Genes	Primer	Base pair	PCR reaction mixture	Temperature profile and Reference
Bla NDM−1	F = GGT TTG GCG ATC TGG TTT TC R=(CGG AAT GGC TCA TCA CGA TC	621 bp	8.5 µl of 2X master mix, 0.5 µl of 10 picomolar primer (forward and reverse), 12.5 µl of nuclease free water and 3 µl of extracted DNA template	initial denaturation at 94 °C for 5 min, followed by 36 cycles of 95 °C for 30 s, 52 °C for 40 s and 72 °C for 50 s with final extension at 72 °C for 5 min [18].
Mcr-1	F = CGGTCAGTCCGTTTGTTC R = CTTGGTCGGTCTGTAGGG	309 bp	21 µl 1X master mix, 0.5 µl of 10 pmolar primer (forward and reverse) and 3 µl of extracted plasmid DNA	Initial heating at 95 °C for 15 min, then 35 cycles of 94 °C for 10 s, 57 °C for 90 s and 72 °C for 90 s and final extension at 72 °C for 10 min. [19]
MexB	F = TGTCGAAGTTTTTCATTGATAG R = AAGGTCAC GGTGATGGT	280 bp	21 µl of 1X Qiagen master mix, 0.5 µl of 10 pmole primers (forward and reverse) and 3 µl of extracted DNA template.	Initial heating at 94 °C for 3 min, then 32 cycles of 94 °C for 30 s, 55 °C for 45 s and 72 °C for 1 min and final extension at 72 °C for 7 min [20].