Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
AAV titer primer and probe sequences.
| Vector component | 5ʹ Primer | 3ʹ Primer | Probe |
|---|---|---|---|
| CB Promoter | cccatagtaacgccaatagggact | cccataaggtcatgtactgggcataa | ccacttggcagtacatcaagtgtatcatatgcca |
| eGFP | acatgaagcagcacgacttct | ttcagctcgatgcggttcac | ctacaagacccgcgccgag |
| mScarlet | ctgaagggcgacattaagat | ttgtgggaggtgatgtccaa | aagcccgtgcagatgcccggc |
