations S371S, S373P, S375F, D405N, K417N, N440K, S477N, T478K, E484A, Q498R, N501Y, Y505H and D574V were detected. Out of which following two missense mutations, G446S and N460K are only present in BA.2.75 subvariant with a frequency of 93% and 94% respectively, and, therefore, are most likely to be the characteristic mutations of this variant. However, determination of the extent to which the mutations in different variants of SARS-CoV-2 can reduce the monoclonal antibodies (MAbs) susceptibility is critical in the prevention and treatment of COVID-19 [25]. The G446S mutation in B.2.75 is reported to be associated in creating the high-level of resistance to imdevimab but not to cilgavimab [26].

In addition, D405N mutation (97% incidence) was also observed in the following Omicron variant BA.2, BA.4, and BA.5 (Table 3), and reported to reduce the susceptibility of these variants to etesevimab (16 to 26-fold) and casirivimab (11 to 14-fold) [3]. Four other missense mutations including N440K, E448A, S477N, and T478K which have 92% prevalence in BA.2.75 Omicron and are also known as the common RBD mutations. It is noteworthy that these mutations have a gradual increase in their prevalence since the start of the pandemic and are still present in all the Omicron SARS-CoV-2 variants (Table 3). Additionally, S371F, N501Y, and Y505H had 91% prevalence in BA.2.75, and are present in the RBD region of Spike protein. The S371F is an RBD core mutation which is also present in the Omicron BA.2, BA.4, and BA.5 variants. It had been reported to drastically reduced the susceptibility of these variants to etesevimab (143 to 630-fold), casirivimab (14 to 28-fold), imdevimab (11 to 126-fold), sotrovimab (5.5 to 21-fold), and tixagevimab (6.3 to 31-fold) [3]. However, the N501Y is present in alpha, beta, gamma, and all variant of Omicron SARS-CoV-2 and reported to mediate the viral entry by enhancing the binding ability of spike protein with ACE-2 receptors [27]. Likewise, S373P, T376A, K417N, and Q498R are present in the RBD region and had 88–89% prevalence in BA.2.75 and are present in all variant of omicron SARS-CoV-2 except K417N which is in RBM mutation and bind with ACE-2 and is also present in Beta, Gamma, and some other Omicron variants.

In addition to RBD mutation, D614G, H655Y and N679K in SD2 region had 100% prevalence while P681H mutation which was located proximal to the S1/S2 furin cleavage site had 99% incidence. The H655Y is involved in increasing the Spike protein cleavage and replication and it is present in Gamma and Omicron variants and many other lineages of SARS-CoV-2. And the D614G, and P681H are the among the preliminary mutations which are present in Alpha, Beta, and each of the Omicron variant [24, 28]. The increase in positive charge associated with this mutation is appeared to influence virus tropism by increasing S1/S2 cleavage in human airway epithelial cells [29]. Moreover, N764K, and D796Y in ACE2 region and Q954H, & N969K in HR1 region have 95–96% and 96–97% prevalence respectively and are known as the most frequent mutations in all the variants of Omicron SARS-CoV-2 [30, 31].

Among the non-structural proteins of BA.2.75 Omicron SARS-CoV-2, T24I, S403L, and G489S, in NSP3; T492I, L264F, L438F in NSP4; P132H in NSP5; P314L, G662S in RdRp protein; R392C in NSP13; I42V in NSP14; and T112I in NSP15 had 99–100% prevalence. However, we suggest G662S in RdRp and S403L in the NSP3 as the characteristic mutations of BA.2.75 Omicron SARS-CoV-2. It is also evident from the fact that their incidence in the global samples of BA.2.75 is 99% and secondly these mutations had not been observed in any other variant of SARS-CoV-2. Moreover, P314L of RdRp had 100% incidence in BA.2.75 and is located very close to the hydrophobic cleft of RdRp which is the target of some antiviral drugs like remdesivir and favipiravir [24, 32]. Hence, the occurrence of highly prevalent mutations in this region of RdRp suggest that this variant is likely to have resistance to various antiviral therapeutic agents. In addition to changing its sensitivity to antiviral drugs, this mutation might be involved in affecting the replication speed of the virus which is the basic function of the RdRp protein [33]. Further to the antiviral treatments, it has been reported that the vaccinated individuals who had suffered with some breakthrough infection from B.1, or B.5 had got protective level of (hybrid) immunity against BA.2.75 compared with those who were only vaccinated (3-doses), which shows high level of cross-immunity between B.1, B.5, and B.2.75 variants [34].

In case of accessory and other structural proteins (Fig 6), the T223I(ORF3a), P13L(N) and T9I(E) are the highly prevalent (100%) mutations in BA.2.75, and are also present in all variants of Omicron SARS-CoV2. Moreover, D614L(ORF6); RG203KR, T24I, S413R (N); and T11A(E) had 99% incidence in all the samples of BA.2.75 Omicron SARS-CoV-2. We also suggest T11A as the characteristic mutation of BA.2.75 of Omicron SARS-CoV2 as it is not observed in any other variant of SARS-CoV-2.

Fig 6. Pictorial view of 15 mutations presents in the structural and accessory proteins, except Spike, of BA.2.75 subvariant of Omicron SARS-CoV-2.

Fig 6

Open in a new tab

However, phylogeny analysis of the BA.2.75 showed its close relationship with BA.2.12.1, a sub-lineage of BA.2 and our results further revealed that BA.2.75 is descended from the earlier Omicron subvariant, BA.5. This evolutionary relationship of BA.2.75 with BA.5 is key finding in establishing that the surge of BA.5 infections or prior infection with BA.5 may reduce the severity of cases accredited to BA.2.75. This may lead to enhance our knowledge and understanding of the fact that these genetic similarities can prime the immune system to successfully fight-off with one of these subvariant, after defeating an infection from the other.

Conclusion

We discovered a total of 11 characteristics mutations for BA.2.75, including 9 mutations in the Spike protein, 2 in non-structural proteins, and 1 in the Envelop protein of BA.2.75. Out of these characteristic mutations K147E, W152R, F157L, I210V, V213G, G339H are present in the NTD; G446S and N460K in RBD; S403L in NSP3; G662S in RdRp and T11A in E protein. However, the phylogenetic analysis revealed that BA.2.75 is descended from BA.5, an Omicron sub-variant. This evolutionary link between BA.2.75 and BA.5 is critical in determining whether the surge of BA.5 infection will decrease the severity of cases caused by BA.2.75, suggesting that that the development of immunity and cross-protection between these two variants is also possible. Hence, it is also very likely that a single vaccine may be used to develop the protective level of immunity against both, BA.5 and BA.2.75.

Supporting information

S1 Table

(DOCX)

Click here for additional data file. (130.4KB, docx)

Acknowledgments

We acknowledge all the labs which submitted the genomic sequences of BA.2.75 on GISAID and at the same time we also acknowledge the work of the all the personnel who are maintaining the GISAID and managing all the data on it.

Data Availability

All relevant data are within the paper.

Funding Statement

The authors have so specific funding for this work.

References

  • 1.Mahase E. Covid-19: What do we know about omicron sublineages? BMJ. 2022:o358. doi: 10.1136/bmj.o358 [DOI] [PubMed] [Google Scholar]
  • 2.Miller NL, Clark T, Raman R, Sasisekharan R. Insights on the mutational landscape of the SARS-CoV-2 Omicron variant. bioRxiv: the preprint server for biology. 2021:2021.12.06.471499. doi: 10.1101/2021.12.06.471499 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Cao Y, Yisimayi A, Jian F, Song W, Xiao T, Wang L, et al. BA.2.12.1, BA.4 and BA.5 escape antibodies elicited by Omicron infection. Nature. 2022;608(7923):593–602. doi: 10.1038/s41586-022-04980-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Ai J, Wang X, He X, Zhao X, Zhang Y, Jiang Y, et al. Antibody Resistance of SARS-CoV-2 Omicron BA.1, BA.1.1, BA.2 and BA.3 Sub-lineages. Cold Spring Harbor Laboratory; 2022. [Google Scholar]
  • 5.Wang X, Ai J, Li X, Zhao X, Wu J, Zhang H, et al. Neutralization of Omicron BA.4/BA.5 and BA.2.75 by Booster Vaccination or BA.2 Breakthrough Infection Sera. Cold Spring Harbor Laboratory; 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Tan C-W, Lim B-L, Young BE, Yeoh AY-Y, Yung C-F, Yap W-C, et al. Comparative neutralisation profile of SARS-CoV-2 omicron subvariants BA.2.75 and BA.5. Lancet Microbe. 2022;3(12):e898–e. Epub 2022/08/10. doi: 10.1016/S2666-5247(22)00220-8 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Callaway E. Will ’Centaurus’ be the next global coronavirus variant? Indian cases offers clues. Nature. 2022;608(7923):462–3. Epub 2022/08/11. doi: 10.1038/d41586-022-02154-4 . [DOI] [PubMed] [Google Scholar]
  • 8.Wang Q, Iketani S, Li Z, Guo Y, Yeh AY, Liu M, et al. Antigenic characterization of the SARS-CoV-2 Omicron subvariant BA.2.75. Cold Spring Harbor Laboratory; 2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Galloway SE, Paul P, MacCannell D, Johansson M, Brooks J, MacNeil A, et al. Emergence of SARS-CoV-2 B.1.1.7 Lineage—United States, December 29, 2020—January 12, 2021. US Department of Health and Human Services/Centers for Disease Control and Prevention, Services UDoHaH; 2021 January 22, 2021. Report No. [Google Scholar]
  • 10.Li X, Giorgi EE, Marichannegowda MH, Foley B, Xiao C, Kong X-P, et al. Emergence of SARS-CoV-2 through recombination and strong purifying selection. Sci Adv. 2020;6(27):eabb9153. doi: 10.1126/sciadv.abb9153 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Health N. Omicron subvariant–BA.2.75 Available online: https://www.narayanahealth.org/blog/omicron-subvariant-ba-2-75/ 2022 [15 August 2022].
  • 12.Shu Y, McCauley J. GISAID: Global initiative on sharing all influenza data—from vision to reality. Euro surveill Bull Eur Mal Trans = Eur Commun Dis Bull. 2017;22(13):30494. doi: 10.2807/1560-7917.ES.2017.22.13.30494 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Basheer A, Zahoor I. Genomic epidemiology of SARS-CoV-2 divulge B.1, B.1.36, and B.1.1.7 as the most dominant lineages in first, second, and third wave of SARS-CoV-2 infections in Pakistan. Microorganisms. 2021;9(12). doi: 10.3390/microorganisms9122609 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Urhan A, Abeel T. Emergence of novel SARS-CoV-2 variants in the Netherlands. Scientific Reports. 2021;11(1):6625. doi: 10.1038/s41598-021-85363-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Tzou PL, Tao K, Pond SLK, Shafer RWJPo. Coronavirus Resistance Database (CoV-RDB): SARS-CoV-2 susceptibility to monoclonal antibodies, convalescent plasma, and plasma from vaccinated persons. PLoS ONE. 2022;17(3):e0261045. doi: 10.1371/journal.pone.0261045 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW. GenBank. Nucleic acids research. 2009;37(Database issue):D26–D31. Epub 2008/10/21. doi: 10.1093/nar/gkn723 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.DeLano WLJCNPC. Pymol: An open-source molecular graphics tool. 2002;40(1):82–92. [Google Scholar]
  • 18.Hadfield J, Megill C, Bell SM, Huddleston J, Potter B, Callender C, et al. Nextstrain: real-time tracking of pathogen evolution. Bioinformatics (Oxford, England). 2018;34(23):4121–3. doi: 10.1093/bioinformatics/bty407 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Katoh K, Toh H. Parallelization of the MAFFT multiple sequence alignment program. Bioinformatics (Oxford, England). 2010;26(15):1899–900. Epub 2010/04/28. doi: 10.1093/bioinformatics/btq224 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular biology and evolution. 2015;32(1):268–74. Epub 2014/11/03. doi: 10.1093/molbev/msu300 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sagulenko P, Puller V, Neher RA. TreeTime: maximum likelihood phylodynamic analysis. Cold Spring Harbor Laboratory; 2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nature methods. 2017;14(6):587–9. Epub 2017/05/08. doi: 10.1038/nmeth.4285 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Fiaz N, Zahoor I, Saima S, Basheer A. Genomic landscape of alpha-variant of SARS-CoV-2 circulated in Pakistan. PLoS One. 2022;17(12):e0276171. Epub 2022/12/14. doi: 10.1371/journal.pone.0276171 ; PubMed Central PMCID: PMC9746927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Koyama T, Platt D, Parida L. Variant analysis of SARS-CoV-2 genomes. Bulletin of the World Health Organization. 2020;98(7):495–504. Epub 2020/06/02. doi: 10.2471/BLT.20.253591 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Fenwick C, Turelli P, Ni D, Perez L, Lau K, Herate C, et al. Patient-derived monoclonal antibody neutralizes SARS-CoV-2 Omicron variants and confers full protection in monkeys. Nature microbiology. 2022;7(9):1376–89. Epub 2022/07/25. doi: 10.1038/s41564-022-01198-6 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Liu L, Iketani S, Guo Y, Chan JFW, Wang M, Liu L, et al. Striking Antibody Evasion Manifested by the Omicron Variant of SARS-CoV-2. Cold Spring Harbor Laboratory; 2021. [DOI] [PubMed] [Google Scholar]
  • 27.Leung K, Shum MH, Leung GM, Lam TT, Wu JT. Early transmissibility assessment of the N501Y mutant strains of SARS-CoV-2 in the United Kingdom, October to November 2020. Euro surveillance: bulletin Europeen sur les maladies transmissibles = European communicable disease bulletin. 2021;26(1). Epub 2021/01/09. doi: 10.2807/1560-7917.ES.2020.26.1.2002106 ; PubMed Central PMCID: PMC7791602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Plante JA, Liu Y, Liu J, Xia H, Johnson BA, Lokugamage KG, et al. Spike mutation D614G alters SARS-CoV-2 fitness. Nature. 2021;592(7852):116–21. Epub 2020/10/26. doi: 10.1038/s41586-020-2895-3 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Lubinski B, Jaimes JA, Whittaker GR. Intrinsic furin-mediated cleavability of the spike S1/S2 site from SARS-CoV-2 variant B.1.1.529 (Omicron). bioRxiv: the preprint server for biology. 2022:2022.04.20.488969. doi: 10.1101/2022.04.20.488969 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Tian D, Sun Y, Xu H, Ye Q. The emergence and epidemic characteristics of the highly mutated SARS-CoV-2 Omicron variant. J Med Virol. 2022;94(6):2376–83. doi: 10.1002/jmv.27643 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Islam F, Dhawan M, Nafady MH, Emran TB, Mitra S, Choudhary OP, et al. Understanding the omicron variant (B.1.1.529) of SARS-CoV-2: Mutational impacts, concerns, and the possible solutions. Annals of Medicine and Surgery. 2022;78:103737. doi: 10.1016/j.amsu.2022.103737 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kumar BK, Venkatraja B, Prithvisagar KS, Rai P, Rohit A, Hegde MN, et al. Mutational analysis unveils the temporal and spatial distribution of G614 genotype of SARS-CoV-2in different Indian states and its association with case fatality rate of COVID-19. bioRxiv. 2020:2020.07.27.222562. doi: 10.1101/2020.07.27.222562%J bioRxiv. [DOI] [Google Scholar]
  • 33.Gorkhali R, Koirala P, Rijal S, Mainali A, Baral A, Bhattarai HK. Structure and Function of Major SARS-CoV-2 and SARS-CoV Proteins. Bioinformatics and biology insights. 2021;15:11779322211025876. Epub 2021/07/06. doi: 10.1177/11779322211025876 ; PubMed Central PMCID: PMC8221690. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Atari N, Kliker L, Zuckerman N, Elkader BA, Weiss-Ottolenghi Y, Mendelson E, et al. Omicron BA.2.75 variant is efficiently neutralised following BA.1 and BA.5 breakthrough infection in vaccinated individuals, Israel, June to September 2022. Euro surveillance: bulletin Europeen sur les maladies transmissibles = European communicable disease bulletin. 2022;27(44). Epub 2022/11/05. doi: 10.2807/1560-7917.ES.2022.27.44.2200785 ; PubMed Central PMCID: PMC9635020. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table

(DOCX)

Click here for additional data file. (130.4KB, docx)

Data Availability Statement

All relevant data are within the paper.

Articles from PLOS ONE are provided here courtesy of PLOS

RESOURCES