Skip to main content
ZooKeys logoLink to ZooKeys
. 2023 Jan 25;1143:1–49. doi: 10.3897/zookeys.1143.93601

A consolidated phylogeny of snail-eating snakes (Serpentes, Dipsadini), with the description of five new species from Colombia, Ecuador, and Panama

Alejandro Arteaga 1,2,, Abel Batista 3,4,5,6
PMCID: PMC10208808  PMID: 37234281

Abstract

A molecular phylogeny of the Neotropical snail-eating snakes (tribe Dipsadini Bonaparte, 1838) is presented that includes 60 of the 133 species currently recognized. There is morphological and phylogenetic support for four new species of Sibon Fitzinger, 1826 and one of Dipsas Laurenti, 1768, which are described here based on their unique combination of molecular, meristic, and color pattern characteristics. PlesiodipsasHarvey et al., 2008 is designated as a junior synonym of Dipsas and additional evidence is presented to support the transfer of the genus Geophis Wagler, 1830 to the tribe Dipsadini. Two of the subspecies of S.nebulatus (Linnaeus, 1758) are elevated to full species status. Insight into additional undescribed cryptic diversity within the S.nebulatus species complex is provided. Evidence that supports the existence of an undescribed species previously confused with D.temporalis is provided, as well as the first country record of S.ayerbeorum Vera-Pérez, 2019 in Ecuador with a comment on the ontogenetic variation of the latter. Finally, photographs of Colombian, Ecuadorian, and Panamanian snail-eating snakes are provided.

Keywords: Caenophidia, Colubroidea, Dipsas , Plesiodipsas , Sibon , Squamata, systematics, taxonomy

Introduction

The snail-eating snake tribe Dipsadini is one of the most diverse yet taxonomically complex group of snakes in the Neotropics. Many authors (Peters 1960; Downs 1961; Hoge 1964; Peters and Orejas-Miranda 1970; Kofron 1982; Orcés and Almendáriz 1987; Porto and Fernandes 1996; Fernandes et al. 1998, 2002; Cadle and Myers 2003; Passos et al. 2004, 2005; Cadle 2005, 2007; Harvey 2008; Harvey and Embert 2008; Harvey et al. 2008) have attempted to clarify the systematics of the group or its subgroups using morphological characters. However, the majority of these authors disagree about the number of genera included in the tribe as well as the allocation of species among genera. Fortunately, this lack of consensus is likely coming to an end with the use of molecular tools on Dipsadini systematics. Three independent groups of researchers (Sheehy 2012; Arteaga et al. 2018; and Grünwald et al. 2021) arrived at similar conclusions about the contents and limits of this snake tribe when molecular and morphological evidence were combined. Although progress is being made regarding the taxonomy of Dipsadini, more than half of the species of the group remain unsampled for DNA characters and additional diversity remains undescribed.

In his unpublished PhD thesis, Sheehy (2012) presented a large (194 taxa) phylogeny of the group using two mitochondrial ant two nuclear genes. Among his most important findings were that the genus Sibynomorphus Fitzinger, 1843 is paraphyletic with respect to Dipsas and that the genus Geophis Wagler, 1830 is deeply nested within Dipsadini. He also uncovered two major (one South American and one Central American) and eleven minor geographically structured clades within the widely distributed snake species Sibonnebulatus and found that Sibonannulatus (Günther, 1872) is paraphyletic with respect to Sibonlamari Solórzano, 2001 and SibonperissostichonKöhler et al., 2010. Sheehy (2012) also presented phylogenetic evidence that Geophissanniolus (Cope, 1866) (previously in the genus Sibon) and D.gaigeae (Oliver, 1937) do not belong to their nominal genera and their relationships with the remaining groups of snail-eating snakes are ambiguous. Since Sheehy’s work was not published, his findings were not integrated into the taxonomy of the Dipsadini. However, his work provided a solid framework for comparison for two subsequent studies.

First, Arteaga et al. (2018) presented a phylogeny of the group based on novel taxon sampling. This work differed from Sheehy’s in that it had an emphasis on Dipsas (rather than Sibon) and on South American (rather than Central American) Dipsadini in general. However, it confirmed some of the results of Sheehy (2012); most notably the paraphyly of Dipsas with respect to Sibynomorphus, which resulted in the latter being designated as a junior subjective synonym of Dipsas. Besides describing five new species of Dipsadini, Arteaga et al. (2018) uncovered, but did not explore further, high levels of intraspecific divergence within each of the nominal species D.vermiculata Peters, 1960 and Sibonannulatus, which suggested that further diversity remained to be described in this group. They also presented evidence that Sibonnebulatus is paraphyletic with respect to Sibondunni Peters, 1957 and SibonbevridgelyiArteaga et al., 2018, and recognized that elevating the subspecies Sibonnebulatusleucomelas (Boulenger, 1896) and Sibonnebulatushartwegi Peters, 1960 to full species status would help resolve this paraphyly. However, Arteaga et al. (2018) refrained from proposing further taxonomic arrangements because their sample size for D.vermiculata, Sibonannulatus, and Sibonnebulatus was insufficient. Later, Grünwald et al. (2021) combined some of the DNA sequences of Sheehy (2012) with novel sequences from Mexico into a phylogeny of Dipsadini that focused on the genus Tropidodipsas Günther, 1858. Based on the results of their phylogenetic analyses, these authors transferred T.annuliferus (Boulenger, 1894), T.sartorii (Cope, 1863), and Sibonsanniolus to Geophis, a genus that, according to Sheehy (2012), should be added to the tribe Dipsadini, a decision seconded by Grünwald et al. (2021) and also herein. Lastly, in a project seeking to create a large DNA barcode library of reptiles from the National Museum of Natural History tissue holdings, Mulcahy et al. (2022) provided mitochondrial DNA sequences (gene fragments COI and 16S) for ten species of Dipsadini. However, these have not been included in any phylogenetic studies so far.

Here, we combine the datasets of Sheehy (2012), Arteaga et al. (2018), Grünwald et al. (2021), and Mulcahy et al. (2022) with novel DNA sequences of Colombian, Panamanian, and Ecuadorian material into a consolidated phylogeny of the tribe Dipsadini. Notably, we include the recently described Sibonayerbeorum and the monotypic Plesiodipsasperijanensis (Aleman, 1953) in the analysis. The combined molecular sampling, together with morphological analysis and species distribution models, supports the existence of at least five new species of Neotropical snail-eating snakes, which we describe here.

Materials and methods

Ethics statement

This study was carried out in strict accordance with the guidelines for use of live amphibians and reptiles in field research (Beaupre et al. 2004) compiled by the American Society of Ichthyologists and Herpetologists (ASIH), the Herpetologists’ League (HL) and the Society for the Study of Amphibians and Reptiles (SSAR). All procedures with animals (see below) were reviewed by the Ministerio del Ambiente, Agua y Transición Ecológica (MAATE), Ecuador and UNARGEN-Ministerio de Ambiente Panamá, and specifically approved as part of obtaining the following field permits for research and collection: MAE-DNB-CM-2018-0105 and MAATE-DBI-CM-2022-0245 (granted to Universidad San Francisco de Quito) and SC/A-8-09, SC/A-28-09, SC/A-37-11, SC/A-33-12, SE/A-60-16, and SE/A-33-18 (granted to Museo Herpetológico de Chiriquí). Specimens were euthanized with 20% benzocaine, fixed in 10% formalin or 90% ethanol, and stored in 70% ethanol. Museum vouchers were deposited at Museo de Zoología de la Universidad San Francisco de Quito (ZSFQ), Museo Herpetológico de Chiriquí (MHCH), and at the Senckenberg Forschungsinstitut Frankfurt (SMF). Specimens labeled TH, SC, and JMG were also deposited at ZSFQ.

Common names

Criteria for common name designation are as proposed by Caramaschi et al. (2006) and Coloma and Guayasamin (2011–2017), reviewed by Arteaga et al. (2019). These are as follows (in order of importance): (i) the etymological intention (implicit or explicit) that the authors used when naming the species (specific epithet); (ii) a common name that is already widely used in the scientific literature; (iii) a common name that has an important ancestral or cultural meaning; (iv) a common name based on any distinctive aspect of the species (distribution, morphology, behavior, etc).

Morphological data

Our terminology for Dipsadini cephalic shields follows proposals by Peters (1960) and Harvey and Embert (2008). Diagnoses and descriptions generally follow Fernandes et al. (2010) and ventral and subcaudal counts follow Dowling (1951). We physically examined comparative alcohol-preserved specimens from the herpetology collections at Colección de Prácticas Zoológicas de la Universidad del Valle (CPZ-UV), Colección Zoológica de la Universidad ICESI (CZI), División de Herpetología del Instituto Nacional de Biodiversidad (DHMECN), MHCH, Museum d’Histoire Naturelle de la Ville de Genève (MHNG), Museo de Zoología de la Universidad del Azuay (MZUA), Museo de Zoología de la Universidad Tecnológica Indoamérica (MZUTI), SMF, Colección de Anfibios y Reptiles de la Universidad del Valle (UV-C), and ZSFQ (Suppl. material 1). We also examined photographs of specimens housed at Museo de Zoología de la Pontificia Universidad Católica del Ecuador (QCAZ). Morphological measurements were taken with measuring tapes to the nearest 1 mm, or with digital calipers to the nearest 0.1 mm. Abbreviations are as follows: snout-vent length (SVL); tail length (TL); total length, TOL (SVL + TL). Sex was determined by establishing the presence/absence of hemipenes through a subcaudal incision at the base of the tail unless hemipenes were everted.

Sampling

Tissue samples from 19 individuals representing eight species (including the five new species described here) were obtained in Colombia, Ecuador, and Panama. All specimens included in the genetic analyses were morphologically identified according to Peters (1960), Duellman (1978), Savage (2002), Cadle and Myers (2003), Cadle (2005, 2007), Harvey (2008), Harvey and Embert (2008), and Arteaga et al. (2018). We generated sequence data for samples marked with an asterisk in Appendix 1, which includes museum vouchers from MHCH, MZUTI, SMF, Colección de Herpetología de la Universidad Industrial de Santander (UIS), and ZSFQ.

Laboratory techniques

Genomic DNA was extracted from 96% ethanol-preserved tissue samples (liver, muscle tissue, or scales) using either a guanidinium isothiocyanate extraction protocol (Peñafiel et al. 2020), or a modified salt precipitation method based on the Puregene DNA purification kit (Gentra Systems). The nucleotide sequences of the primers and the PCR conditions applied to each primer pair are detailed in Appendix 2. PCR products were cleaned with either ExoSAP-IT (Affymetrix, Cleveland, OH), or Exonuclease I and Alkaline Phosphatase (Illustra ExoProStar by GE Healthcare) before they were sent to Macrogen Inc (Seoul, South Korea) for sequencing. All PCR products were sequenced in both forward and reverse directions with the same primers that were used for amplification. The edited sequences were deposited in GenBank (Appendix 1).

DNA phylogenetic analyses

A total of 343 DNA sequences was used to build a phylogenetic tree of the tribe Dipsadini, of which 35 were generated during this work and 308 were downloaded from GenBank, most of which were produced by Sheehy (2012), Arteaga et al. (2018), and Grünwald et al. (2021). Of these, 20 sequences are 242–473 bp long fragments of the 12S gene, 65 are 201–422 bp long fragments of the 16S gene, 16 are 493–657 bp long fragments of the COI gene, 85 are 559–1,071 bp long fragments of the CYTB gene, 80 are 325–684 bp long fragments of the ND4 gene, 29 are 606–674 bp long fragments of the DNAH3 gene, and 48 are 456–470 bp long fragments of the NT3 gene. New sequences were edited and assembled using the program Geneious ProTM 2021.1.1 (Drummond et al. 2021) and aligned with those downloaded from GenBank (Appendix 1) using MAFFT v. 7 (Katoh and Standley 2013) under the default parameters in Geneious ProTM 2021.1.1. Genes were combined into a single matrix with 17 partitions, one per non-coding gene and three per protein coding gene corresponding to each codon position. The best partition strategies along with the best-fit models of evolution were obtained in PartitionFinder 2.1.1 (Lanfear et al. 2016) under the Bayesian information criterion.

Phylogenetic relationships were assessed under a Bayesian inference (BI) approach in MrBayes 3.2.0 (Ronquist and Huelsenbeck 2013). Four independent analyses were performed to reduce the chance of converging on a local optimum. Each analysis consisted of 20,000,000 generations and four Markov chains with default heating settings. Trees were sampled every 1,000 generations and 25% of them were arbitrarily discarded as ‘‘burn-in.” The resulting 15,000 saved trees per analysis were used to calculate posterior probabilities (PP) for each bipartition in a 50% majority-rule consensus tree. We used Tracer 1.6 (Rambaut et al. 2022) to assess convergence and effective sample sizes (ESS) for all parameters. Additionally, we verified that the average standard deviation of split frequencies between chains and the potential scale reduction factor (PSRF) of all the estimated parameters approached values of ≤ 0.01 and 1, respectively. GenBank accession numbers are listed in Appendix 1.

Distribution maps and ecological niche models

We present ranges of occurrence for eleven species of Dipsadini, including five new species described here. Presence localities are derived from museum vouchers (Suppl. materal 1), photographic records (iNaturalist), and the literature (all summarized in Suppl. materal 2). For each species, a binary environmental niche model (ENM) accompanies the dot maps. These models estimate potential areas of distribution on the basis of observed presences and a set of environmental predictors (Elith and Leathwick 2009). To delimit the occupancy areas and the potential species distribution, we used the BAM diagram proposal (Soberón and Peterson 2005; Peterson et al. 2011). To create the models, we used presence localities listed in Suppl. materal 2, 19 bioclimatic variables from Worldclim 1.4 (Hijmans et al. 2005), and Maxent 3.4.1k, an algorithm based on the principle of maximum entropy (Phillips et al. 2006; Elith et al. 2011; Renner and Warton 2013).

For the first explorative exercise, we used the 19 climate layers from the WorldClim project and assessed which variables were the most important for the model, according to the Jackknife test calculated in MaxEnt (Royle et al. 2012). Correlated environmental variables (r < 0.8) were identified using the PEARSON correlation test of PAST 3. In a second modelling exercise, we used the locality records for each species and the variables identified in the first approach to generate the species distribution. 5,000 iterations were specified to the program with clamping and no extrapolation. All other parameters in MaxEnt were maintained at default settings. To create the binary environmental niche models, suitable areas were distinguished from unsuitable areas by setting a minimum training presence threshold value. The logistic format was used to obtain the values for habitat suitability (continuous probability from 0 to 1), which were subsequently converted to binary presence-absence values on the basis of the established threshold value, defined herein as the minimum training presence. The convergence threshold was set to 10-5, maximum iterations to 500, and the regularization parameter to “auto.”

Results

Molecular phylogeny and taxonomic consequences

Selected partitions and models of evolution are presented in Table 1. We consider strong support for a clade when Bayesian analyses yield posterior probability values > 95%, following Felsenstein (2004). The topology and support (Fig. 1) of our phylogenetic tree differs from that of Sheehy (2012), Arteaga et al. (2018), and Grünwald et al. (2021), primarily regarding the relationships between the included genera. Below, we outline these differences and comment on the phylogenetic position of new material included in this work.

Table 1.

Partition scheme and models of evolution used in phylogenetic analyses. Numbers in parentheses indicate codon position.

Partitition Best model Gene regions Number of aligned sites
1 GTR+I+G 12S, 16S, COI(1), CYTB(3), ND4(1) 1742
2 HKY+I+G CYTB(1), ND4(2) 614
3 GTR+I+G COI(3), CYTB(2), ND4(3) 833
4 K80+I DNAH3(1), DNAH3(2) 450
5 K80+G DNAH3(3), NT3(1) 381
6 K80+G NT3(2), NT3(3) 313
7 F81 COI(2) 219

Figure 1.

Figure 1.

Phylogenetic relationships within Dipsadini inferred using a Bayesian inference and derived from analysis of DNA gene fragments 12S, 16S, COI, CYTB, ND4, DNAH3, and NT3. Support values on intra-specific branches are not shown for clarity. Voucher numbers for sequences are indicated for each terminal. Black dots indicate clades with posterior probability values from 95–100%. Grey dots indicate values from 70–94%. White dots indicate values from 50–69% (values < 50% not shown). Colored clades correspond to the species’ distribution presented in the maps. New or redefined species are indicated in bold type.

Tropidodipsasfischeri Boulenger, 1894 is recovered as sister to all other sampled Dipsadini, with the exception of Geophissanniolus, a species that did not form a group with the remaining Geophis. Neither of these or any other higher relationships within Dipsadini are strongly supported in our analysis, but all other sampled species of Dipsadini are included in their corresponding genera sensuArteaga et al. (2018) and Grünwald et al. (2021).

With the exception of Geophissanniolus, relationships within Geophis are identical to those presented in Grünwald et al. (2021). The relationships within Tropidodipsas are similar to those presented in Sheehy (2012) and the newly described T.tricolorGrünwald et al., 2021 is recovered as the strongly supported sister species of T.papavericolaGrünwald et al., 2021.

Dipsasgaigeae is recovered as the sister species of all other Dipsas, albeit with low support, but not as sister to (see Sheehy 2012) or forming a polytomy with (see Grünwald et al. 2021) Tropidodipsas. The D.articulata group, as defined by Peters (1960) and modified by Harvey (2008) and Arteaga et al. (2018) is monophyletic. Within it, D.viguieri (Bocourt, 1884), a species not included in previous phylogenetic analyses, is recovered as the moderately supported sister taxon of D.articulata (Cope, 1868). We found D.pavonina Schlegel, 1837 to be the moderately supported sister taxon of a clade formed by D.peruana (Boettger, 1898), D.palmeri (Boulenger, 1912), and D.klebbaiArteaga et al., 2018, a relationship not recovered in any of the previous phylogenies. Plesiodipsasperijanensis is nested within the genus Dipsas and is recovered as the moderately supported sister species of D.albifrons (Sauvage, 1884). There are two reciprocally monophyletic, deeply divergent, and geographically structured clades within D.vermiculata sensu lato. One is D.vermiculata sensu stricto and the other is a new species endemic to the Cordillera del Cóndor in southeastern Ecuador and northern Peru. This new species is described in this work. The D.oreas group, as defined by Harvey (2008) and modified by Arteaga et al. (2018) is monophyletic and includes D.nicholsi Dunn, 1933. Within it, D.elegans Boulenger, 1896 is recovered as the strongly supported sister species of D.ellipsifera (Boulenger, 1898), a relationship already uncovered in Arteaga et al. (2018). There are two reciprocally monophyletic, deeply divergent, and geographically structured clades within D.temporalis (Werner, 1909). One is D.temporalis sensu stricto and the other is a new species endemic to central Panama.

Relationships within Sibon are most similar to those presented in Sheehy (2012). The S.argus group is sister to all other members of the genus and it includes the newly described S.ayerbeorum, a species not previously sampled for molecular characters. Sibonannulatus is paraphyletic with respect to S.perissostichon, S.lamari, and three new species described in this work. We restrict the name S.annulatus to the red clade in Fig. 1a based on the type locality of this species (Cartago, Costa Rica) where only members of the red clade have been recorded, as well as on the original description of this species. Günther (1872) mentioned that the holotype has 164 ventrals and the body and tail are encircled by black rings. Members of the yellow clade have more than 170 ventrals and lack full body rings. Sibonannulatus, S.perissostichon, S.lamari, and the three new species form a monophyletic unit exclusive of all other species of the paraphyletic S.annulatus species group (see Arteaga et al. 2018 for a list of species included in this group). There are eleven monophyletic, deeply divergent, and geographically structured clades within S.nebulatus sensu lato. Two of these correspond to species already described (S.bevridgelyi and S.dunni), three correspond to subspecies of S.nebulatus (nebulatus, leucomelas, and hartwegi), one corresponds to a new species described here, and the remaining clades are deemed putative new species. The allocation of subspecies names to each clade was based on direct examination of museum vouchers and whether these agree in coloration and lepidosis with the corresponding holotype, as well as on the geographic range of the included samples.

Finally, we excluded SibonnoalaminaLotzkat et al., 2012 (voucher SMF 91539) from the analyses as the short sequence available in GenBank (gene fragment 16S) represented a rogue taxon that assumed varying phylogenetic positions in the tree collection used to build the consensus tree.

Systematic accounts

We name and provide descriptions only for species that are monophyletic in our molecular phylogeny and share diagnostic features of their coloration pattern and lepidosis. Based on these species delimitation criteria, which follow the general species concept of de Queiroz (2007), we describe five new species of Dipsadini.

. Sibon irmelindicaprioae sp. nov.

5C3151DE-21DD-56FD-A582-39BBA2799285

https://zoobank.org/E2264D87-D5DF-4977-9893-B85C7F762644

Figs 2a, b , 3 , 4b , 5c Proposed standard English name: DiCaprio’s Snail-eating Snake Proposed standard Spanish name: Culebra caracolera de DiCaprio

Figure 2.

Figure 2.

Photographs of some species of Sibon in life aS.irmelindicaprioae sp. nov. MHCH 3269 from Chucantí Reserve, Darién province, Panama bS.irmelindicaprioae sp. nov. from Morromico Reserve, Chocó department, Colombia cS.canopy sp. nov. from Cerro Gaital, Coclé province, Panama d, eS.annulatus from Centro Manu, Limón province, Costa Rica fS.ayerbeorumZSFQ 5066 from Canandé Biological Reserve, Esmeraldas Province, Ecuador gS.marleyae sp. nov. holotype ZSFQ 5065 from Verdecanandé, Esmeraldas Province, Ecuador hS.marleyae sp. nov. ZSFQ 5068 from Verdecanandé, Esmeraldas Province, Ecuador iS.marleyae sp. nov. neonate from Verdecanandé, Esmeraldas Province, Ecuador.

Figure 3.

Figure 3.

Adult male holotype of Sibonirmelindicaprioae sp. nov. MHCH 3143 in lateral views a right and b left side.

Figure 4.

Figure 4.

Photographs of some species of Sibon and Dipsas in life aS.canopy sp. nov. from El Valle de Antón, Coclé province, Panama bS.irmelindicaprioae sp. nov. holotype MHCH 3143 from Puerto Indio, Darién province, Panama cS.marleyae sp. nov. from Verdecanandé, Esmeraldas Province, Ecuador dS.vieirai sp. nov. from Mashpi Amagusa Reserve, Pichincha province, Ecuador eDipsas sp. from Cerro Gaital, Coclé province, Panama fD.welborni sp. nov. ZSFQ 5060 from Vía a Nuevo Paraíso, Zamora Chinchipe province, Ecuador.

Figure 5.

Figure 5.

Differences in head morphology between species of Sibon previously subsumed under S.annulatusaS.annulatusMHCH 1982 from Bonyic, Bocas del Toro province, Panama bS.canopy sp. nov. holotype MHCH 3110 from Cerro Gaital, Coclé province, Panama cS.irmelindicaprioae sp. nov. MHCH 3120 from Pirré, Darién province, Panama dS.marleyae sp. nov. holotype ZSFQ 5065 from Verdecanandé, Esmeraldas Province, Ecuador.

Type material.

Holotype: MHCH 3143 (Figs 3, 4b), adult male collected by Abel Batista and Milan Vesely, on 29 September 2011 at Cerro Bailarín, Pavarandó, Comarca Emberá-Wounaan, Panama (7.69385, -78.04267; 852 m a.s.l.).

Paratypes: MHCH 3145, adult female collected by Abel Batista and Milan Vesely on 26 September 2012 at Ambroya, Panama province, Panama (8.91680, -78.61779; 484 m a.s.l.). MHCH 3146, adult male collected by Abel Batista on 16 November 2012 at Cerro Garra Garra, Pavarandó, Comarca Emberá-Wounaan, Panama (7.76400, -78.10063; 655 m a.s.l.). MHCH 3111, adult male collected by Abel Batista, Madian Miranda, Orlando Garcés, Rogemif Fuentes on 15 October 2016 at Chucantí, Darién province, Panama (8.79773, -78.46225; 1295 m a.s.l.). MHCH 3120, adult male collected by Abel Batista, Madian Miranda, Michelle Quiroz, Marcos Ponce on 18 June 2015 at Pirré, Darién province, Panama (7.99695, -77.71040; 550 m a.s.l.). COLZOOCH-H 0792, adult male collected by Jhon Tailor Rengifo Mosquera on 6 March 2005 at El Afirmado, Chocó department, Colombia (5.64190, -77.07550; 216 m a.s.l.).

Diagnosis.

Sibonirmelindicaprioae sp. nov. is placed in the genus Sibon based on phylogenetic evidence (Fig. 1a) and on having the penultimate supralabial conspicuously higher than all other supralabials. The species is diagnosed based on the following combination of characters: (1) 15/15/15 smooth dorsals with enlarged vertebral row (1.5× as wide as adjacent rows); (2) loreal and prefrontal in contact with orbit; (3) 7–9 supralabials with, usually, 5th and 6th contacting orbit; (4) 8–10 infralabials with 3rd–7th in contact with chinshields, first pair of infralabials not in contact behind symphysial due to presence of postmentals; (5) 187–196 ventrals in males, 174 in the single female; (6) 110–128 divided subcaudals in males, 117 in the single female; (7) dorsal background color olive with maroon lateral body blotches or irregular bands (2–6 dorsal scales long) and a reddish tint along the vertebral line (Figs 2a, b, 4b), ventral surfaces yellowish white with encroachment from the dorsal maroon blotches and with smaller blackish speckles and marks in-between the blotches, dorsal aspect of head variegated with a mixture of pinkish to maroon and pale olive yellow speckles (Fig. 5c), throat yellowish white with brownish blotches and spots, iris pale olive brown to rich dark brown; (8) 292–387 mm SVL in males, 402 mm in the single female; (9) 123–193 mm TL in males, 204 mm in the single female.

Comparisons.

Sibonirmelindicaprioae sp. nov. is compared to other species of Sibon previously subsumed under S.annulatus sensu lato (differences summarized in Table 2). From S.annulatus sensu stricto, the new species differs in having the dorsal body bands faint and broken along the vertebral line (Figs 2a, b, 4b) and by having a finely variegated pattern on the dorsal surface of the head (Fig. 5c), whereas in S.annulatus the dorsal bands reach over all dorsal and lateral surfaces and extend comparably far onto the ventral surfaces (Figs 2d, e) and the head pattern consists of symmetrical broad blotches (Fig. 5a). Sibonirmelindicaprioae sp. nov. differs from S.canopy sp. nov. by having two (instead of one) postmental scales, a higher number of infralabials (8–10 instead of 6–10), a higher number of ventrals in males (187–196 instead of 180–189), a finely variegated pattern on the dorsal surface of the head (instead of broad irregular blotches; Fig. 5), and by lacking reddish spots enclosed in the dorsal olive interspaces (Figs 2, 4). Sibonirmelindicaprioae sp. nov. differs from S.marleyae sp. nov. by having a finely variegated pattern on the dorsal surface of the head (instead of having irregular/symmetrical broad blotches; see Fig. 5), distinct dorsal bands (instead of bands usually broken along the vertebral line), and a higher number (over 177) of ventrals in females.

Table 2.

Differences in coloration, scale counts, and size between Sibonannulatus, S.canopy sp. nov., S.irmelindicaprioae sp. nov., and S.marleyae sp. nov. The range of each continuous variable is from our own sample, Peters (1960), Savage and McDiarmid 1992, Lewis et al. (2013), Lotzkat (2014), and Meneses-Pelayo et al. (2016). The numbers in parentheses represent the sample size.

Variable Sibonannulatus Siboncanopy sp. nov. Sibonirmelindicaprioae sp. nov. Sibonmarleyae sp. nov.
Dorsum pattern Reddish bands distinct and extending over the entire dorsal and lateral surfaces Reddish bands distinct and broken along vertebral line in about half of individuals Reddish bands faint and broken along vertebral line Reddish bands distinct and usually broken along vertebral line
Reddish vertebral spots in interspaces No Yes No No
Head pattern Symmetrical broad blotches Irregular broad blotches Finely variegated Irregular/symmetrical broad blotches
Supralabials 7–8 6–8 7–9 7–8
Infralabials 7–9 6–8 8–10 8–9
Postmentals 2 1 2 2 (1 in QCAZ 16974)
Sex Males (n = 10) Females (n = 15) Males (n = 12) Females (n = 8) Males (n = 7) Females (n = 1) Males (n = 6) Females (n = 5)
Maximum TOL 707 mm 611 mm 648 mm 536 mm 580 mm 606 mm 657 mm 551 mm
Ventrals 170–192 161–186 180–189 170–185 187–196 174 186–204 176–193
Subcaudals 108–135 113–126 113–130 107–124 110–128 117 130–143 109–128

Description of holotype.

Adult male, SVL 387 mm, tail length 193 mm (49% SVL); head length 14.3 mm (3.7% SVL) from tip of snout to angle of jaw; head width 9.0 mm (88% head length) taken at broadest point; snout-orbit distance 2.3 mm; head distinct from neck; snout short, blunt in dorsal outline and rounded in profile; rostral 1.8 mm wide, higher than broad; internasals 1.8 mm wide, broader than long; prefrontals 2.3 mm wide, longer than broad, entering orbit; supraocular 3.6 mm long, longer than broad; frontal 3.7 mm long, pentagonal and with an inward-bent anterior border, in contact with prefrontals, supraoculars, and parietals; parietals 5.8 mm long, longer than broad; nasal divided, in contact with first two supralabials, loreal, prefrontal, internasal, and rostral; loreal 1.4 mm long, longer than high, entering the orbit; eye diameter 3.7 mm; pupil semi-elliptical; no preocular; two postoculars; temporals 1+3 on the right side, 2+3 on the left side; eight supralabials with 5th and 6th contacting orbit on the right side, eight supralabials with 5th and 6th contacting orbit on the left side; symphysial precluded from contacting chinshields by a pair of postmentals; ten infralabials, 3rd–7th contacting chinshields; two pair of chinshields longer than wide; dorsal scales in 15/15/15 rows, smooth, without apical pits; 193 ventrals; 128 paired subcaudals; cloacal plate single.

Natural history.

Specimens of Sibonirmelindicaprioae sp. nov. have been found at night foraging on shrubs, trees, and palm fronds 200–300 cm above the ground in old-growth to moderately disturbed evergreen lowland/foothill forests. Snakes of this species are docile and never attempt to bite. When threatened, individuals may hide the head among body coils and produce a musky and distasteful odor.

Distribution.

Sibonirmelindicaprioae sp. nov. is known from 16 localities (listed in Suppl. material 2) in the Chocó region of eastern Panama and northwestern Colombia, with an isolated population on the western slopes of the Cordillera Oriental of Colombia. The species occurs over an estimated area of 62,241 km2 and has been recorded at elevations 346–1295 m above sea level (Fig. 6). Since the population on the Cordillera Oriental is isolated from the remaining populations and individuals in this area occur at higher elevations and have a different dorsal color pattern, we provisionally assign them to S.irmelindicaprioae sp. nov. pending more comprehensive genetic analyses.

Figure 6.

Figure 6.

Distribution of species of Sibon previously subsumed under S.annulatus. Black symbols represent type localities; white symbols other localities listed in Suppl. material 2. Colored areas show the extent of suitable environmental conditions for each species.

Etymology.

The specific epithet irmelindicaprioae is a patronym honoring Irmelin DiCaprio (1945–present), mother of Leonardo DiCaprio, long-time advocate and supporter of biodiversity conservation around the world.

Conservation status.

We consider Sibonirmelindicaprioae sp. nov. to be included in the Near Threatened category following IUCN Red List criteria (IUCN 2001) because the species is distributed over a region that holds large areas of continuous unspoiled forest. Based on the species distribution model presented in Fig. 6 in combination with maps of vegetation cover of Colombia (IDEAM 2014) and Panama (CATHALAC 2011), we estimate that more than half (~ 54%) of the species’ forest habitat is still standing. Unfortunately, vast areas of the Chocó rainforest in northern Colombia and towards central Panama have already been converted to pastures (Myers et al. 2000). However, S.irmelindicaprioae sp. nov. occurs over an area greater than 50,000 km2 and is presumably not declining fast enough to qualify for a threatened category.

. Sibon canopy sp. nov.

54069384-456A-59F9-A534-BD403B5C43F8

https://zoobank.org/EAE5090E-93AC-403D-A11C-4AFF2C737AE4

Figs 2c , 4a , 5b , 7 Proposed standard English name: Canopy Snail-eating Snake Proposed standard Spanish name: Culebra caracolera de dosel

Figure 7.

Figure 7.

Adult female holotype of Siboncanopy sp. nov. MHCH 3110 in a dorsal and b ventral view.

Type material.

Holotype: MHCH 3110 (Figs 5b, 7), adult female collected by Abel Batista on 8 August 2016 at Cerro Gaital, La Pintada, Coclé province, Panama (8.70874, -80.42411; 543 m a.s.l.).

Paratypes: MHCH 1067, SMF 88713–14, juveniles collected by Johannes Köhler, Abel Batista, and Marcos Ponce on 17 January 2007 at Casa de Ancón, Sendero el Pianista, Bocas del Toro province, Panama (8.87142, -82.41594; 1005 m a.s.l.). MHCH 220, juvenile female collected by Abel Batista and Marcos Ponce on March 2002 at Camino al Río Culebra, Bocas del Toro province, Panama (8.90772, -82.39115; 698 m a.s.l.). SMF 85077, adult female collected by Gunther Köhler, Abel Batista, Marcos Ponce, and Javier Sunyer on 17 January 2006 at Reserva Forestal La Fortuna, Comarca Ngäbe-Buglé, Panama (8.77763, -82.20916; 1030 m a.s.l.). SMF 89596, adult female collected by Leonhard Stadler and Nadim Hamad on 5 August 2008 at Cerro Mariposa, Veraguas province, Panama (8.52488, -81.13275; 679 m a.s.l.). SMF 90023, adult female collected by Arcadio Carrizo on 27 June 2008 at Cerro Negro, Veraguas province, Panama (8.56901, -81.09894; 680 m a.s.l.). SMF 91578, adult female collected by Sebastian Lotzkat and Andreas Hertz on 17 July 2010 at Río Changena, Bocas del Toro province, Panama (8.97851, -82.69005; 1641 m a.s.l.). SMF 86411, juvenile collected by Abel Batista and Marcos Ponce on 10 February 2006 at Sendero El Pianista, Bocas del Toro province, Panama (8.87141, -82.41594; 1005 m a.s.l.). SMF 90208, juvenile collected by Joe-Felix Bienentreu and Frank Hauenschild on 25 October 2009 at Cerro Guayabo, Chiriquí province, Panama (8.75531, -82.25431; 1247 m a.s.l.). MHCH 2363–64, males collected by Sebastian Lotzkat and Andreas Hertz between 29 October 2009 and 11 June 2010 at Cabeceras del Río Chiriquí Mali, Comarca Ngäbe-Buglé, Panama (8.78906, -82.21547; 1080 m a.s.l.). MHCH 2365, juvenile male collected by Sebastian Lotzkat and Andreas Hertz on 7 August 2010 at Cerro Mariposa, Veraguas province, Panama (8.50815, -81.12104; 899 m a.s.l.). SMF 85078, adult male collected by Gunther Köhler, Abel Batista, Marcos Ponce, and Javier Sunyer on 19 January 2006 at Reserva Forestal La Fortuna, Comarca Ngäbe-Buglé, Panama (8.77763, -82.20916; 1030 m a.s.l.). SMF 88715, adult male collected by Sebastian Lotzkat and Andreas Hertz on 14 May 2008 at Trail to Rio Hornito, Chiriquí province, Panama (8.67385, -82.21845; 1320 m a.s.l.). SMF 89597, adult male collected by Leonhard Stadler and Nadim Hamad on 6 August 2008 at Cerro Mariposa, Veraguas province, Panama (8.51463, -81.11927; 1003 m a.s.l.). SMF 89786, adult male collected by Sebastian Lotzkat and Andreas Hertz on 1 April 2009 at Cerro Negro, Veraguas province, Panama (8.56901, -81.09894; 900 m a.s.l.). SMF 90024, adult male collected by Arcadio Carrizo on 29 July 2008 at Cerro Negro, Veraguas province, Panama (8.57697, -81.09705; 1085 m a.s.l.). SMF 90207, adult male collected by Sebastian Lotzkat and Andreas Hertz on 29 October 2009 at Cabeceras del Río Chiriquí Mali, Comarca Ngäbe-Buglé, Panama (8.78906, -82.21547; 1054 m a.s.l.). SMF 91579, adult male collected by Sebastian Lotzkat and Andreas Hertz on 11 June 2010 at Cabeceras del Río Chiriquí Mali, Comarca Ngäbe-Buglé, Panama (8.78906, -82.21547; 1054 m a.s.l.). SMF 91580, adult male collected by Sebastian Lotzkat and Andreas Hertz on 24 June 2010 at Bosque Guayabito, Comarca Ngäbe-Buglé, Panama (8.54939, -81.48467; 1510 m a.s.l.).

Diagnosis.

Siboncanopy sp. nov. is placed in the genus Sibon based on phylogenetic evidence (Fig. 1a) and on having the penultimate supralabial conspicuously higher than all other supralabials. The species is diagnosed based on the following combination of characters: (1) 15/15/15 smooth dorsals with enlarged vertebral row (1.4× as wide as adjacent rows); (2) loreal and prefrontal in contact with orbit; (3) 7–8 supralabials with, usually, 4th, 5th, and occasionally 6th contacting orbit; (4) usually 7–8 infralabials with 2nd–6th in contact with chinshields, first pair of infralabials not in contact behind symphysial due to presence of a postmental; (5) 180–189 ventrals in males, 170–185 in females; (6) 113–130 divided subcaudals in males, 107–124 in females; (7) dorsal background color olive with maroon bands (1–2 dorsal scales long mid-dorsally and 3–5 dorsal scales long on the lower flanks) and a reddish tint along the vertebral line (Fig. 2c), ventral surfaces white with encroachment from the dorsal maroon blotches, dorsal aspect of head composed of broad irregular maroon to blackish blotches interspersed with olive to red blotches (Fig. 5b), throat white with brownish blotches, iris dark reddish brown; (8) 336–427 mm SVL in males, 318–357 mm in females; (9) 160–221 mm TL in males, 157–185 mm in females.

Comparisons.

Siboncanopy sp. nov. is compared to other species of Sibon previously subsumed under S.annulatus sensu lato (differences summarized in Table 2). From S.annulatus sensu stricto, the new species differs in having a single postmental scale, olive spaces among dorsal bands enclosing maroon blotches (Figs 2c, 4a), and by having small irregular (rather than broad and symmetrical) markings on the dorsal surface of the head (Fig. 5). Siboncanopy sp. nov. differs from S.irmelindicaprioae sp. nov. by having one postmental scale (instead of two), a lower number of infralabials (6–10 vs. 8–10), a lower number of ventrals in males (180–189 vs. 187–196), a different pattern on the dorsal surface of the head (Fig. 5), and by having maroon spots enclosed in the dorsal olive interspaces (Figs 2, 4). Siboncanopy sp. nov. differs from S.marleyae sp. nov. by having one postmental scale (instead of two), olive spaces among dorsal bands enclosing maroon blotches (Figs 2, 4), and by having irregular (rather than symmetrical) markings on the dorsal surface of the head (Fig. 5).

Description of holotype.

Adult female, SVL 321 mm, tail length 157 mm (48% SVL); head length 15.4 mm (4.7% SVL) from tip of snout to commissure of mouth; head width 8.0 mm (76% head length) taken at broadest point; snout-orbit distance 3.3 mm; head distinct from neck; snout short, blunt in dorsal outline and rounded in profile; rostral 2.1 mm wide, higher than broad; internasals 1.6 mm wide, broader than long; prefrontals 1.9 mm wide, longer than broad, entering orbit; supraocular 3.7 mm long, longer than broad; frontal 3.2 mm long, pentagonal and with a straight anterior border, in contact with prefrontals, supraoculars, and parietals; parietals 5.2 mm long, longer than broad; nasal divided, in contact with first three supralabials, loreal, prefrontal, internasal, and rostral; loreal 1.7 mm long, longer than high, entering the orbit; eye diameter 3.0 mm; pupil semi-elliptical; no preocular; two postoculars; temporals 1+2; eight supralabials with 5th and 6th contacting orbit on the right side, seven supralabials with 4th and 5th contacting orbit on the left side; symphysial in contact with chinshields; nine infralabials with 2nd–5th contacting chinshields; two pair of chinshields longer than wide; dorsal scales in 15/15/15 rows, smooth, without apical pits; 172 ventrals; 93+ divided subcaudals; cloacal plate entire.

Natural history.

Lotzkat (2014) found specimens of Siboncanopy sp. nov. foraging at night on vegetation 50–300 cm above the ground in old-growth to moderately disturbed evergreen foothill/montane forests. At Cerro Gaital, Coclé province, we found two specimens moving on mossy branches and moist leaves 40–220 cm above the ground in primary forest during a drizzle. Ray et al. (2012) found this species to be more common in forest and along streams rather than around ponds. Only one individual (a juvenile) was seen crawling along a stream bed. Ray et al. (2012) found oligochaete and mollusk remains in fecal samples of 37 individuals of S.canopy sp. nov. from El Copé and Altos del María, Panama. They also observed an individual feeding on a snail at El Copé.

Distribution.

Siboncanopy sp. nov. is known from 25 localities (listed in Suppl. material 2) in both the Atlantic and Pacific slopes of the Cordillera Central in western Panama, with a population on the slopes of El Valle Volcano. The species occurs over an estimated area of 8,089 km2 and has been recorded at elevations 543–1641 m above sea level (Fig. 6).

Etymology.

The specific epithet canopy is used as a noun in apposition and honors the Canopy Family system of reserves, particularly its Canopy Lodge in Valle de Antón, Coclé province, Panama, where the new species occurs. Though best known for its world-class eco-tourism focused on birds, the Canopy Family also protects habitat that is critical for dozens of poorly studied Panamanian snakes such as S.canopy sp. nov. and S.irmelindicaprioae sp. nov. The project was founded in 1994 by Raúl Arias de Para and Denise Barakat de Arias, two champions of Panamanian conservation who are deeply intertwined with the Political history of the country. In 2019, the Canopy Family invited us to explore their system of reserves in order to discover their herpetofauna. As a result of this invitation, both S.canopy sp. nov. and a new species of Dipsas were discovered.

Conservation status.

We consider Siboncanopy sp. nov. to be included in the Near Threatened category following IUCN Red List criteria (IUCN 2001) because, although the species’ estimated extent of occurrence is less than 10,000 km2 and nearly 40% of this area has already been deforested (Fig. 6; CATHALAC 2011), the species occurs in at least four major national parks (Lotzkat 2014) and satellite images show that there is forest connectivity between populations. At Parque Nacional G. D. Omar Torríjos Herrera, the occurrence rates of S.canopy sp. nov. have actually increased by a factor of three in the period between 2006 and 2012 (Zipkin et al. 2020). However, the body condition of the individuals in this locality declined following the collapse of amphibian populations due to chytridiomycosis (Zipkin et al. 2020). The status and trend of other populations should be evaluated carefully given that S.canopy sp. nov. is endemic to Panama (but see Discussion) and probably highly dependent on old-growth forests.

. Sibon marleyae sp. nov.

3661D1DA-68CF-50E5-B6B6-88B7AF5FB315

https://zoobank.org/86EE4400-A3F1-4414-AB46-5E391D2AED24

Figs 2g–i , 4c , 5d , 8 Proposed standard English name: Marley’s Snail-eating Snake Proposed standard Spanish name: Culebra caracolera de Marley

Figure 8.

Figure 8.

Adult male holotype of Sibonmarleyae sp. nov. ZSFQ 5065 in a dorsal and b ventral view.

Type material.

Holotype: ZSFQ 5065 (Figs 2g, 5d, 8), adult male collected by Amanda Quezada, Eric Osterman, and Regdy Vera in December 2021 at Verdecanandé, Esmeraldas Province, Ecuador (0.52395, -79.01233; 344 m a.s.l.).

Paratypes: MZUTI 3034, adult male collected by Jaime Culebras on 22 July 2013 at Reserva Itapoa, Esmeraldas Province, Ecuador (0.51307, -79.13401; 321 m a.s.l.). ICN 10834, adult male collected at San José del Palmar, Chocó department, Colombia (4.96841, -76.22751; 1338 m a.s.l.). ZSFQ 5069, adult male collected by Jose Vieira, Daniela Franco, and Alex Mora on 4 December 2019 at Reserva Biológica Canandé, Esmeraldas Province, Ecuador (0.49531, -79.17832; 560 m a.s.l.). ZSFQ 5067, adult female collected by Jose Vieira, Frank Pichardo, and Matteo Espinosa at Durango, Esmeraldas Province, Ecuador (1.04161, -78.62658; 245 m a.s.l.). CPZ-UV 04567, adult female collected by Andrés Gómez Figueroa at Tamboral, Valle del Cauca department, Colombia. CZI-R009, adult female collected by Santiago Orozco on 9 September 2018 at Campamento Yatacué, Valle del Cauca department, Colombia (3.57472, -76.87777; 598 m a.s.l.). CZI-R051, adult female collected by Santiago Orozco on 16 June 2019 at Represa Murrapal, Valle del Cauca department, Colombia (3.55283, -76.98077; 321 m a.s.l.).

Diagnosis.

Sibonmarleyae sp. nov. is placed in the genus Sibon based on phylogenetic evidence (Fig. 1a) and on having the penultimate supralabial conspicuously higher than all other supralabials. The species is diagnosed based on the following combination of characters: (1) 15/15/15 smooth dorsals with enlarged vertebral row (up to 2× as wide as adjacent rows); (2) loreal and prefrontal in contact with orbit; (3) 7–8 supralabials with, usually, 4th, 5th, and occasionally 6th contacting orbit; (4) usually 8–9 infralabials with 2nd–6th in contact with chinshields, first pair of infralabials not in contact behind symphysial due to presence of two postmentals; (5) 186–204 ventrals in males, 176–193 in females; (6) 130–143 divided subcaudals in males, 109–128 in females; (7) dorsal background color olive to yellow with maroon (black in juveniles) bands (1–2 dorsal scales long mid-dorsally and 3–5 dorsal scales long on the lower flanks) and a reddish tint along the vertebral line (Figs 2g–i, 4c), ventral surfaces white with encroachment from the dorsal maroon blotches (Fig. 8b), dorsal aspect of head composed of blackish symmetrical markings on a red background color (Fig. 5d), throat white with broad brownish blotches, iris rich reddish brown; (8) 308–464 mm SVL in males, 329–368 mm in females; (9) 167–233 mm TL in males, 175–183 mm in females.

Comparisons.

Sibonmarleyae sp. nov. is compared to other species of Sibon previously subsumed under S.annulatus sensu lato (differences summarized in Table 2). From S.annulatus sensu stricto, the new species differs in having maroon bands usually broken along vertebral line rather than bands extending over the entire dorsal and lateral surfaces, a bright reddish coloration along the mid-dorsum and on the top of the head (Figs 4c, 5d, 8a), and a higher number of ventral scales in males and females (Table 2). Sibonmarleyae sp. nov. differs from S.canopy sp. nov. by having two postmental scales (instead of only one), a higher number of ventrals in males and females, a pattern of symmetrical (rather than irregular and asymmetrical) markings on the dorsal surface of the head (Fig. 5), and by lacking maroon spots enclosed in the dorsal olive interspaces (Figs 2g–i, 4c). Sibonmarleyae sp. nov. differs from S.irmelindicaprioae sp. nov. primarily by having a pattern of broad blackish markings on the head instead of a finely variegated pattern and by having a higher number of ventrals and subcaudals in both males and females (Table 2).

Description of holotype.

Adult male, SVL 335 mm, tail length 167 mm (49.8% SVL); head length 12.8 mm (3.8% SVL) from tip of snout to angle of jaw; head width 7.6 mm (59% head length) taken at broadest point; snout-orbit distance 3.1 mm; head distinct from neck; snout short, blunt in dorsal outline and rounded in profile; rostral 2.1 mm wide, higher than broad; internasals 1.3 mm wide, broader than long; prefrontals 1.6 mm wide, longer than broad, entering orbit; supraocular 2.8 mm long, longer than broad; frontal 2.9 mm long, pentagonal and with a straight anterior border, in contact with prefrontals, supraoculars, and parietals; parietals 4.3 mm long, longer than broad; nasal divided, in contact with two supralabials, loreal, prefrontal, internasal, and rostral; loreal 1.2 mm long, longer than high, entering the orbit; eye diameter 2.9 mm; pupil semi-elliptical; no preocular; two postoculars; temporals 1+2; seven supralabials with 4th and 5th contacting orbit; symphysial precluded from contacting chinshields by the presence of two small postmentals; eight infralabials with 2nd–6th contacting chinshields on the right side, nine infralabials with 2nd–7th contacting chinshields on the left side; two pairs of chinshields longer than wide; dorsal scales in 15/15/15 rows, smooth, without apical pits; 204 ventrals; 132 divided subcaudals; cloacal plate entire.

Natural history.

Specimens of Sibonmarleyae sp. nov. have been found at night foraging on shrubs and trees 1–6 m above the ground in old-growth evergreen lowland/foothill forests, particularly along streams and small rivers. Snakes of this species are docile and never attempt to bite. When threatened, individuals may hide the head among body coils and produce a musky and distasteful odor. One female (Fig. 2h) from the type locality laid two eggs in a terrarium. After an incubation period of 80 days, one of the eggs hatched (Fig. 2i).

Distribution.

Sibonmarleyae sp. nov. is known from 17 localities (listed in Suppl. material 2) along the Chocoan lowlands and adjacent foothills of the Andes in Ecuador and Colombia, with populations on the coastal mountain ranges Mache-Chindul and Cerro Pata de Pájaro in Ecuador. The species has been recorded at elevations 131–1338 m above sea level (Fig. 6).

Etymology.

The specific epithet marleyae is a patronym honoring a young nature lover, Marley Sheth, the 11-year old daughter of Brian and Adria Sheth, both long-time supporters of biodiversity conservation around the world.

Conservation status.

We consider Sibonmarleyae sp. nov. to be included in the Least Concern category following IUCN Red List criteria (IUCN 2001) because the species is distributed over a region of the Chocó biome that holds large areas of continuous unspoiled forest. Based on the species distribution model presented in Fig. 6 in combination with maps of vegetation cover of Colombia (IDEAM 2014) and Ecuador (MAE 2012), we estimate that more than half (~ 55%) of the species’ forest habitat is still standing. Unfortunately, vast areas of the Chocó rainforest in western Ecuador have already been converted to pastures (Myers et al. 2000). However, S.marleyae sp. nov. occurs over an area greater than 25,000 km2 and is presumably not declining fast enough to qualify for a threatened category.

. Sibon vieirai sp. nov.

5413F02B-73CA-5BCD-B81B-A3D733EDEC50

https://zoobank.org/AEE40456-E5FB-492E-822E-C8667E6874B6

Figs 4d , 9 , 10b–d , 11a, b Proposed standard English name: Vieira’s Snail-eating Snake Proposed standard Spanish name: Culebra caracolera de Jose Vieira

Figure 9.

Figure 9.

Adult male holotype of Sibonvieirai sp. nov. ZSFQ 5071 in a dorsal and b ventral view.

Figure 10.

Figure 10.

Photographs of species of the Sibonnebulatusleucomelas complex in life aS.leucomelas from Morromico Reserve, Chocó department, Colombia bS.vieirai sp. nov. ZSFQ 5073 from Hacienda Cerro Chico, Los Ríos province, Ecuador cS.vieirai sp. nov. from Tundaloma Lodge, Esmeraldas Province, Ecuador dS.vieirai sp. nov. holotype ZSFQ 5071 from Tundaloma Lodge, Esmeraldas Province, Ecuador.

Figure 11.

Figure 11.

Differences in throat color pattern between species of the Sibonnebulatusleucomelas complex aS.vieirai sp. nov. ZSFQ 5073 from Hacienda Cerro Chico, Los Ríos province, Ecuador bS.vieirai sp. nov. holotype ZSFQ 5071 from Tundaloma Lodge, Esmeraldas Province, Ecuador cS.leucomelasCZI-R075 from Represa Murrapal, Valle del Cauca department, Colombia dS.leucomelasCZI-R029 from Campamento Yatacué, Valle del Cauca department, Colombia.

Type material.

Holotype: ZSFQ 5071 (Figs 9, 10d, 11b), adult male collected by Jose Vieira, Frank Pichardo, and Matteo Espinosa on 28 February 2021 at Tundaloma Lodge, Esmeraldas Province, Ecuador (1.18166, -78.74945; 74 m a.s.l.).

Paratypes: MZUA.RE.0328, adult male collected at Jauneche, Los Ríos province, Ecuador (-1.33333, -79.58333; 41 m a.s.l.). MZUTI 4810, adult female collected by Jaime Culebras on 14 February 2016 at Bosque Privado El Jardín de los Sueños, Cotopaxi province, Ecuador (-0.83142, -79.21337; 349 m a.s.l.). ZSFQ 5070, adult male collected by Alejandro Arteaga and Jose Vieira on 12 March 2018 at La Primavera, Carchi province, Ecuador (0.79502, -78.21763; 1228 m a.s.l.). MZUTI 3911, juvenile male collected by Jaime Culebras on 11 November 2014 at Itapoa Reserve, Esmeraldas Province, Ecuador (0.51307, -79.13401; 321 m a.s.l.). MZUTI 5342, adult male collected by Jorge Vaca on 27 May 2017 at Reserva Jama Coaque, Manabí province, Ecuador (-0.11556, -80.12472; 299 m a.s.l.). ZSFQ 5073, adult male collected by Jose Vieira on 23 August 2020 at Hacienda Cerro Chico, Los Ríos province, Ecuador (-0.63862, -79.42585; 141 m a.s.l.). USNM 285499, juvenile male collected by Roy McDiarmid on 1 January 1979 at Centro Científico Río Palenque, Los Ríos province, Ecuador (-0.58333, -79.36667; 173 m a.s.l.). USNM 285501, adult male collected by Roy McDiarmid on 10 March 1979 at Hacienda Cerro Chico, Los Ríos province, Ecuador (-0.63862, -79.42585; 141 m a.s.l.). USNM 283534, adult of undetermined sex collected on 6 June 1981 at Rancho Santa Teresita, Santo Domingo de los Tsáchilas province, Ecuador (-0.25277, -79.37946; 288 m a.s.l.). USNM 285498, adult of undetermined sex collected by Roy McDiarmid on 23 May 1976 at Centro Científico Río Palenque, Los Ríos province, Ecuador (-0.58333, -79.36667; 173 m a.s.l.). USNM 285500, adult of undetermined sex collected by Roy McDiarmid on 2 February 1976 at Centro Científico Río Palenque, Los Ríos province, Ecuador (-0.58333, -79.36667; 173 m a.s.l.). MZUA.RE.0174, adult female collected at Macul, Los Ríos province, Ecuador (-1.1298, -79.65731; 65 m a.s.l.).

Diagnosis.

Sibonvieirai sp. nov. is placed in the genus Sibon based on phylogenetic evidence (Fig. 1a) and on having the penultimate supralabial conspicuously higher than all other supralabials. The species is diagnosed based on the following combination of characters: (1) 15/15/15 smooth dorsals with enlarged vertebral row (1.4–3× as wide as adjacent rows); (2) loreal and prefrontal in contact with orbit; (3) 7–8 supralabials with, usually, 4th, 5th, and occasionally 6th contacting orbit; (4) 9–10 infralabials with 1st to 6th in contact with chinshields, first pair of infralabials in contact behind symphysial; (5) 183–195 ventrals in males, 178–189 in females; (6) 95–105 divided subcaudals in males, 78–92 in females; (7) dorsal background color slate gray to brownish gray with faint blackish blotches or incomplete bands bordered by a series of white dots, fine blackish and white speckling in the interspaces (Figs 4d, 9a, 10b–d), ventral surfaces white with encroachment from the dorsal blackish blotches and with or without fine black speckles in-between the blotches (Fig. 9b), dorsal aspect of head black with fine white speckles, throat white with various amounts of black markings that form a checkerboard pattern (Fig. 11a, b), iris pale gray finely variegated with black; (8) 363–542 mm SVL in males, 352–544 mm in females; (9) 127–224 mm TL in males, 113–170 mm in females.

Comparisons.

Sibonvieirai sp. nov. is most similar to S.leucomelas, from which it differs primarily on the basis of coloration (differences summarized under Table 3). In S.vieirai sp. nov. (Figs 4d, 10b–d), the complete black and pale dorsal bands typical of S.leucomelas (Fig. 10a) are usually absent. Instead, the white “bands” are formed by series of white spots and the black bands are faint and incomplete. The color of the pale “bands” also differs between species: rosy white in S. leucomelas and white in S.vieirai sp. nov. (Fig. 10). In S.vieirai sp. nov the throat has a checkerboard pattern of black and white markings whereas in S.leucomelas it is entirely black with fine white speckling (Fig. 11). Overall, specimens assignable to S.leucomelas have a greater number of ventral scales than Sibonvieirai sp. nov. in both males and females, although there is overlap in the counts (Table 3). Sibonvieirai sp. nov. differs from S.bevridgelyi by having white (instead of golden yellow) dorsal markings on a primarily gray (instead of rusty brown to deep maroon) background color. Arteaga at al. (2018) presented an in-depth comparison between S.bevridgelyi and Sibonvieirai sp. nov. (reported as S.nebulatus from Ecuador).

Table 3.

Differences in coloration, scale counts, and size between Sibonleucomelas and S.vieirai sp. nov. The range of each continuous variable is from our own sample, Boulenger 1896, and Frazier et al. (2006). The numbers in parentheses represent the sample size.

Variable Sibonleucomelas Sibonvieirai sp. nov.
White dorsal bands Distinct, 1–2 scales wide Incomplete, broken into dots
Complete black bands extending over the entire dorsal and lateral surfaces Present, distinct Usually absent; if present, indistinct and broken
Color of pale dorsal markings Rosy white White
Throat pattern Entirely black with fine white speckling Checkerboard, with large black and white markings
Sex Males (n = 5) Females (n = 7) Males (n = 8) Females (n = 5)
Maximum TOL 809 mm 700 mm 732 mm 714 mm
Ventral scales 190–198 187–194 183–195 178–189
Subcaudal scales 86–101 84–100 95–105 78–92

Description of holotype.

Adult male, SVL 515 mm, tail length 199 mm (38.6% SVL); head length 20.7 mm (4.0% SVL) from tip of snout to angle of jaw; head width 11.6 mm (55% head length) taken at broadest point; snout-orbit distance 4.9 mm; head distinct from neck; snout short, blunt in dorsal outline and rounded in profile; rostral 3.8 mm wide, higher than broad; internasals 2.1 mm wide, broader than long; prefrontals 3.4 mm wide, slightly broader than long, entering orbit; supraocular 3.6 mm long, longer than broad; frontal 4.3 mm long, with a rounded triangular shape, in contact with prefrontals, supraoculars, and parietals; parietals 6.4 mm long, longer than broad; nasal divided, in contact with two supralabials, loreal, prefrontal, internasal, and rostral; loreal 2.3 mm long, longer than high, entering the orbit; eye diameter 3.9 mm; pupil semi-elliptical; no preocular; two postoculars; temporals 1+2; seven supralabials with 4th and 5th contacting orbit; symphysial precluded from contacting chinshields by first pair of infralabials; nine infralabials with 1st–6th contacting chinshields; two pairs of chinshields longer than wide; dorsal scales in 15/15/15 rows, smooth, without apical pits; 195 ventrals; 105 divided subcaudals; cloacal plate entire.

Natural history.

Specimens of Sibonvieirai sp. nov. have been found in old growth to heavily disturbed evergreen lowland/foothill forests as well as in rural gardens and plantations. Active snakes have been seen at night foraging at ground level or on vegetation up to 3 m above the ground. One snake was spotted as it emerged from under a pile of logs at sunset. Based on our own field experience, individuals appear to be more active when it is raining or drizzling. In the field in Ecuador, specimens of S.vieirai sp. nov. have been observed feeding on slugs and snails. A female from Hostería Selva Virgen, Pichincha province, Ecuador laid a clutch of four eggs.

Distribution.

Sibonvieirai sp. nov. is known from at least 95 localities (listed in Suppl. material 2) along the Chocoan lowlands and adjacent foothills of the Andes in northwestern Ecuador and southwestern Colombia. Previous records of S.nebulatus from the rainforests of northwestern Ecuador as well as those of the Pacific lowlands of Colombia in Nariño department almost surely correspond to this new species. Sibonvieirai sp. nov. occurs over an estimated 58,551 km2 area and has been recorded at elevations 5–1803 m above sea level (Fig. 12).

Figure 12.

Figure 12.

Distribution of species of Sibon previously subsumed under S.nebulatusleucomelas. Black symbols represent type localities; white symbols other localities listed in Suppl. material 2. Colored areas show the extent of suitable environmental conditions for each species.

Etymology.

The specific epithet vieirai is a patronym honoring Jose Vieira, a Venezuelan biologist and wildlife photographer who created the Ex-Situ project, a free-access photo bank depicting Latin American fauna on a white background. Jose Vieira’s photos have been crucial in illustrating field guides about herpetofauna, educational posters, and research publications. Most of the images in this work were created by Jose Vieira. Additionally, after nearly six years of active collaboration with one of us (AA), it has become evident that Jose is one of the most tireless and focused young field biologists ever to sample the jungles of the tropics, a work ethic that has resulted in the generation of photo and museum vouchers for hundreds of poorly studied species of herpetofauna, including the holotype of this new Sibon.

Conservation status.

We consider Sibonvieirai sp. nov. to be included in the Least Concern category following IUCN Red List criteria (IUCN 2001) because the species is distributed over a region of the Chocó biome that holds large areas of continuous unspoiled forest. Based on the species distribution model presented in Fig. 12 in combination with maps of vegetation cover of Colombia (IDEAM 2014) and Ecuador (MAE 2012), we estimate that more than half (~ 51%) of the species’ forest habitat is still standing. Unfortunately, vast areas of the Chocó rainforest in western Ecuador have already been converted to pastures (Myers et al. 2000). However, S.vieirai sp. nov. occurs over an area greater than 50,000 km2 and is presumably not declining fast enough to qualify for a threatened category.

. Dipsas welborni sp. nov.

452868F0-F4B8-572A-8F34-A792D5F30810

https://zoobank.org/8F1C3963-FB25-4C98-81E9-714727A4CCEF

Figs 4f , 13 , 14a , 15a Proposed standard English name: Welborn’s Snail-eating Snake Proposed standard Spanish name: Culebra caracolera de Welborn

Figure 13.

Figure 13.

Male holotype of Dipsaswelborni sp. nov. MZUTI 3663 in a dorsal and b ventral view.

Figure 14.

Figure 14.

Photographs of species of Dipsas previously subsumed under D.vermiculataaD.welborni sp. nov. paratype ZSFQ 5060 from Vía a Nuevo Paraíso, Zamora Chinchipe province, Ecuador bD.vermiculataZSFQ 5059 from Tamandúa Reserve, Pastaza province, Ecuador cD.vermiculataZSFQ 5064 from Narupa Reserve, Napo province, Ecuador dD.vermiculataZSFQ 5061 from Narupa Reserve, Napo province, Ecuador.

Figure 15.

Figure 15.

Difference in the condition of the prefrontal scale between Dipsaswelborni sp. nov. and D.vermiculataa divided in Dipsaswelborni sp. nov. holotype MZUTI 3663 b fused in D.vermiculataZSFQ 5061.

Type material.

Holotype: MZUTI 3663 (Figs 13, 15a), adult male collected on 2 July 2014 at Reserva Maycu, Zamora Chinchipe province, Ecuador (-4.20719, -78.63987; 960 m a.s.l.).

Paratypes: MZUA.RE.0261, adult male collected at Nangaritza, Zamora Chinchipe province, Ecuador (-4.43169, -78.63869; 996 m a.s.l.). DHMECN 11197, juvenile male collected by Raquel Betancourt and Miguel Alcoser on 18 September 2012 at Concesión ECSA, Zamora Chinchipe province, Ecuador (-3.57245, -78.46982; 790 m a.s.l.). ZSFQ 5060 (Figs 4f, 14a), female collected by Alejandro Arteaga and Amanda Quezada at Maycu Reserve, Zamora Chinchipe province, Ecuador (-4.26395, -78.64483; 1078 m a.s.l.).

Diagnosis.

Dipsaswelborni sp. nov. is placed in the genus Dipsas based on phylogenetic evidence (Fig. 1b) and the absence of a labial that is noticeably higher than other labials. The species is diagnosed based on the following combination of characters: (1) 13/13/13 smooth dorsals with enlarged vertebral row (1.8–2.1× as wide as adjacent rows); (2) loreal and a preocular in contact with orbit; (3) 7–8 supralabials with 4th, 5th, and occasionally 6th, contacting orbit; (4) 8–9 infralabials with 1st to 5th or to 6th in contact with chinshields, one pair of infralabials in contact behind symphysial; (5) 181–193 ventrals in males, 177–179 in females; (6) 107–116 divided subcaudals in males, 105–106 in females; (7) dorsal color consisting of 21–26 dark brown to blackish body blotches (8–13 dorsal scales long anteriorly and 2–5 dorsal scales long posteriorly) separated from each other by narrow (2–3 dorsal scales long) pale brown interspaces that become white towards the lower lateral side, ventral surfaces white with encroachment from the dorsal dark brown blotches and with smaller brownish marks in-between the blotches, dorsal aspect of head dark reddish brown with fine bright yellow (juveniles) to light brown (adults; Fig. 15a) reticulations, throat white, iris pale brown; (8) 491–542 mm SVL in males, 321–595 mm in females; (9) 190–279 mm TL in males, 132–281 mm in females.

Comparisons.

Dipsaswelborni sp. nov. differs from the majority of its congeners by having dorsal scales arranged in 13/13/13 rows, loreal entering the orbit, and dorsum of head strongly vermiculated. The new species is most similar to D.vermiculata, from which it differs on the basis of the following characters of coloration and lepidosis (Fig. 14; Table 4). In D.welborni sp. nov., there are two prefrontal scales (partially fused in ZSFQ 5060) whereas in all specimens of D.vermiculata examined (Suppl. material 1) as well as the four Ecuadorian specimens reported in Peters (1960), the prefrontals are fused into a single scale (Fig. 15). Females of Dipsaswelborni sp. nov. have more ventrals (177–179) and subcaudals (105–106) than those of D.vermiculata (173–174 ventrals and 99–103 subcaudals). Females of the new species attain a larger body size than those of D.vermiculata (Table 4), and males of the former also have more rows of spines on the asulcate surface of the hemipenis body (the hemipenis of D.vermiculata is depicted in Vera-Pérez 2020 whereas the organs of four males of D.welborni sp. nov. are depicted in Pazmiño-Otamendi et al. 2020). Finally, the two species further differ in the background color of the ventral surfaces: always white in D.welborni sp. nov. (Fig. 13b), and usually yellow or occasionally pale yellowish white in D.vermiculata.

Table 4.

Differences in coloration, scale counts, and size between Dipsasvermiculata and D.welborni sp. nov. The range of each continuous variable is from our own sample, Peters (1960), and Vera-Pérez (2020). The numbers in parentheses represent the sample size.

Variable Dipsasvermiculata Dipsaswelborni sp. nov.
Background color of ventral surfaces Always white Usually yellow, occasionally pale yellowish white
Prefrontals fused No (partially fused in ZSFQ 5060) Yes
Rows of spines on hemipenis body (asulcate surface) 1–2 rows of curved spines 2 rows of straight spines followed by 2–3 rows of curved spines
Sex Males (n = 8) Females (n = 3) Males (n = 7) Females (n = 3)
Maximum SVL 515 mm 501 mm 542 mm 595 mm
Maximum TOL 735 mm 701 mm 689 mm 876 mm
Ventral scales 181–192 173–174 181–193 177–179
Subcaudal scales 103–113 99–103 107–116 105–106

Description of holotype.

Adult male, SVL 542 mm, tail length 195 mm (incomplete); head length 16.4 mm (3.0% SVL) from tip of snout to angle of jaw; head width 10.2 mm (62% head length) taken at broadest point; snout-orbit distance 3.8 mm; head distinct from neck; snout short, blunt in dorsal outline and rounded in profile; rostral 2.4 mm wide, higher than broad; internasals 1.8 mm wide, broader than long; prefrontals 2.7 mm wide, longer than broad, not entering orbit; supraocular 3.8 mm long, longer than broad; frontal 4.1 mm long, hexagonal and with angled anterior border, in contact with prefrontals, supraoculars, and parietals; parietals 5.5 mm long, longer than broad; nasal divided, in contact with two supralabials, loreal, prefrontal, internasal, and rostral; loreal 2.1 mm long, longer than high, entering the orbit; eye diameter 3.4 mm; pupil semi-elliptical; one small preocular above loreal; two postoculars; temporals 2+2; seven supralabials with 4th–5th contacting orbit; symphysial precluded from contacting chinshields by first pair of infralabials; nine infralabials with 1st to 5th contacting chinshields; three pairs of chinshields, first longer than wide; dorsal scales in 13/13/13 rows, smooth, without apical pits; 185 ventrals; 80+ divided subcaudals; cloacal plate entire.

Natural history.

Specimens of Dipsaswelborni sp. nov. have been found foraging on vegetation 20–350 cm above the ground in old-growth to moderately disturbed evergreen montane forests. Snakes of this species are docile and never attempt to bite. When threatened, individuals may flatten their body and expand their head to simulate a triangular shape as well as produce a musky and distasteful odor.

Distribution.

Dipsaswelborni sp. nov. is known from 26 localities (listed in Suppl. material 2) along the Cordillera del Cóndor in southeastern Ecuador (provinces Morona Santiago and Zamora Chinchipe) and northern Peru (Amazonas department). The species occurs over an estimated area of 10,521 km2 and has been recorded at elevations 853–1843 m above sea level (Fig. 16). One locality, Etseketai Entse, Amazonas department, Peru, is in the Río Cenepa valley at ~ 245 m above sea level. Since this locality is much lower in elevation than other localities in the Cordillera del Cóndor, it is likely that the specimens collected there (USNM 316599–600) were actually found on the neighboring mountain ridges.

Figure 16.

Figure 16.

Distribution of species of Dipsas previously subsumed under D.vermiculata. Black symbols represent type localities; white symbols other localities listed in Suppl. material 2. Colored areas show the extent of suitable environmental conditions for each species.

Etymology.

The specific epithet welborni is a patronym honoring David Welborn, a lifelong champion of ecosystem and species conservation who supports and serves on several nonprofit boards dedicated to the environment. David retired from the board of Nature and Culture International in 2021 after 18 years of service, including four as board chairman. Nature and Culture International, a non-profit organization, has conserved more than 9 million hectares of tropical Latin American ecosystems, including key habitat in the Maycu Reserve of southeastern Ecuador, where Dipsaswelborni sp. nov. was discovered.

Conservation status.

We consider Dipsaswelborni sp. nov. to be in the Near Threatened category following IUCN Red List criteria (IUCN 2001) because the species is distributed over a region of the Amazonian slopes of the Andes that holds large areas of continuous unspoiled forest. Based on the species distribution model presented in Fig. 16 in combination with the most recent maps of vegetation cover of the Amazon basin (MapBiomas Amazonía 2022), we estimate that the majority (~ 76%) of the species’ forest habitat in Ecuador is still standing. Unfortunately, vast areas of the Cordillera del Cóndor, notably on the Ecuadorian part of the species’ range, are being cleared to make room for large-scale opencast mining operations (Chicaiza 2010; Valencia et al. 2017). However, since D.welborni sp. nov. occurs over an area greater than 10,000 km2, the species does not qualify for a threatened category.

Presence of Sibonayerbeorum in Ecuador and Valle del Cauca, Colombia

We expand the distribution of Sibonayerbeorum, a species previously known only from departments Cauca (Vera-Pérez 2019), Chocó (Echavarría-Rentería and Medina-Rangel 2021), and Risaralda (Bonilla and Moya 2021) in Colombia. We examined three additional specimens (listed in Suppl. material 1) at Colección Zoológica de la Universidad ICESI (labeled CZI) and at ZSFQ that represent, respectively, new records for Valle del Cauca department in Colombia and Esmeraldas province in Ecuador. CZI-R063 is a juvenile male collected by Santiago Orozco on 17 August 2019 at La Loca, Valle del Cauca department, Colombia (3.57656, -76.88029; 658 m a.s.l.). CZI-R067 is a juvenile male collected by Santiago Orozco on 30 August 2019 at La Riqueza, Valle del Cauca department, Colombia (3.59874, -76.89184; 621 m a.s.l.). ZSFQ 5066 (Fig. 2f) is a juvenile male collected by Jose Vieira, Daniela Franco, and Alex Mora on 4 December 2019 at Reserva Biológica Canandé, Esmeraldas Province, Ecuador (0.49531, -79.17832; 560 m a.s.l.). These specimens agree in coloration and lepidosis with the description of S.ayerbeorum presented in Vera-Pérez 2019 (expanded in Echavarría-Rentería and Medina-Rangel 2021), most notably in having a much lower (fewer than 160) number of ventral scales than any other sympatric Sibon species, vertebral scale row not noticeably wider than adjacent rows, postmentals absent, dorsal coloration green to grayish brown with black-bordered reddish markings, and ventral coloration consisting of a checkerboard pattern of yellowish white markings interspersed with blackish markings. We also report an individual of S.ayerbeorum photographed (https://www.inaturalist.org/photos/179847493; DHMECN 14936) by Mateo Vega on July 21, 2019 at Comunidad El Baboso, Carchi province, Ecuador (0.89972, -78.44797; 803 m). We did not examine this specimen, but the photograph agrees in coloration with the variation reported for this species in Vera-Pérez (2019) and Echavarría-Rentería and Medina-Rangel (2021). The updated distribution of S.ayerbeorum is shown in Fig. 17 and includes both published records as well as new localities reported here (summarized in Suppl. material 2).

Figure 17.

Figure 17.

Distribution of Sibonayerbeorum showing previously known (circles) and new records (triangles).

Supplementary Material

XML Treatment for Sibon irmelindicaprioae
XML Treatment for Sibon canopy
XML Treatment for Sibon marleyae
XML Treatment for Sibon vieirai
XML Treatment for Dipsas welborni

Acknowledgements

This article was greatly improved by comments of Sebastian Lotzkat, Julie M. Ray, and Robert Jadin. For granting access to the protected forests under their care, we are grateful to Daniel Arias and Raúl Arias of the Canopy Family lodges, to Martin Schaefer and David Agro of Fundación Jocotoco, and to Matthew Clark, Renzo Paladines, and Felipe Serrano of Nature and Culture International. For providing DNA sequence data of Sibon and the enigmatic Dipsasperijanensis, we are grateful to Elson Meneses-Pelayo (UIS). For granting access to specimens under their care, we are grateful to David Salazar-Valenzuela (MZUTI), Gustavo Adolfo Londoño Guerrero (CZI), Wilmar Bolívar (CPZ-UV), and Raúl Sedano (UV-C). Locality data and morphometrics of S.annulatus from Costa Rica were kindly provided by Todd Lewis, Alexander McKelvy, and Alex Figueroa. Special thanks to Jose Vieira, Frank Pichardo, Amanda Quezada, Valeria Sorgato, and Eric Osterman for their assistance and companionship in the field. Angie Tovar-Ortiz, Santiago Orozco, and Paul Gutiérrez-Cárdenas provided specimen photos and ecological information of Dipsadini. In-situ images of the new species were kindly provided by Eric Osterman, Pearl Ee, and Ariel Concepción. White background images of living specimens were created by Jose Vieira and Sebastián Di Doménico. Diego Quirola (MZUTI) provided images of the holotype of D.welborni sp. nov.; Manlio Cuevas, Joseph Vargas, and Pablo Acosta photographed museum specimens of the type series of S.irmelindicaprioae sp. nov., S.canopy sp. nov., and S.leucomelas; Joseph Vargas and Madian Miranda provided measurements and counts of specimens at SMF and MHCH, respectively. Gabriela Gavilanes provided invaluable lab assistance in generating DNA sequence data; Lorena Benitez created the topographical maps. Fieldwork was made possible with the support of Re:wild, Nature and Culture International, The Explorers Club Discovery Expedition Grants, Khamai Foundation, Tropical Herping, and Canopy Family lodges. Laboratory work was carried out at ZSFQ under the tutelage of Juan M. Guayasamin. Sequencing was made possible with support of the Inédita Program from the Ecuadorian Science Agency SENESCYT (Respuestas a la Crisis de Biodiversidad: La Descripción de Especies como Herramienta de Conservación; INEDITA PIC-20-INE-USFQ-001). Work by AB was supported by Sistema Nacional de Investigación (SNI) of the Secretaría Nacional de Ciencia, Tecnología e Innovación (SENACYT, Panamá).

Appendix 1

Table A1.

GenBank accession numbers for loci and terminals of taxa and outgroups sampled in this study. Novel sequence data produced in this study are marked with an asterisk (*).

Species Voucher 12S 16S COI CYTB ND4 DNAH3 NT3
Atractusukupacha QCAZ 4944 MH790540 MN887689 MN887714
Dipsasalbifrons MZUSP 13993 JQ598803 JQ598866 JQ598925
Dipsasandiana MZUTI 3505 MH341010 MH374974
Dipsasarticulata USNM 348490 JQ598804 MH140680 MH140122
Dipsasbobridgelyi MZUTI 5414 MH341016 MH374984
Dipsasbucephala GRCOLLI 25659 MH341087 MH341018 MH375026 MH375052
Dipsascatesbyi QCAZ 13558 MH341088 MH341019 MH374975 MH375042
Dipsaselegans MZUTI 3317 MH341021 MH375033
Dipsasellipsifera MZUTI 4931 MH341024 MH375030
Dipsasgaigeae JAC 28587 JX398613 JX398462 JX293850 JX398735
Dipsasgeorgejetti MZUA.RE.121 MH341025 MH375024
Dipsasgracilis MZUTI 3331 MH341030 MH374995
Dipsasindica QCAZ 13305 MH341089 MH341037 MH375006 MH375043
Dipsasjamespetersi QCAZ 9190 MH341042 MH375014
Dipsasklebbai MZUTI 5412 MH341045 MH374977
Dipsas sp. CH 8479 MH140683
JM 663 MH140698 JX398625 JX398475
JM 664 MH140697 JX398626 JX398476
JM 758 JX398627 JX398477 JX398752
JM 795 MH140692 JX398628 JX398478 JX398753
SMF 97346 OP879850*
Dipsasmikanii MZUSP 14658 GQ457832 GQ457771 KX694855
Dipsasneuwiedi MZUSP 13972 JQ598838 JQ598898
Dipsasnicholsi JM 812 JX398619 JX398469
Dipsasoligozonata MZUA.RE.081 MH341050 MH375029
Dipsasoreas MZUTI 5418 MH341054 MH374981
Dipsaspakaraima USNM 561837 MH273777
Dipsaspalmeri QCAZ 13304 MH341092 MH341065 MH375009 MH375046
Dipsaspavonina MZUTI 4972 MH341068 MH374983
Dipsasperijanensis UIS R-4180 OP897299*
Dipsasperuana LSUMZ 1532 JX398622 JX398472 JX293856 JX398750
Dipsaspratti MBUCV 6837 JX398624 JX398473 JX398751
Dipsastemporalis MHCH 2878 OP879851* OP873116*
MHUA 14278 GQ334482 GQ334583 GQ334667
QCAZ 5050 MH341069 MH375003
SMF 97343 OP873117*
Dipsastrinitatis UWIZM 2011.20.25 JX398629 JX398479
Dipsasturgida LSUMZ 6458 JQ598839 KX660279 JX398696 JX398556 JX293899 JX398819
Dipsasvagus KU 219121 KX660252
Dipsasvariegata UTA R-15772 JX398601 JX398482 JX293858 JX398736
Dipsasventrimaculata MCP 4870 JQ598840 JQ598900
Dipsasvermiculata MZUTI 4738 OP839489* OP879846* OP897291*
QCAZ 13563 MH341095 MH341071 MH374972 MH375049
QCAZ 13582 MH341096 MH341072 MH375040
ZSFQ 5059 OP839490* OP879847* OP897289* OP897293*
ZSFQ 5061 OP839491* OP879848* OP897290* OP897292*
Dipsasviguieri MHCH 2875 OP879852* OP873118*
Dipsaswelborni sp. nov. MZUTI 3663 MH341070 MH374989 OP897294*
QCAZ 13825 MH341073 MH374973 MH375050
UTA R-55939 JX398632 JX398483 JX293859 JX398754
Dipsaswilliamsi CORBIDI 12695 MH374968 MH375041
Geophisannuliferus JAC 27792 JX398699 JX398559 JX293914
Geophisbicolor MX29-53 JX398637 JX398487 JX293862 JX398759
Geophisnigrocinctus JAC 30704 JX398638 JX398488
Geophisomiltemanus ENS 11496 JX398639 JX398760
Geophissanniolus MX21-36 JX398692 JX398553 JX293895 JX398815
Geophissartorii USNM 564144 JX398717 JX398585 JX293912 JX398831
Geophistarascae MX28-19 JX398640 JX398489 JX293870 JX398761
Sibonaff.hartwegi ICN 11463 JX398532
ICN 11510 JX398533 JX398803
Sibonaff.nebulatus CH 6614 MH140390
UTA R-42429 JX398534 JX293887
JAC 28055 JX398678 JX398535 JX293889
JAC 28140 JX398536 JX293893
JAC 28589 JX398537 JX293894
JAC 30102 JX398538
MVZ 233298 EU728583 EU728583 EU728583 EU728583 EU728583 FJ455221 FJ455189
N068 JX398682 JX398542 JX398807
USNM 564142 JX398547 JX398810
USNM 564143 JX398548 JX398811
UTA R-42431 JX398690 JX398549 JX293891 JX398812
Sibonannulatus ADM 242 KX660169 KX660443 KX660572 KX651996
ADM0007 KX660170 KX660444 KX660573 KX651997
B45-57 JX398499 JX398770
D167 JX398652 JX398501 JX293869 JX398772
MVZ 269290 MH341097 MH341074 MH375034 MH375053
N740 JX398505 JX398777
Sibonanthracops MVZ 215680 MH341098 MH341076 MH375035 MH375054
Sibonargus USNM 579852 MH140960 MH140380 JX398662 JX398511 JX398783
Sibonayerbeorum ZSFQ 5066 OP839492* OP879849* OP897298*
Sibonbevridgelyi MZUA.RE.424 MH374990
MZUTI 3269 MH341077 MH374962
MZUTI 5416 MH341078 MH374963
RSCDSP 0391 JX398683 JX398543 JX293890 JX398808
Siboncanopy sp. nov. JM 705 MH140951 JX398654 JX398503 JX398774
JM 759 MH140949 JX398655 JX398775
USNM 579846 JX398653 JX398502 JX398773
USNM 579849 MH140947 MH140366 JX398656 JX398504 JX398776
Siboncarri UTA R-45493 JX398665 JX398514 JX293876 JX398786
Sibonirmelindicaprioae sp. nov. MHCH 3111 OP879853*
MHCH 3145 OP879854* OP873119*
MHCH 3146 OP879855* OP873121*
SMF 97586 OP879856* OP873120*
SMF 97587 OP879857*
UIS R-3515 OP897296*
UIS R-3701 OP897297*
Sibondimidiatus USNM 565824 JX398668 JX398517 JX398789
Sibondunni CAMPO 533 MH341079 MH374991
Sibonhartwegi MHUA 14511 GQ334556 GQ334662 GQ334579 GQ334685
SN 0001 JX398684 JX398544 JX293892 JX398809
Sibonlamari ASL 362 JX398670 JX398519
No voucher JX398671 JX398520 JX293879 JX398791
Sibonleucomelas CH 5296 MH140972 MH140392
CH 9135 MH140971 MH140391
JM 703 JX398679 JX398539 JX398804
JM 722 MH140967 JX398680 JX398540 JX398805
MHCH 3149 OP879860*
Sibonleucomelas USNM 579854 MH140393 JX398681 JX398541 JX398806
Sibonlongifrenis MVZ 215681 MH341099 MH375036 MH375055
Sibonmarleyae sp. nov. ZSFQ 5069 OP879861* OP897295*
MZUTI 3034 MH341075 MH375021
Sibonnebulatus SN02 JX398545
UWIZM 2011.20.26 JX398687 JX398551
Sibonperissostichon SMF 88716 JX398688 JX398552 JX293888 JX398814
Sibonvieirai sp. nov. DHMECN 9585 MH341082
ENS 12500 JX398531 JX398802
ENS 12459 JX398530 JX398801
MZUTI 3911 MH341083 MH374964
MZUTI 4810 MH341084 MH374965
Tropidodipsasfasciata MX14 JX398703 JX293901 JX398821
Tropidodipsasfischeri UTA R-38932 JX398707 JX398566 JX293903 JX398823
Tropidodipsasguerreroensis INIRENA 2781 MZ287381 MZ287395 MZ287403 MZ287420
Tropidodipsaspapavericola INIRENA 2805 MZ287392 MZ287392 MZ287400 MZ287418
Tropidodipsasphilipii JAC 24811 JX398710 JX398570 JX293909 JX398826
Tropidodipsastricolor CIG 1837 MZ287386 MZ287394 MZ287404 MZ287415

Appendix 2

Table A2.

List of PCR and sequencing primers and their respective PCR conditions (denaturation, annealing, extension and number of corresponding cycles) used in this study. All PCR protocols included an initial 3-min step at 94 °C and a final extension of 10 min at 72 °C.

Locus Primer Sequence (5’-3’) Reference PCR profile:
12S H1557mod GTACRCTTACCWTGTTACGACTT Zaher et al. 2009 93 °C (1 min), 54 °C (1 min), 72 °C (2–5 min) [x25–40]
L1091mod CAAACTAGGATTAGATACCCTACTAT
16S 16Sar-L CGCCTGTTTATCAAAAACAT Palumbi et al. (1991) 94 °C (45 sec), 53 °C (45 sec), 72 °C (1 min) [x30]
16Sbr-H-R CCGGTCTGAACTCAGATCACGT
COI RepCOI-F TNTTMTCAACNAACCACAAAGA Murphy et al. (2013) 94 °C (3 min), 48.5 °C (30 sec), 72 °C (1 min) [x40]
RepCOI-R ACTTCTGGRTGKCCAAARAATCA
Cytb L14910 GACCTGTGATMTGAAAACCAYCGTTGT Burbrink et al. (2000) 94 °C (1 min), 58 °C (1 min), 72 °C (2 min) [x30–36]
H16064 CTTTGGTTTACAAGAACAATGCTTTA
ND4 ND4 CACCTATGACTACCAAAAGCTCATGTAGAAGC Arévalo et al. (1994) 94 °C (25 sec), 56 or 60 °C (1 min), 72 °C (2 min) [x25–30]
Leu CATTACTTTTACTTGGATTTGCACCA

Citation

Arteaga A, Batista A (2023) A consolidated phylogeny of snail-eating snakes (Serpentes, Dipsadini), with the description of five new species from Colombia, Ecuador, and Panama. ZooKeys 1143: 1–49. https://doi.org/10.3897/zookeys.1143.93601

Funding Statement

Re:wild, Nature and Culture International, The Explorers Club Discovery Expedition Grants, Khamai Foundation, Tropical Herping, Canopy Family lodges, SENESCYT, SENACYT

Supplementary materials

Supplementary material 1

Morphological and locality data for specimens of Dipsadini species examined, either directly, indirectly through digital photographs, or both. Codes: SVL = snout-vent length (mm); TL = tail length (mm); M = Male, F = Female.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Alejandro Arteaga, Abel Batista

Data type

Morphological

Supplementary material 2

Locality data used to create distribution maps. Type localities indicated in bold type.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Alejandro Arteaga, Abel Batista

Data type

Occurrences

References

  1. Aleman C. (1953) Apuntes sobre reptiles y anfibios de la región Baruta-El Hatillo. Memorias de la Sociedad de Ciencias Naturales La Salle 12: 11–30. [Google Scholar]
  2. Arévalo E, Davis SK, Sites JW. (1994) Mitochondrial DNA-sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporusgrammicus complex (Phrynosomatidae) in Central Mexico. Systematic Biology 43(3): 387–418. 10.1093/sysbio/43.3.387 [DOI] [Google Scholar]
  3. Arteaga A, Salazar-Valenzuela D, Mebert K, Peñafiel N, Aguiar G, Sánchez-Nivicela JC, Pyron RA, Colston TJ, Cisneros-Heredia DF, Yánez-Muñoz MH, Venegas PJ, Guayasamin JM, Torres-Carvajal O. (2018) Systematics of South American snail-eating snakes (Serpentes, Dipsadini), with the description of five new species from Ecuador and Peru. ZooKeys 766: 79–147. 10.3897/zookeys.766.24523 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Arteaga A, Bustamante L, Vieira J, Tapia W, Guayasamin JM. (2019) Reptiles of the Galápagos: life on the Enchanted Islands. Tropical Herping, Quito, 208 pp. 10.47051/AQJU7348 [DOI] [Google Scholar]
  5. Barros TR, Jadin RC, Caicedo-Portilla JR, Rivas GA. (2012) Discovery of a rare snail-eater snake in Venezuela (Dipsadinae, Dipsaspratti), with additions to its natural history and morphology. Zoosystematics and Evolution 88(1): 125–134. 10.1002/zoos.201200011 [DOI] [Google Scholar]
  6. Beaupre SJ, Jacobson ER, Lillywhite HB, Zamudio K. (2004) Guidelines for Use of Live Amphibians and Reptiles in Field and Laboratory Research. American Society of Ichthyologists and Herpetologists, Lawrence, 43 pp. [Google Scholar]
  7. Bocourt MF. (1884) Note sur quelques ophidiens nouveaux, provenant de l’Amerique inter- tropicale. Bulletin de la Société Philomathique de Paris 8: 133–142. [Google Scholar]
  8. Boettger O. (1898) Katalog der Reptilien-Sammlung im Museum der Senckenbergischen Naturforschenden Gesellschaft in Frankfurt. Gebr. Knauer, Frankfurt, 140 pp. [Google Scholar]
  9. Bonaparte CL. (1838) Iconografia della Fauna Italica. Per le Quattro Classi degli Animali Vertebrati. Salviucci, Roma, 384 pp. 10.5962/bhl.title.70395 [DOI] [Google Scholar]
  10. Bonilla NS, Moya J. (2021) Herpetofauna del Alto Amurrapá, Santa Cecilia, Risaralda. Instituto de Investigaciones Ambientales del Pacífico John Von Neumann – IIAP. 10.15472/oep3q7 [accessed via GBIF.org on 2022-07-21] [DOI]
  11. Boulenger GA. (1894) Catalogue of the Snakes in the British Museum (Natural History) (Vol. II). Trustees of the British Museum, London, 382 pp. [Google Scholar]
  12. Boulenger GA. (1896) Description of new reptiles and batrachians from Colombia. Annals & Magazine of Natural History 17(97): 16–21. 10.1080/00222939608680317 [DOI] [Google Scholar]
  13. Boulenger GA. (1897) Description of a new snake from the Andes of Colombia. Annals & Magazine of Natural History 20(120): e523. 10.1080/00222939709487395 [DOI]
  14. Boulenger GA. (1898) An account of the reptiles and batrachians collected by Mr. Rosenberg in western Ecuador. Proceedings of the Zoological Society of London 9(1): 107–126. 10.1111/j.1096-3642.1898.tb03134.x [DOI] [Google Scholar]
  15. Boulenger GA. (1911) Descriptions of new reptiles from the Andes of South America, preserved in the British Museum. Annals & Magazine of Natural History 7(37): 19–25. 10.1080/00222931108692903 [DOI] [Google Scholar]
  16. Boulenger GA. (1912) Descriptions of new reptiles from the Andes of South America, preserved in the British Museum. Annals & Magazine of Natural History 10(58): 420–424. 10.1080/00222931208693255 [DOI] [Google Scholar]
  17. Burbrink FT, Lawson R, Slowinski JB. (2000) Mitochondrial DNA phylogeography of the polytypic North American rat snake (Elapheobsoleta): A critique of the subspecies concept. Evolution; International Journal of Organic Evolution 54: 2107–2188. 10.1111/j.0014-3820.2000.tb01253.x [DOI] [PubMed] [Google Scholar]
  18. Cadle JE. (2005) Systematics of snakes in the Dipsasoreas complex (Colubridae: Dipsadinae) in western Ecuador and Peru, with revalidation of D.elegans (Boulenger) and D.ellipsifera (Boulenger). Bulletin of the Museum of Comparative Zoology 158(3): 67–136. 10.3099/0027-4100(2005)158[67:SOSOTD]2.0.CO;2 [DOI]
  19. Cadle JE. (2007) The snake genus Sibynomorphus (Colubridae: Dipsadinae: Dipsadini) in Peru and Ecuador, with comments on the systematics of Dipsadini. Bulletin of the Museum of Comparative Zoology 158(5): 183–283. 10.3099/0027-4100(2007)158[183:TSGSCD]2.0.CO;2 [DOI]
  20. Cadle JE, Myers CW. (2003) Systematics of snakes referred to Dipsasvariegata in Panama and Western South America, with revalidation of two species and notes on defensive behaviors in the Dipsadini (Colubridae). American Museum Novitates 3409: 1–47. [DOI] [Google Scholar]
  21. Caramaschi U, de Sá RO, Heyer WR. (2006) Leptodactylus. Information bank for Leptodactylus frogs. https://facultyhub.richmond.edu [accessed 1 January 2019]
  22. CATHALAC (2011) Mapa Centroamericano de Cobertura y Uso de la Tierra, Cambios de Cobertura y Uso de la Tierra 1980–1990–2000–2010. Programa Regional para la Reducción de la Vulnerabilidad y Degradación Ambiental, Ciudad de Panamá, 166 pp. [Google Scholar]
  23. Cedano-Cruz RE, Gil-Lopez DL, Cediel JL, Lopez A. (2022) Colección de anfibios y reptiles, Universidad del Valle (Colección UV-C). Version 14.2. Universidad del Valle. 10.15472/4nryow [accessed via GBIF.org on 2022-07-22] [DOI]
  24. Chicaiza G. (2010) El Enclave Minero de la Cordillera del Cóndor. Acción Ecológica, Quito, 39 pp. [Google Scholar]
  25. Coloma LA, Guayasamin JM. (2011–2017) Nombres vernáculos de anfibios de Ecuador. http://www.anfibiosecuador.ec
  26. Cope ED. (1863) Descriptions of new American Squamata in the Museum of the Smithsonian Institution. Proceedings. Academy of Natural Sciences of Philadelphia 15: 100–106. [Google Scholar]
  27. Cope ED. (1866) Fourth contribution to the herpetology of tropical America. Proceedings. Academy of Natural Sciences of Philadelphia 18: 123–132. [Google Scholar]
  28. Cope ED. (1868) An examination of the Reptilia and Batrachia obtained by the Orton Expedition to Equador and the Upper Amazon, with notes on other species. Proceedings. Academy of Natural Sciences of Philadelphia 20: 96–140. [Google Scholar]
  29. Daza JM, Smith EN, Páez VP, Parkinson CL. (2009) Complex evolution in the Neotropics: the origin and diversification of the widespread genus Leptodeira (Serpentes: Colubridae). Molecular Phylogenetics and Evolution 53: 653–667. 10.1016/j.ympev.2009.07.022 [DOI] [PubMed] [Google Scholar]
  30. de Queiroz K. (2007) Species concepts and species delimitation. Systematic Biology 56(6): 879–886. 10.1080/10635150701701083 [DOI] [PubMed] [Google Scholar]
  31. Dowling HG. (1951) A proposed standard system of counting ventrals in snakes. British Journal of Herpetology 1: 97–99. [Google Scholar]
  32. Downs FL. (1961) Generic reallocation of Tropidodipsasleucomelas Werner. Copeia 383–387. 10.2307/1439577 [DOI]
  33. Drummond AJ, Ashton B, Buxton S, Cheung M, Cooper A, Heled J, Kearse M, Moir R, Stones-Havas S, Sturrock S, Thierer T, Wilson A. (2021) Geneious version 2021.1. https://www.geneious.com
  34. Duellman WE. (1978) The biology of an equatorial herpetofauna in Amazonian Ecuador. Publications of the Museum of Natural History, University of Kansas 65: 1–352. [Google Scholar]
  35. Echavarría-Rentería JD, Medina-Rangel G. (2021) Range extension of Sibonayerbeorum Vera-Pérez, 2019 (Serpentes: Dipsadidae) in Colombia. Revista Latinoamericana de Herpetología 4(1): 221–225. 10.22201/fc.25942158e.2021.1.190 [DOI] [Google Scholar]
  36. Elith J, Leathwick JR. (2009) Species distribution models: Ecological explanation and prediction across space and time. Annual Review of Ecology, Evolution, and Systematics 40(1): 677–697. 10.1146/annurev.ecolsys.110308.120159 [DOI] [Google Scholar]
  37. Elith J, Phillips SJ, Hastie T, Dudík M, Chee YE, Yates CJ. (2011) A statistical explanation of MaxEnt for ecologists. Diversity & Distributions 17(1): 43–57. 10.1111/j.1472-4642.2010.00725.x [DOI] [Google Scholar]
  38. Felsenstein J. (2004) Inferring Phylogenies. Sinauer Associates, Sunderland, 664 pp. [Google Scholar]
  39. Fernandes R, Porto M, Caramaschi U. (1998) The taxonomic status of Heterorhachispoecilolepis Amaral, 1923. Journal of Herpetology 32(1): 139–141. 10.2307/1565497 [DOI] [Google Scholar]
  40. Fernandes R, Fernandes DS, Passos P. (2002) Leptognathuslatifasciatus Boulenger 1913, a junior synonym of Dipsaspolylepis Boulenger 1912 (Serpentes, Colubridae). Boletim do Museu Nacional 493: 1–7. [Google Scholar]
  41. Fernandes DS, Marques OAV, Argôlo AJS. (2010) A new species of Dipsas Laurenti from the Atlantic Forest of Brazil. Zootaxa 2691(1): 57–66. 10.11646/zootaxa.2691.1.4 [DOI] [Google Scholar]
  42. Fitzinger LJFJ. (1826) Neue Classification der Reptilien Nach Ihren Naturlichen Verwandtschaften. J. G. Heubner, Vienna, 66 pp. 10.5962/bhl.title.4683 [DOI] [Google Scholar]
  43. Fitzinger LJFJ. (1843) Systema Reptilium. Braumüller et Seidel, Wien, 106 pp. 10.5962/bhl.title.4694 [DOI] [Google Scholar]
  44. Frazier JA, Montgomery CE, Lips KR. (2006) Sibonnebulatus (Common Snaileater): Maximum size. Herpetological Review 37: e235.
  45. Grünwald CI, Toribio-Jiménez S, Montaño-Ruvalcaba C, Franz-Chávez H, Peñaloza-Montaño MA, Barrera-Nava EY, Jones JM, Rodriguez CM, Hughes IM, Strickland JL, Reyes-Velasco J. (2021) Two new species of snail-eating snakes of the genus Tropidodipsas (Serpentes, Dipsadidae) from southern Mexico, with notes on related species. Herpetozoa (Wien) 34: 233–257. 10.3897/herpetozoa.34.e69176 [DOI] [Google Scholar]
  46. Günther A. (1858) Catalogue of Colubrine snakes of the British Museum. Taylor and Francis, London, 281 pp. [Google Scholar]
  47. Günther A. (1872) Seventh account of new species of snakes in the collection of the British Museum. Annals & Magazine of Natural History 9(49): 13–37. 10.1080/002229372011951771 [DOI] [Google Scholar]
  48. Harvey MB. (2008) New and poorly known Dipsas (Serpentes: Colubridae) from Northern South America. Herpetologica 64(4): 422–451. 10.1655/07-068R1.1 [DOI] [Google Scholar]
  49. Harvey MB, Embert D. (2008) Review of Bolivian Dipsas (Serpentes: Colubridae), with comments on other South American species. Herpetological Monographs 22(1): 54–105. 10.1655/07-023.1 [DOI] [Google Scholar]
  50. Harvey MB, Rivas G, Caicedo-Portilla JR, Rueda-Almonacid JV. (2008) Systematics of the enigmatic Dipsadine snake Tropidodipsasperijanensis Aleman (Serpentes: Colubridae) and review of morphological characters of Dipsadini. Herpetological Monographs 22(1): 106–132. 10.1655/08-025.1 [DOI] [Google Scholar]
  51. Hijmans RJ, Cameron SE, Parra JL, Jones PG, Jarvis A. (2005) Very high resolution interpolated climate surfaces for global land areas. International Journal of Climatology 25(15): 1965–1978. 10.1002/joc.1276 [DOI] [Google Scholar]
  52. Hoge AR. (1964) Sur la position systématique de quelques serpents du genre Siphlophis Fitzinger 1843 (Serpentes). Memorias do Instituto Butantan 30: 35–50. [Google Scholar]
  53. IDEAM (2014) Mapa de Cobertura de la Tierra Adaptada Para Colombia. Instituto de Hidrología, Meteorología y Estudios Ambientales, Bogotá, 1 pp. [Google Scholar]
  54. IUCN (2001) IUCN Red List categories and criteria: Version 3.1. IUCN Species Survival Commission, Gland and Cambridge, 30 pp. [Google Scholar]
  55. Katoh K, Standley DM. (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30(4): 772–780. 10.1093/molbev/mst010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Kofron CP. (1982) The identities of some dipsadine snakes: Dipsaselegans, D.ellipsifera and Leptognathusandrei. Copeia 1982(1): 46–51. 10.2307/1444266 [DOI]
  57. Köhler G, Lotzkat S, Hertz A. (2010) A new species of Sibon (Squamata: Colubridae) from western Panama. Herpetologica 66(1): 80–85. 10.1655/08-077.1 [DOI] [Google Scholar]
  58. Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B. (2016) PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34: 772–773. 10.1093/molbev/msw260 [DOI] [PubMed] [Google Scholar]
  59. Laurenti JN. (1768) Specimen Medicum, Exhibens Synopsin Reptilium Emendatum cum Experimentis Circa Venena et Antidota Reptilium Austriacorum. Joan Thom, Vienna, 214 pp. 10.5962/bhl.title.5108 [DOI] [Google Scholar]
  60. Lewis TR, Griffin RK, Grant PBC, Figueroa A, Ray JM, Graham KE, David G. (2013) Morphology and ecology of Sibon snakes (Squamata: Dipsadidae) from two Neotropical forests in Mesoamerica. Phyllomedusa 12: 47–55. 10.11606/issn.2316-9079.v12i1p47-55 [DOI] [Google Scholar]
  61. Linnaeus C. (1758) Systema Naturae. Editio Decima, Reformata. Impensis Laurentii Salvii, Stockholm, 824 pp. [Google Scholar]
  62. Lotzkat S. (2014) Diversity, taxonomy, and biogeography of the reptiles inhabiting the highlands of the Cordillera Central (Serranía de Talamanca and Serranía de Tabasará) in western Panama. PhD thesis, Goethe-Universität in Frankfurt am Main, 931 pp. [Google Scholar]
  63. Lotzkat S, Hertz A, Köhler G. (2012) A new species of Sibon (Squamata: Colubroidea: Dipsadidae) from the Cordillera Central of western Panama, with comments on other species of the genus in the area. Zootaxa 3485(1): 26–40. 10.11646/zootaxa.3485.1.2 [DOI] [Google Scholar]
  64. MAE (2012) Línea Base de Deforestación del Ecuador Continental. Ministerio del Ambiente del Ecuador, Quito, 30 pp. [Google Scholar]
  65. MapBiomas Amazonía (2022) Mapeo anual de cobertura y uso del suelo de la Amazonía. www.amazonia.mapbiomas.org
  66. Meneses-Pelayo E, Echavarría-Rentería JD, Bayona-Serrano JD, Caicedo-Portilla JC, Rengifo-Mosquera JT. (2016) New records and an update of the distribution of Sibonannulatus (Colubridae: Dipsadinae: Dipsadini) for Colombia. Check List 12(4): 1–5. 10.15560/12.4.1931 [DOI] [Google Scholar]
  67. Meneses-Pelayo E, Echavarría-Rentería JD, Bayona-Serrano JD, Caicedo-Portilla JR, Rengifo-Mosquera JT. (2018) Sibonannulatus (Günther, 1872). Catálogo de Anfibios y Reptiles de Colombia 4: 70–77. [Google Scholar]
  68. Mulcahy DG, Ibáñez R, Jaramillo CA, Crawford AJ, Ray JM, Gotte SW, Jacobs JF, Wynn AH, Gonzalez-Porter GP, McDiarmid RW, Crombie RI, Zug GR, de Queiroz K. (2022) DNA barcoding of the National Museum of Natural History reptile tissue holdings raises concerns about the use of natural history collections and the responsibilities of scientists in the molecular age. PLoS ONE 17(3): e0264930. 10.1371/journal.pone.0264930 [DOI] [PMC free article] [PubMed]
  69. Murphy RW, Crawford AJ, Bauer AM, Che J, Donnellan SC, Fritz U, Haddad CFB, Nagy ZT, Poyarkov NA, Vences M, Wang W, Zhang Y. (2013) Cold Code: The global initiative to DNA barcode amphibians and non-avian reptiles. Molecular Ecology Resources 13(2): 161–167. 10.1111/1755-0998.12050 [DOI] [Google Scholar]
  70. Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GAB, Kent J. (2000) Biodiversity hotspots for conservation priorities. Nature 403(6772): 835–838. 10.1038/35002501 [DOI] [PubMed] [Google Scholar]
  71. Oliver JA. (1937) Notes on a collection of amphibians and reptiles from the State of Colima, Mexico. Occasional Papers of the Museum of Zoology, University of Michigan 360: 1–28. [Google Scholar]
  72. Orcés G, Almendáriz A. (1987) Sistemática y distribución de las serpientes dipsadinae del grupo oreas. Revista Politécnica 12: 135–144.
  73. Palumbi SR, Martin A, Romano S, McMillan WO, Stice L, Grabowski G. (1991) The Simple Fool’s Guide to PCR, version 2.0. University of Hawaii, Honolulu, 94 pp. [Google Scholar]
  74. Passos P, Fernandes DS, Caramaschi U. (2004) The taxonomic status of Leptognathusincertus Jan, 1863, with revalidation of Dipsasalternans (Fischer, 1885) (Colubridae: Dipsadinae). Amphibia-Reptilia 25(4): 381–393. 10.1163/1568538042788951 [DOI] [Google Scholar]
  75. Passos P, Fernandes R, Porto M. (2005) Geographical variation and taxonomy of the snail-eating snake Dipsasalbifrons (Sauvage, 1884), with comments on the systematic status of Dipsasalbifronscavalheiroi Hoge, 1950 (Serpentes: Colubridae: Dipsadinae). Zootaxa 1013(1): 19–34. 10.11646/zootaxa.1013.1.2 [DOI] [Google Scholar]
  76. Pazmiño-Otamendi G, Rodríguez-Guerra A, Torres-Carvajal O. (2020) Dipsasvermiculata. In: Torres-Carvajal O, Pazmiño-Otamendi G, Salazar-Valenzuela D (Eds) Reptiles del Ecuador. Version 2021.0. Museo de Zoología, Pontificia Universidad Católica del Ecuador. [accessed on 2022-07-27]
  77. Peñafiel N, Flores DM, Rivero De Aguilar J, Guayasamin JM, Bonaccorso E. (2020) A cost-effective protocol for total DNA isolation from animal tissue. Neotropical Biodiversity 5(1): 69–74. 10.1080/23766808.2019.1706387 [DOI] [Google Scholar]
  78. Peters J. (1957) A new species of the snake genus Sibon from Ecuador. Copeia 109–111(2): e109. 10.2307/1439397 [DOI]
  79. Peters JA. (1960) The snakes of the subfamily Dipsadinae. Miscellaneous Publications, Museum of Zoology. Univesity of Michigan 114: 1–224. [Google Scholar]
  80. Peters JA, Orejas Miranda B. (1970) Catalogue of the Neotropical Squamata. Part I. Snakes. Smithsonian Institution Press, Washington DC, 347 pp. 10.5962/bhl.title.46653 [DOI] [Google Scholar]
  81. Peterson AT, Soberón JR, Pearson RG, Anderson RP, Martínez‐Meyer E, Nakamura M, Bastos Araújo M. (2011) Ecological Niches and Geographic Distributions. Princeton University Press, Princeton, 328 pp. 10.23943/princeton/9780691136868.003.0003 [DOI] [Google Scholar]
  82. Phillips SJ, Anderson RP, Schapire RE. (2006) Maximum entropy modeling of species geographic distributions. Ecological Modelling 190(3–4): 231–259. 10.1016/j.ecolmodel.2005.03.026 [DOI] [Google Scholar]
  83. Porto M, Fernandes R. (1996) Variation and natural history of the snail-eating snake Dipsasneivai (Colubridae: Xenodontinae). Journal of Herpetology 30(2): 269–271. 10.2307/1565522 [DOI] [Google Scholar]
  84. Rambaut A, Suchard M, Drummond AJ. (2022) Tracer version 1.7.1. http://www.beast.community [accessed May 2022]
  85. Ray JM, Montgomery CE, Mahon HK, Savitzky AH, Lips KR. (2012) Goo-eaters: Diets of the Neotropical snakes Dipsas and Sibon in Central Panama. Copeia 2012(2): 197–202. 10.1643/CH-10-100 [DOI] [Google Scholar]
  86. Ray JM, Sánchez-Martínez P, Batista A, Mulcahy DG, Sheehy III CM, Smith EN, Pyron RA, Arteaga A. (in press) A new species of Dipsas (Serpentes, Dipsadidae) from central Panama. ZooKeys. (in press) [DOI] [PMC free article] [PubMed]
  87. Renner IW, Warton DI. (2013) Equivalence of MAXENT and poisson point process models for species distribution modeling in ecology. Biometrics 69(1): 274–281. 10.1111/j.1541-0420.2012.01824.x [DOI] [PubMed] [Google Scholar]
  88. Ronquist F, Huelsenbeck JP. (2013) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics (Oxford, England) 19(12): 1572–1574. 10.1093/bioinformatics/btg180 [DOI] [PubMed] [Google Scholar]
  89. Royle JA, Chandler RB, Yackulic C, Nichols JD. (2012) Likelihood analysis of species occurrence probability from presence-only data for modelling species distributions. Methods in Ecology and Evolution 3(3): 545–554. 10.1111/j.2041-210X.2011.00182.x [DOI] [Google Scholar]
  90. Sauvage HE. (1884) Sur quelques reptiles de la collection du Muséum d’Histoire Naturelle. Bulletin de la Société Philomathique de Paris 8: 142–146. [Google Scholar]
  91. Savage JM. (2002) The Amphibians and Reptiles of Costa Rica, a Herpetofauna Between Two Continents, Between Two Seas. The University of Chicago Press, Chicago, 934 pp. [Google Scholar]
  92. Schlegel H. (1837) Essai sur la Physionomie des Serpens. Partie Descriptive. J. Kips, J. HZ. et W. P. van Stockum, La Haye, 606 pp. 10.5962/bhl.title.4693 [DOI] [Google Scholar]
  93. Sheehy C. (2012) Phylogenetic relationships and feeding behavior of Neotropical snail-eating snakes (Dipsadinae, Dipsadini). PhD Thesis, UT Arlington, 126 pp. [Google Scholar]
  94. Soberón J, Peterson TA. (2005) Interpretation of models of fundamental ecological niches and species’ distributional areas. Biodiversity Informatics 2(0): 1–10. 10.17161/bi.v2i0.4 [DOI] [Google Scholar]
  95. Solórzano A. (2001) Una nueva especie de serpiente del genero Sibon (Serpentes: Colubridae) de la vertiente del Caribe de Costa Rica. Revista de Biología Tropical 49: 1111–1120. [PubMed] [Google Scholar]
  96. Valencia JH, Dueñas MR, Székely P, Batallas D, Pulluquitín F, Ron SR. (2017) A new species of direct-developing frog of the genus Pristimantis (Anura: Terrarana: Craugastoridae) from Cordillera del Cóndor, Ecuador, with comments on threats to the anuran fauna in the region. Zootaxa 4353(3): 447–466. 10.11646/zootaxa.4353.3.3 [DOI] [PubMed] [Google Scholar]
  97. Vera-Pérez LE. (2019) A new species of Sibon Fitzinger, 1826 (Squamata: Colubridae) from southwestern Colombia. Zootaxa 4701(5): 443–453. 10.11646/zootaxa.4701.5.4 [DOI] [PubMed] [Google Scholar]
  98. Vera-Pérez LE. (2020) Dipsasvermiculata Peters, 1960 (Squamata, Colubridae): First country record from Colombia, with description of its hemipenial morphology and comments on its distribution and diagnosis. Check List 16(3): 527–533. 10.15560/16.3.527 [DOI] [Google Scholar]
  99. Wagler JG. (1830) Natürliches System der Amphibien: mit vorangehender Classification der Säugethiere und Vögel: ein Beitrag zur vergleichenden Zoologie. J.G. Cotta, München, 354 pp. 10.5962/bhl.title.58730 [DOI] [Google Scholar]
  100. Zaher H, Grazziotin FG, Cadle JE, Murphy RW, Moura-Leite JC, Bonatto SL. (2009) Molecular phylogeny of advanced snakes (Serpentes, Caenophidia) with an emphasis on South American xenodontines: A revised classification and descriptions of new taxa. Papéis Avulsos de Zoologia 49(11): 115–153. 10.1590/S0031-10492009001100001 [DOI] [Google Scholar]
  101. Zipkin EF, DiRenzo GD, Ray JM, Rossman S, Lips KR. (2020) Tropical snake diversity collapses after widespread amphibian loss. Science 367(6479): 814–816. 10.1126/science.aay5733 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

XML Treatment for Sibon irmelindicaprioae
XML Treatment for Sibon canopy
XML Treatment for Sibon marleyae
XML Treatment for Sibon vieirai
XML Treatment for Dipsas welborni
Supplementary material 1

Morphological and locality data for specimens of Dipsadini species examined, either directly, indirectly through digital photographs, or both. Codes: SVL = snout-vent length (mm); TL = tail length (mm); M = Male, F = Female.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Alejandro Arteaga, Abel Batista

Data type

Morphological

Supplementary material 2

Locality data used to create distribution maps. Type localities indicated in bold type.

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.

Alejandro Arteaga, Abel Batista

Data type

Occurrences


Articles from ZooKeys are provided here courtesy of Pensoft Publishers

RESOURCES