Abstract
Background
Importance of the amphizoic amoeba Entamoeba moshkovskii is increasing in the study of amoebiasis as a common human pathogen in some settings. Limited studies are found on the genetic and phylogenetic characterization of E. moshkovskii from India; hence remain largely unknown. In this study, we determined the prevalence and characterized the E. moshkovskii isolates in eastern India.
Methods
A three-year systemic surveillance study among a total of 6051 diarrhoeal patients from ID Hospital and BC Roy Hospital, Kolkata was conducted for E. moshkovskii detection via a nested PCR system targeting 18S rRNA locus. The outer primer set detected the genus Entamoeba and the inner primer pair identified the E. moshkovskii species. The 18S rRNA locus of the positive samples was sequenced. Genetic and phylogenetic structures were determined using DnaSP.v5 and MEGA-X. GraphPad Prism (v.8.4.2), CA, USA was used to analyze the statistical data.
Result
4.84% (95%CI = 0.0433–0.0541) samples were positive for Entamoeba spp and 3.12% (95%CI = 0.027–0.036) were infected with E. moshkovskii. E. moshkovskii infection was significantly associated with age groups (X2 = 26.01, P<0.0001) but not with gender (Fisher’s exact test = 0.2548, P<0.05). A unique seasonal pattern was found for E. moshkovskii infection. Additionally, 46.56% (95%CI = 0.396–0.537) were sole E. moshkovskii infections and significantly associated with diarrheal incidence (X2 = 335.5,df = 9; P<0.0001). Sequencing revealed that the local E. moshkovskii strains were 99.59%-100% identical to the prototype (GenBank: KP722605.1). The study found certain SNPs that showed a correlation with clinical features, but it is not necessarily indicative of direct control over pathogenicity. However, SNPs in the 18S rRNA gene could impact the biology of the amoeba and serve as a useful phylogenetic marker for identifying pathogenic E. moshkovskii isolates. Neutrality tests of different coinfected subgroups indicated deviations from neutrality and implied population expansion after a bottleneck event or a selective sweep and/or purifying selection in co-infected subgroups. The majority of FST values of different coinfected subgroups were <0.25, indicating low to moderate genetic differentiation within the subgroups of this geographical area.
Conclusion
The findings reveal the epidemiological significance of E. moshkovskii infection in Eastern India as the first report in this geographical area and expose this species as a possible emerging enteric pathogen in India. Our findings provide useful knowledge for further research and the development of future control strategies against E. moshkovskii.
Author summary
Although Entamoeba genus consists of many different species, not all are pathogenic. Entamoeba histolytica is the only species recognized as a definite pathogen associated with intestinal and extraintestinal infections. Nowadays, the importance of other morphologically identical Entamoeba species, like amphizoic E. moshkovskii is increasing, as it has been reported in human patients over the years from different countries. Investigations into the pathogenic potential of E. moshkovskii are ongoing, and only limited studies have been conducted on genetic characterization from India. This study reveals the epidemiology and population structure of E. moshkovskii in diarrhoeal patients from eastern India. Our study showed that the prevalence of E. moshkovskii in diarrhoeal patients is higher than E. histolytica in the studied region. In addition, there was a unique seasonal pattern, found for the infection. The high prevalence rate of sole infection in patients suggests that it is one of the definite etiological agents for diarrhoeal disease in eastern India. The further study identified two SNPs in the 18S rRNA locus, significantly associated with the sole infection cases and hence they can be regarded as a marker for identifying pathogenic isolates of E. moshkovskii. Many novel genotypes were obtained in the study indicating high genetic diversity in E. moshkovskii population conferring adaptability in a changing environment. Further research is needed to ensure proper control measures for this infection for better health care.
Introduction
Amoebiasis, an infection by enteric protozoa, most commonly Entamoeba histolytica is globally considered a potentially severe and life-threatening infection [1]. The motile form of the parasite, the trophozoite inhabits the lumen of the large intestine, where it multiplies and differentiates into a resistant form. These cysts are released into the environment [1,2]. Consecutively, this resistant form is responsible for the transmission of the infection to another host via the faecal-oral route. Together with the pathogenic species E. histolytica, the genus Entamoeba includes many other species that reside in the human intestinal lumen, namely E. dispar, E. moshkovskii, E. bangladeshi, E. polecki, E. coli, and E. hartmanni [3]. In many cases, infections with the trophozoites of Entamoeba spp. can result in harmless colonization in the intestinal lumen of asymptomatic carriers, passing cysts in their stool (non-invasive infection). In other cases, the trophozoites invade the intestinal mucosa (intestinal disease) and, through the bloodstream, reach extraintestinal sites in other tissues such as the liver, brain, and lungs (extraintestinal disease) with consequential pathologic manifestations [4]. Abdominal pain, diarrhoea, nausea, vomiting and flatulence are the acute symptoms of amoebiasis caused by the eukaryotic parasite E. histolytica [4,5,6]. Other Entamoeba species are mostly commensals or are said to rarely infect humans [7].
Amoebic infection is one of the most prevalent parasitic diseases in India and worldwide [8]. It is significantly associated with poor sanitation and socioeconomic status than the geographical location’s climate [9]. In most cases, amoebiasis is routinely diagnosed by light microscopy of a wet smear or stained stool samples [10]. This technique is inexpensive and simple, but it has limited sensitivity and specificity, such as being unable to differentiate between the cyst and trophozoites of the pathogenic species E. histolytica and the rest commensal species like Entamoeba dispar and the newly identified Entamoeba bangladeshi and the amphizoic amoeba E. moshkovskii which sporadically infects humans [3,10,11]. These four species are genetically related and morphologically indistinguishable with different biochemical features [3]. Amoebiasis affects approximately 50 million people in tropical regions and nearly 100,000 deaths are reported annually [12]. After malaria and schistosomiasis, it is the third foremost parasitic cause of death in humans [13]. Although all deaths could be due to invasive E. histolytica infestation, the prevalence is overestimated due to its epidemiological overlap with other morphologically indistinguishable species, specifically Entamoeba dispar and Entamoeba moshkovskii [14]. Moreover, cysts of another nonpathogenic amoeba, Entamoeba hartmanni can be mystified with E. histolytica under the microscope which is even smaller in size (> 10 μm) [15–16]. In many geographical areas, the actual prevalence of each species is not well characterized particularly for E. moshkovskii, as some reports suggest that it has a potential role in provoking human disease [17]. So, it is important to understand the molecular epidemiology of E. moshkovskii in endemic countries in the study of amoebiasis and it has become crucial in the last decade.
E. moshkovskii was first described as a distinct species from Moscow by Tshalaia in 1941. It was primarily considered to be a free-living environmental strain and still regarded as a common protozoan species found in anoxic sediments to brackish coastal pools. It is osmotolerant in nature and can be cultured in various media suitable for intestinal protozoa, in which it grows easily at temperatures of 10–15° C and 37° C [18–19]. Although all the characteristics differentiate E. moshkovskii from E. histolytica and E. dispar, the entire life-cycle, including excystment and metacystic development, closely resemble E. histolytica and E. dispar. The size of the amoeba trophozoites varies from 10 to 120μ, with an average of 25μ and cysts vary from 5 to 16 μ, with an average of 10μ [19]. In 1961, an E. histolytica-like strain was obtained from a resident of Laredo, Texas, who suffered from diarrhoea, weight loss, and epigastric pain and the strain was named E. histolytica Laredo strain which shared many biological characteristics with E. moshkovskii. Both the Laredo strain and E. moshkovskii grew easily at room temperature, were osmotolerant, and resistant to drugs used in the chemotherapy of amoebiasis, for instance, emetine [20]. Subsequent molecular studies revealed that the E. histolytica Laredo strain is E. moshkovskii, the first human isolate of E. moshkovskii [20–21].
Nowadays importance of E. moshkovskii is increasing in the study of amoebiasis, and it is reported as a common Entamoeba infection in humans in some settings. Colonization of E. moshkovskii in human hosts has been reported in countries such as the United States, Italy, Iran, Turkey, Bangladesh, India (Pondicherry), Kenya, Australia, Indonesia, Colombia, Malaysia, Tunisia, Tanzania and Brazil [22–34]. Most of the stool samples in these studies were submitted to clinical microbiology laboratories from patients with gastrointestinal complications, indicating that E. moshkovskii might be associated with pathogenicity. In India (Pondicherry), it is reported that E. moshkovskii cannot invade intestinal mucosa and does not have any ingested erythrocytes, unlike that E. histolytica. [29]. In HIV-1-infected persons in northern Tanzania, E. moshkovskii is also not associated with clinical indicators. But in Bangladesh, this species has been identified as the only likely pathogen in individuals with gastrointestinal clinical manifestations, including dysentery [26,27]. However, in these patients, no studies of viral or bacterial agents were conducted to rule out other pathogens or potential pathogens. Another study in Bangladesh by Shimokawa et al, 2012 also pointed out a possible cause of diarrhoea in infants, which was due to E. moshkovskii infection [27]. While in Malaysia, it was isolated from both symptomatic and asymptomatic cases [28]. In the murine model of intestinal amebiasis, E. moshkovskii also caused diarrhoea, weight loss, and colitis [27]. Thus, the pathogenicity of E. moshkovskii in humans remains unclear.
For parasite identification, phylogeny and genetic characterization, small subunits of nuclear ribosomal RNA (18S rRNA) loci are recognized as potential targets [35–38]. Therefore, amplification and sequencing of this gene is being extensively used for decades [2,12,26,31–32]. Moreover, genetic variations based on 18S rRNA can be significant in pathogenicity for parasites.
To date, limited studies have been conducted on the genetic and phylogenetic characterization of E. moshkovskii in India [29] and remain largely unknown. In this study, we aimed to determine the epidemiology and molecular characterization based on 18S rRNA of amphizoic amoeba E. moshkovskii in human stool samples from an active surveillance study on enteric pathogens in and around Kolkata, India. We have also investigated the level of genetic diversity and established the genetic structure among the obtained local isolates using a molecular analysis tool.
Material and methods
Ethical statement
The ethical clearance of this study was reviewed and approved by the Institutional Human Ethics Committee of the Indian Council of Medical Research-National Institute of Cholera and Enteric Diseases (IRB Number: A-1/2015-IEC). Written informed consent statements were obtained from every participant. In the case of children, voluntary written informed consent statements were taken from their caregivers (parent/guardian).
Study area and population
This is a hospital-based systemic surveillance study conducted from March 2017 to February 2020. The target population is patients from different parts of Kolkata and adjacent areas admitted to Infectious Disease & Beliaghata General Hospital and Dr. B C Roy Post Graduate Institute of Paediatric Sciences Hospital, Kolkata, with diarrheal complaints. These two hospitals are referral centres for the treatment of diarrheal diseases along with government health care facilities. Non-diarrhoeal cases have not been included in this study.
Sample collection and microscopy
This is a hospital-based systemic surveillance study conducted among the patients admitted to Infectious Disease & Beliaghata General Hospital and Dr B C Roy Post Graduate Institute of Paediatric Sciences Hospital, Kolkata, India, with diarrheal complaints from March 2017 to February 2020. These two hospitals are referral centres for the treatment of diarrheal diseases along with government health care facilities. Non-diarrhoeal cases have not been included in this study. This study collected and screened a total of 3258 samples from ID Hospital and 2793 from B C Roy Hospital. The faecal samples were collected from the patients admitted to the hospital by trained medical professionals in the presence of attending physicians on the first day of hospitalisation and before antibiotic therapy. Samples were collected in a sterile container with a unique identification number. Once the samples were collected, they were immediately sent to laboratories for testing after written informed consent was obtained from patients. All stool samples were microscopically examined in triplicate in saline and iodine wet mounts. Trichome staining also has been used for E. moshkovskii identification. The Uninuclear, binuclear, trinuclear, or tetranuclear cysts or trophozoites of Entamoeba spp observed were recorded.
DNA extraction
DNA was isolated directly from clinical samples using STOOL DNA Minikit (QIAGEN, USA) as per the manufacturer’s protocol, followed by genetic identification through PCR amplification via species-specific primers. For molecular detection of parasites, species-specific primers have been generated using Primer3 Software.
Primer design
We have designed a nested PCR system targeting the 18S rRNA gene to detect E. moshkovskii from stool samples. The first set of primer (outer primer set) was used to amplify the 18S rRNA locus of the Entamoeba genus (Genus specific PCR assay), and the second set of primer (Nested primer set) was used for the identification of E. moshkovskii species only. The forward and reverse primers of the Entamoeba genus were designed from highly conserved regions of 18S rRNA locus of five phylogenetically close Entamoeba species viz. E. histolytica, E. dispar, E. moshkovskii, E. bangladeshi and E. nuttalli. The following sequences were analysed: E. histolytica, GenBank accession no. X56991 (1947 bp); Entamoeba dispar, GenBank accession no. Z49256 (1949 bp); E. moshkovskii, GenBank accession no. AF149906 (1944 bp); E. bangladeshi, GenBank accession no. KR025411 (1927 bp); E. nuttalli, GenBank accession no. AB485592.1 (2431 bp); Entamoeba coli, GenBank accession no. AF149914 (2101 bp); Entamoeba chattoni, GenBank accession no. AF149912 (1963 bp); Entamoeba polecki, GenBank accession no. AF149913 (1858 bp); Entamoeba invadens, GenBank accession no. AF149905 (1965 bp). The sequences were aligned using the ClustalW program (https://www.genome.jp/tools-bin/clustalw). Primer 3 online software was used to design the primers. Primer length and melting temperature were considered. Primer sequences specific for Entamoeba spp. were as follows: EntaS_F: CTGCCAGTATTATATGCTGATGTT and EntaS_R: TCTCCTTCCTCTAAATAAGGAGATTTA. The ability of genus-specific primer to amplify the 18S rRNA of the five Entamoeba species was verified using genomic DNA preparation. In the second round, a nested primer set was designed to amplify the E. moshkovskii species DNA fragment of the same gene. The nested E. moshkovskii-specific primer sequences were EM_779bpNF: AACTAACGAAGGAGATGAAGTGAG and EM_779bpNR: GCCAGAGACATCGATTAAAATG.
PCR amplification
The genus-specific PCR assay was adjusted to ensure the amplification of each target. We performed PCR amplification in a final volume of 50 mL containing 1X PCR buffer and 1U of Biotaq DNA polymerase (Bioline, UK) to obtain the primary PCR product. After MgCl2 concentrations ranging from 1.0–4.0 mM were checked, the optimal concentration of MgCl2 was found to be 2.5 mM. 0.2 μM of each forward and reverse primer was found to be the optimal concentration for best results. After running a gradient PCR, the optimal annealing temperature was fixed to 55°C. The amplification was done in a thermal cycler as follows: 5 min at 94°C, followed by 35 cycles, each of 94°C for 45 sec, 55°C for 50 seconds and then 72°C for 50 seconds with a final extension at 72°C for 7 mins. Amplified PCR products were separated by agarose gel electrophoresis and visualised in a UV transilluminator after 0.5 μm/ml of ethidium bromide staining. The genus-targeted PCR products of Entamoeba spp showed 1803 bp—2046 bp amplicon on the agarose gel, depending on the species.
For the detection of E. moshkovskii the primary products went through the second round of PCR amplification using species-specific primer pair. 1.0 μL of primary PCR product was used as a template for the nested PCR reaction. To obtain the nested PCR product, we performed PCR amplification in a final volume of 50 μL reaction mixture containing 1X PCR buffer, 4.0 mM MgCl2, 0.2 mM of each dNTP, 0.2 μM of each forward and reverse primer (EM_779bpNF & EM_779bpNR) and 1U of Biotaq DNA polymerase (Bioline, UK). Reactions were performed in a thermal cycler PCR system (Applied Biosystem). The PCR reaction was started with an initial denaturation step at 94°C for 3 minutes and then subjected to 35 cycles of 94°C for 40 seconds, 57°C for 35 seconds and 72°C for 45 Seconds, followed by a final extension at 72°C for 7 minutes. The nested PCR was performed in 2.0 mM MgCl2. Nested PCR generates a 779 bp fragment in the presence of E. moshkovskii. Amplified PCR products were separated by electrophoresis in 1.5% agarose gel (Lonza SeaKem® LE Agarose)s in 1X Tris boric Acid EDTA buffer and visualised in a UV transilluminator after 0.5 μm/ml of ethidium bromide staining.
The specificity of Genus specific PCR was tested using genomic DNA preparation of five Entamoeba species viz. E. histolytica, E. moshkovskii, E. dispar, E. bangladeshi and E. nuttalli. The specificity of E. moshkovskii species-specific primer set was also assessed against DNA extracted from faecal samples of other pathogens, namely E. histolytica, E. dispar, E. bangladeshi, E. nuttalli, E. coli, Giardia lamblia, Cryptosporidium parvum, Cryptosporidium hominis, Cryptosporidium viatorum and mixed bacterial infections. All the tested DNA samples were subjected to the abovementioned amplification protocol. The sensitivity of the nested PCR system was also evaluated using reference DNA templates by serial dilutions from 10 to 0.000019 ng/μL of DNA.
DNA Sequencing
The 18S rRNA locus of the positive samples was sequenced to characterize the local isolates of E. moshkovskii. As the same-size amplified products do not unavoidably mean identical DNA sequences, we directly sequenced the PCR products without cloning them into any vector to reduce the chances of any sequence selection. For DNA sequencing of E. moshkovskii positive samples obtained in this study were amplified separately using ExTaq DNA polymerase (Takara, Japan). We used ExTaq because of its higher fidelity than standard Taq with a lower mutation rate. The aforementioned species-specific primer set was employed directly to amplify the 18S rRNA locus of the positive samples by conventional PCR method. PCR was accomplished in a 50 μL reaction mixture containing: 0.50 μL Takara Ex Taq, 5 μL 10X Ex Taq Buffer, dNTP mixture 3 μL, 0.2 μM of each forward and reverse primer (EM_779bpNF & EM_779bpNR), approximately 200 ng stool DNA and nuclease-free water (Ambion™) up to 50 μL. The reaction mixture was subjected to an initial denaturation step at 94°C for 5 mins, followed by 35 cycles of 60 s at 94°C of denaturation, primer annealing for 40 s at 57°C and extension for 55 s at 72°C. A final seven minutes polymerization step at 72°C was also performed. Successfully amplified PCR products were purified using the Roche PCR Gel extraction Kit as per the manufacturer’s protocol. The purified PCR products were sequenced using the standard BigDye terminator V3.1 sequencing kit (Applied Biosystem, USA) following the manufacturer’s instructions. Sequencing was performed with a 5730 DNA analyzer (Applied Biosystem, Foster City, CA, USA). The accuracy of the sequence was verified with sequencing in the 5’ - 3’ direction using both forward and reverse primer separately.
Sequence alignment, nucleotide polymorphisms analysis
The obtained 18S rDNA gene sequences of E. moshkovskii compared to those available in the GenBank database using the BLAST tool (NCBI - https://blast.ncbi.nlm.nih.gov/Blast.cgi)). All of the obtained sequences were deposited in NCBI GenBank (accession numbers ON965383- ON965450). Multiple alignments of the nucleotide sequence allowed us to analyze nucleotide sequence variations. The obtained sequences were aligned using ClustalW multiple sequence alignment program of GenomeNet Bioinformatics tools and edited manually. This alignment was also performed with MultAlin using identity parameter values of -1 and -0 and the penalty default values to determine sequence variations. All obtained sequences were aligned and adjusted in MEGA X. Substitution matrix (Maximum likelihood/ML) and transition/transversion (ML) bias were estimated using the same software. In the substitution matrix (ML), each entry is the probability of substitution (r) from one base (row) to another base (column). Substitution patterns and rates were estimated under the General Time Reversible model (+G+I) [39]. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories, [+G], parameter = 200.0000). The rate variation model allowed some sites to be evolutionarily invariable ([+I], 0% sites). Rates of different transitional substitutions are shown in bold and those of transversionsal substitutions are shown in italics. Relative values of instantaneous r should be considered when evaluating them. For simplicity, the sum of r values is made equal to 100. For estimating Maximum likelihood values, a tree topology was automatically computed [39]. This analysis involved 68 nucleotide sequences. For transition/transversion (ML) bias determination substitution patterns and rates were estimated under the Tamura-Nei (1993) model (+G+I) [40]. There were a total of 733 positions in the final dataset. Nucleotide composition, parsimony-informative sites, singleton sites, variable sites (S), the number of haplotypes (h), haplotype diversity (Hd), the average number of nucleotide differences (K), and nucleotide diversity (π) were determined from the aligned sequences using the program DnaSP v5.
Genetic structure analysis
Partitions of genetic diversity within and among different population subdivisions of local isolates obtained from the present study were calculated using Wright’s F statistics (FST). Population subdivision was performed based on the co-infection status of the isolates. FST is a measure of genetic differentiation among populations. DnaSP v5.0 package was used to estimate the mean pairwise differences between the populations. The significant difference in FST was from 0 based on 1000 random permutations of the dataset. Four neutrality tests using Tajima’s D, Fu’s FS, Fu and Li’s D and F statistics were also performed through DnaSP v5.0 for assessing the probable population expansion.
Phylogenetic analysis
The maximum Likelihood method and Tamura-Nei model were applied to infer the evolutionary history [40]. The tree with the highest log likelihood (-6543.31) is shown. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Tamura-Nei model and then selecting the topology with superior log likelihood value. A discrete Gamma distribution was used to model evolutionary rate differences among sites [8 categories (+G, parameter = 200.0000)]. The rate variation model allowed for some sites to be evolutionarily invariable ([+I], 0.42% sites). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. This analysis involved 76 nucleotide sequences. There were a total of 822 positions in the final dataset. Evolutionary analyses were conducted in MEGA X [39,41].
Haplotype network construction
The relationship between the haplotypes of E. moshkovskii in different coinfected subgroups was inferred by constructing a Median Joining haplotype network in PopART v1.7. The isolates were colour-coded according to specific coinfection groups to derive a relationship with sequenced data.
Data collection of other Enteropathogen infections
E. histolytica, Cryptosporidium and Giardia were identified by PCR method as described elsewhere [42]. Helminth parasites were detected by light microscopy after wet mount. Other enteric pathogens like Vibrio cholera O1/O139, Salmonella spp., Campylobacter jejuni, Rotavirus, astrovirus and adenovirus co-infection information with E. moshkovskii were obtained from the institutional database of ICMR-National Institute of Cholera and Enteric Diseases, Kolkata, India.
Cultivation of Entamoeba spp
In this study, we used Trophozoites of the E. moshkovskii (An isolate of Thailand), a gift from Dr Seiki Kobayashi, School of Medicine, Keio University. The E. moshkovskii strain was regularly cultivated in our lab using the BIS-33 medium and maintained at a temperature of 25°C. Trophozoites under the log phase of growth were used in the experiments as a positive control.
Geographical distribution of E. moshkovskii infection
The geographical locations of the patients were obtained from the hospital case record file (CRF). This data was employed to evaluate the spatial distribution of E. moshkovskii in the catchment area. If patients from any area comprised less than 1% of the total sample size, the site was excluded from the dataset.
Statistical analysis
GraphPad prism v.8.4.2, CA, USA, was used to analyze the data. The relationship between the prevalence of E. moshkovskii with other variables like age, gender, and other co-infections/additional enteropathogens was measured by testing X2. Fisher’s exact test was applied to evaluate the statistical association between gender and the occurrence of infection of E. moshkovskii. Two-way ANOVA was employed in three-year sample comparisons to assess the statistical significance of the seasonal pattern of E. moshkovskii infection. In all cases, a p-value less than 0.05 was considered significant.
Results
Prevalence of Entamoeba moshkovskii
A total of 6051 samples (3258 samples from ID Hospital and 2793 samples from B C Roy Hospital) were collected and screened in this study to detect E. moshkovskii. Out of 6051 clinical samples, 4.10% (n/N = 248/6051, 95% CI 0.036–0.046) samples were identified as cysts or trophozoites of Entamoeba spp. by light microscope (Fig 1). Genus-specific PCR assay showed 4.84% (n/N = 293/6051, 95% CI 0.043–0.054) samples were positive for Entamoeba spp. As a result, microscopy failed to detect 15.36% (n/N = 45/293, 95% CI 0.273–0.380) of the samples that were positive for Entamoeba spp. All the samples that tested positive in the genus-specific PCR assay (including those that were positive and negative for Entamoeba spp by microscopy) were then subjected to a second round of nested PCR to screen for E. moshkovskii infection. The prevalence of E. moshkovskii after nested PCR assay was 3.12% (n = 189/6051, 95% CI 0.027–0.036). Therefore, 1.72% (n = 104/6051, 95% CI 0.014–0.021) of patients were infected with other Entamoeba species in the study area. 64.50% (n/N = 189/293, 95% CI 0.59–0.70) of amoebic infections were positive for E. moshkovskii in this study area. The PCR system utilized in the prevalence study possessed the capability to identify as little as 1.2 pg genomic DNA of E. moshkovskii. These results increased the attention to studying traditionally non-pathogenic species infection and invasive amoebiasis. Approximately 19.04% (n/N = 36/189, 95% CI 0.141–0.252) of E. moshkovskii infections were overlooked using microscopy but were later identified using a nested PCR test. The finding suggests that the number of cysts produced in E. moshkovskii infections is smaller when compared to other Entamoeba species. Of the 189 samples that tested positive for E. moshkovskii through PCR, only 9.00% (n/N = 17/189, 95% CI 0.056–0.14) showed the presence of trophozoites through microscopy.
Fig 1. Microscopic view of Entamoeba moshovskii cysts and trophozoites after Trichrome staining (40X).
a. Trophozoite of Entamoeba moshkovskii.; b. Cyst of Entamoeba moshkovskii.
The occurrence of E. moshkovskii was higher in Males (E. moshkovskii: n/N = 117/189, 61.35%, 95% CI 0.548–0.685) than in females (E. moshkovskii: n/N = 38/189, 38.62%, 95% CI 0.315–0.452); but the difference between them was not statistically significant (Fisher’s exact test = 0.2548, P<0.05). The infections (Sole) were significantly associated with age groups (X2 = 26.01, P<0.0001). The highest (n/N = 54/189, 28.57%, 95% CI 0.223–0.354) and lowest (n/N = 12/189, 6.35%, 95% CI 0.036–0.109) infection rate of E. moshkovskii was found among 5–12 and 19–29 years of age groups, respectively (Fig 2A).
Fig 2.
A. Age-wise distribution of Entamoeba moshkovskii (mono-infection); Total number of infected individuals = 189. B. Additional enteropathogens in E. moshkovskii infected patients. C. Seasonal distribution of Entamoeba moshkovskii from March 2017 to February 2020 in Kolkata and adjacent areas.
Additional enteropathogens in stool samples of E. moshkovskii (sole) infected peoples
Many bacteria, viruses, enteric parasites, and helminths are associated to induce diarrhoea. The coinfection status with other diarrheagenic organisms was analyzed by examining the data from our institutional database, followed by evaluating the statistical significance. In the 189 diarrheal stool samples with E. moshkovskii, few were coinfected with one kind of enteropathogen, like 5.82% (n/N = 11/189, 95% CI 0.032–0.102) with E. histolytica, 2.12% (n/N = 4/189, 95% CI 0.008–0.053) with G. lamblia, 3.17% (n/N = 6/189, 95% CI 0.015–0.068) with Cryptosporidium spp, 7.94% (n/N = 15/189, 95% CI 0.049–0.127) with Soil-transmitted helminths (STH), 12.70% (n/N = 24/189, 95% CI 0.087–0.182) with E. coli, 10.58% (n/N = 20/189, 95% CI 0.007–0.158) with Shigella spp, 4.23% (n/N = 8/189, 95% CI 0.022–0.081) with V. cholerae, 2.12% (n/N = 4/189, 95% CI 0.008 0.053) with Rotavirus (Fig 2B). 4.76% (n/N = 9/189, 95% 0.025–0.088) samples were co-infected with 2 or >2 enteropathogens. 46.56% (n/N = 88/189, 95% CI 0.396–0.537) of the samples were positive solely for E. moshkovskii (Fig 2B). So it is, therefore, worthy of note that the diarrheal cases associated with E. moshkovskii were not commonly coinfected in Kolkata. Many positive samples were infected with E. moshkovskii, and the sole infection with E. moshkovskii was significantly associated with diarrheal incidence (X2 = 335.5, df = 9; P<0.0001) in this study area.
Seasonal distribution of Entamoeba moshkovskii infection
In this three-year study (March 2017 to February 2020), a specific seasonal distribution was found for E. moshkovskii infection. It was observed that the prevalence of E. moshkovskii parasites mostly increased during the post-fall (Sep-Nov) season and in the summer season (April-June) of each year and a statistically significant correlation was observed (p<0.0001) (Fig 2C). Moreover, the prevalence of E. moshkovskii was significantly higher than that E. histolytica throughout the three years (p = 0.0095).
E. moshkovskii prevalent areas
The prevalence study carried out in the I.D. hospital and B C Roy Children Hospital pointed out that the following areas i.e., Beliaghata, Entally, Kashipur-Belgachia, Maniktala, Gopalpur-Rajarhat, Kolkata-Port, Jorasanko, Baruipurpurba, Maheshtala, Metiabruz, Bhangar around Kolkata were very highly burdened (>3.5%) with E. moshkovskii infection. Ballygunge, Chowringhee, Dumdum Uttar, Dumdum, Bidhannagar, Bhabanipur and Kashba had high prevalence rates (3%-3.5%). Behala Paschim, Behala Purba, and Jadavpur were moderately (2.5%-2.99%) infected, while the lowest prevalence (< 2.49%) was reported in Baranagar, Rajarhat New Town and Shyampukur areas.
Phylogenetic and sequencing analysis of local isolates of E. moshkovskii
To consider the genetic diversity in E. moshkovskii isolates in and around Kolkata, the 18S rRNA gene locus in 68 positive cases was successfully sequenced. Sequencing revealed that the locally found E. moshkovskii strains were 99.59% - 100% identical with the prototype (GenBank accession no KP722605.1), and all isolates were the same species. All 68 sequences were deposited in NCBI GenBank under accession numbers ON965383- ON965450 [S1 Table]. The nucleotide sequence of E. moshkovskii of 36 isolates had 100% genetic identity with the reference sequences (prototype) previously published in GenBank (accession numberAF149906.1), and the rest of the 32 sequences represented genetic variants of E. moshkovskii not described earlier. We selected five known sequences, viz. E. histolytica (Genbank: AP023147.1), E. nuttalli (Genbank: LC042219.2), E. invadens (Genbank: AF149905.1), E. chattoni (Genbank: AF1499121.1), E. coli (Genbank: AF149914.1), Dictyostelium discoideum (Genbank: AM168039.1), E. polecki (Genbank: AF14913.1) to construct the phylogenetic tree of the E. moshkovskii isolates obtained in this study. Phylogenetic analysis showed that the study isolates of E. moshkovskii formed a monophyletic sister clade to the common ancestors of the E. histolytica and E. dispar 18S rRNA sequences (Fig 3). The clades were supported with high bootstrap values. The studied E. moshkovskii isolates were grouped with both prototypes (GenBank accession no: AF149906.1) and their close variants. Most of the variants showing the bootstrap value of 89%–99% shared a common clade with the prototype cluster, consisting of two subgroups: sole infection and mixed infection. Some isolates from the mixed infection subgroup are also clustered into separate distant clades from the prototype lineage. The EM IND/37 (GenBank: ON9654419) and EM IND/46 (GenBank: ON9654428) formed a separate group with 100% bootstrap value from the prototypes, which was considered unique due to the presence of one insertion (nucleotide A) and one deletion (nucleotide T) at the studied locus of the isolates. This group requires further investigation to gain a better understanding of the evolutionary processes that have shaped them.
Fig 3. Phylogenetic analysis of study isolates based on 18S rRNA locus of Entamoeba moshkovskii.
Overall distribution of SNPs in 18S rRNA locus of E. moshkovskii
The sequence of 18r RNA locus from 68 isolates was successfully acquired from positive stool samples. This analysis involved all of the 68 nucleotide sequences. A total of 733 positions were analysed to identify SNPs in the final dataset. Through the sequence of 18S rRNA locus, we have identified 10 SNPs, one deletion and one insertion in 733 sequenced bases from 68 isolates of E. moshkovskii (Table 1). The isolates were 99.60%- 100% identical (GenBank accession no AF149906.1), and all isolates were of the same species (S1 Table). Out of 68 isolates, 36 had sequences identical to the corresponding reference sequence and the rest of the 30 differed by one to three single-nucleotide polymorphisms (SNPs). Two samples had one insertion at position 795–796 (nucleotide A) and one deletion at position 769 (Nucleotide T). All SNPs identified corresponded to transition (pyrimidine < = > pyrimidine/ purine < = > purine) or transversion (purine < = > pyrimidine) mutations. The studied locus of the isolates transition and transversion base substitutions showed the same propensity (50%). The estimated Transition/Transversion bias (R) was 0.4. The average base composition in the studied locus was A = 33.57%, T/U = 25.30%, C = 16.80%, and G = 24.33%, with slightly high AT richness in the sequences. The maximum Log-likelihood for this computation was -1181.283. The maximum likelihood estimate of the substitution matrix is presented in S2 Table. We have also obtained a sum of 28 polymorphic/variable sites, out of which there were 0 singleton variables and 28 were parsimony-informative sites (Table 2). The parsimony-informative sites gave information about the evolutionary relationships among the isolates. Among 10 SNPs observed in the 18S rRNA locus, five SNPs were potentially associated with specific coinfection incidence. For example, 722 T/C (p = <0.0001) transition was found to be associated with E. histolytica co-infection (IEH). 814 T/G transversion (p = 0.0142) and 826 T/A transversion (p = 0.0142) also exhibited a strong association with diarrhoea-causing bacterial or viral co-infection (IB/V). Only 1345 T/G (p = 0.0424) and 1361 A/G (p = 0.0424) showed a positive correlation with the sole infection of E. moshkovskii. However, the deletion of nucleotide A (adenine) at 769 and insertion of nucleotide T (thymine) at 795–796 were not significantly associated with any co-infection incidence. Detailed information on SNPs identified within the target loci of study isolates is provided in S1 Table.
Table 1. SNPs/ insertion-deletion identified in 18S rRNA of E. moshkovskii study isolates.
| SNPs | P VALUE | X2, df | Significance | Associated group |
|---|---|---|---|---|
| 722 T/C | <0.0001 | 34.24, 4 | Yes | IEH |
| 788 T/C | 0.864 | 1.286, 4 | No | _ |
| 814 T/G | 0.0142 | 12.46, 4 | YES | IBV |
| 826 T/A | 0.0142 | 12.46, 4 | YES | IBV |
| 988 G/C | 0.293 | 4.945, 4 | No | _ |
| 1145G/A | 0.1909 | 6.113, 4 | No | _ |
| 1345 T/G | 0.0424 | 9.884, 4 | Yes | Sole D |
| 1361 A/G | 0.0424 | 9.884, 4 | Yes | Sole D |
| 1377 T/G | 0.1448 | 6.836, 4 | No | _ |
| 1437 G/A | 0.2445 | 5.446, 4 | No | _ |
| 769 A delete | 0.3295 | 4.612, 4 | No | _ |
| 795–796 T insert | 0.3295 | 4.612, 4 | No | _ |
Sole D: diarrheal patients solely infected with E. moshkovskii, IEH: E. moshkovskii positive samples co-infected with Entamoeba histolytica, IOEP: E. moshkovskii positive samples co-infected with other Enteric Parasites- G. lamblia, Cryptosporidium spp, ISTH: E. moshkovskii positive samples co-infected with soil-transmitted helminths, IB/V: E. moshkovskii positive samples co-infected with other diarrhoea-causing bacteria-E. coli, Shigella spp & V. cholera or virus-Rotavirus., P: Correlation coefficient value of the particular association, df: degree of freedom, X2: Chi-square value.
Table 2. Genetic diversity indices and neutrality tests based on 18S rRNA sequences found in local isolates of E. moshkovskii in Kolkata and adjacent areas.
Haplotype_1(Prototypes) was identical to Laredo strain of E. moshkovskii.
| Subgroups | N | Haplotypes obtained | S | h | K | Hd +/-SD | Π +/-SD | Fu’s Fs | Tajima’s D | Fu & Li’s D | Fu & Li’s F |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Sole D | 30 | Hap_1, Hap_2, Hap_3, Hap_4, Hap_5, Hap_6, Hap_7, Hap_8 | 9 | 8 | 1.42759 | 0.623+/-0.093 | 0.00195+/0.00036 | -2.506 | -1.15479 | -2.12379 | -2.13591 |
| IEH | 6 | Hap_4, Hap_6 | 3 | 2 | 1.60000 | 0.533+/-0.172 | 0.00218+/0.00070 | 2.506 | 1.12414 | 1.39584 | 1.40624 |
| IOEP | 6 | Hap_1, Hap_3, Hap_10 | 2 | 3 | 0.66667 | 0.600+/-0.215 | 0.00091+/0.00038 | -0.858 | -1.13197 | -1.15529 | -1.19511 |
| ISTH | 5 | Hap_1, Hap_8 | 1 | 2 | 0.40000 | 0.400+/-0.237 | 0.00055+/0.00032 | 0.90 | -0.81650 | -0.81650 | -0.77152 |
| IB/V | 21 | Hap_1, Hap_6, Hap_9, Hap_10 | 22 | 4 | 4.4667 | 0.633+/-0.074 | 0.00609+/0.00266 | 5.167 | -1.02116 | 1.35707 | 0.75547 |
| Total | 68 | 28 | 10 | 2.46313 | 0.677+/-0.057 | 0.00336+/0.00100 | -0.544 | -1.83320** | 1.85839* | 0.58884 |
N: Sample size; S: number of polymorphic/segregating sites; ℎ: number of haplotypes; K: Average number of nucleotide differences; Hd: haplotype diversity;: π nucleotide diversity
**Statistically significant, p<0.05
*Statistically significant, p<0.02
Median-Joining haplotype network
In total, 68 sequences of the 18S rRNA locus were used to assess the relationship of E. moshkovskii haplotypes among different coinfected subgroups. Ten distinct haplotypes were identified in this study. Haplotype 1 was widespread, occurring in both coinfected subgroups viz. IOEP, ISTH and IB/V and the sole E. moshkovskii-infected subgroup (Sole D). The stellate shape of the constructed network suggests a rapid expansion of the population of E. moshkovskii in the study region (Fig 4).
Fig 4. Median-joining network of 68 E. moshkovskii haplotypes obtained in and around Kolkata, West Bengal, India.
Sole D: diarrheal patients solely infected with E. moshkovskii, IEH: E. moshkovskii positive samples co-infected with E. histolytica, IOEP: E. moshkovskii positive samples co-infected with other Enteric Parasites- G. lamblia, Cryptosporidium spp, ISTH: E. moshkovskii positive samples co-infected with soil-transmitted helminths, IB/V: E. moshkovskii positive samples co-infected with other diarrhoea-causing bacteria-E. coli, Shigella spp &V. cholera or virus-Rotavirus.
Population structure
Genetic diversity
We have investigated the following descriptive statistics of genetic diversity using the software DnaSP v5: number of segregating sites (S), number of haplotypes (ℎ), haplotype diversity (HD), and nucleotide diversity (π) and Average number of nucleotide (K). Genetic diversity indices revealed a total of 28 segregating sites (S) and 10 haplotypes, as well as haplotype diversity (HD) of 0.677 ±0.057 and nucleotide diversity (π) of 0.00336 ±0.00100. We also investigated the same for different co-infected/sole E. moshkovskii-infected subgroups. The values are provided in Table 2. The haplotype diversity (HD) for different subgroups ranges from 0.400 ±0.237 to 0.633 ±0.074, and the nucleotide diversity (π) ranges from 0.00055 ±0.00032 to 0.00609 ±0.00266 across all sites. The average number of Nucleotide differences (k) for each subgroup ranged from 0.40000 to 4.4667. The study found a high degree of haplotype diversity in the Sole D subgroup and low nucleotide diversity, except for those co-infected with Soil-transmitted helminths (ISTH) which showed lower haplotype diversity. The Sole D subgroup had the most haplotypes (8 haplotypes), with a high HD value. Hence, the apparent observation from this study is that there is a high level of genetic diversity in the Sole D subgroup compared to other subgroups. The Sole D subgroup had two separate subclades in the phylogenetic tree, the first containing Haplotype_2 and Haplotype_5 with a bootstrap value of 91, and the second containing only Haplotype_9. But no clustering was seen in the phylogenetic tree for other co-infected subgroups, and there was no geographical or seasonal pattern. Most novel haplotypes were found to co-occur with the most prevalent haplotype. Haplotypes Hap_2, Hap_7, and Hap_5 were only found in the Sole E. moshkovskii infected subgroup, while Hap_9 appeared exclusively in the subgroup co-infected with IB/V.
Three neutrality tests (Tajima’ D, Fu & Li’s D and Fu & Li’s F value) showed negative non-significant values for Sole D, ISTH and IOEP subpopulations (Table 2). These analyses indicated deviations from neutrality and implied population expansion (e.g., after a bottleneck event or a selective sweep) and/or purifying selection in the three infected subgroups of E. moshkovskii. The negative Tajima’ D value of the IB/V subgroup (Tajima’ D = -1.02116) also suggested that this population deviated from the standard neutral. The three neutrality tests for the IEH subgroup resulted in positive values spectacled balancing selection or sudden population contraction. However, statistically non-significant value revealed a weak selection within and among all study sites. The estimation of another neutrality test, Fu’s FS based on the haplotype distribution, showed negative values for Sole D and IOEP subpopulations, demonstrating an excess of rare haplotypes compared to what would be expected under neutrality. Sole D exhibited the lowest Fu’s FS value (Fu’s Fs = -2.506) which conferred the hypothesis of past population expansion incidents for the subgroup. However, positive values of Fu’s FS in IEH, ISTH and IB/V subgroups suggested population subdivisions and the overdominant selection or bottlenecks. IB/V subgroups showed the highest degree of positive Fu’s FS value (Fu’s Fs = 5.167) due to the presence of haplotype (Hap_9) with insertion–deletion polymorphisms. Strong positive neutrality results for IEH (Fu’s Fs = 2.506; Tajima’ D = 1.12414; Fu & Li’s D = 1.39584 and Fu & Li’s F = 1.40624) subgroups highly supported a sudden population contraction and/or balancing selection (Table 2).
Tajima’ D results in overall negative values (Tajima’ D = -1.83320; p<0.05) from both the tests that there is an excess of rare mutations in the subgroups, and the excess is statistically significant. The overall negative values (Fu’s FS = -0.544) also resulted from Fu’s FS test. However, the overall Fu & Li’s D and Fu & Li’s F (Fu & Li’s D = 1.85839, p<0.02; Fu & Li’s F = 0.58884) values were positive, and this revealed an excess of ancestral/prototype variants, that have been selected for in the past (Table 2). In other words, the number of unique variants present was low, and the ones that were present were carried by a large number of individuals.
Pairwise fixation index (FST) values among the different coinfected groups were assessed for measuring population differentiation based on their level of genetic differentiation. Pair-wise FST values were also obtained from the comparison between specific co-infected/sole-infected subgroups, and these values were assessed to measure population differentiation. An FST greater than 0.15 can be interpreted as very little gene flow and is significant in differentiating populations [43]. According to Table 3 shown, very little gene flow was obtained among the subgroups of Sole D with IEH, IOEP with IEH and the subgroups of IEH with ISTH. Consequently, very high genetic differentiation was observed in these subgroups. The highest FST value was estimated between co-infected subgroup IEH against subgroups ISTH (FST value = 0.34783) in all possible combinations of co-infected/Sole infected subgroups. The co-infected subgroups IOEP against ISTH exhibited the lowest FST value (FST value = 0.0000) (Table 3), indicating the highest level of gene flows between these two subpopulations with the shortest distance and the most increased accessibility. Overall the estimated genetic differentiation index was highly statistically significant (X2 = 77.195, P<0.001) among the parasite subpopulations.
Table 3. Genetic differentiation (FST) among different coinfected subgroups of Entamoeba moshkovskii.
| Sub group | Sole D | IEH | IOEP | ISTH | IB/V |
|---|---|---|---|---|---|
| Sole D | 0.0000 | ||||
| IEH | 0.27144 | 0.0000 | |||
| IOEP | 0.09383 | 0.32000 | 0.0000 | ||
| ISTH | 0.10412 | 0.34783 | 0.0000 | 0.0000 | |
| IB/V | 0.10865 | 0.11116 | 0.09665 | 0.10664 | 0.0000 |
Discussion
The study was conducted to determine the prevalence of E. moshkovskii in stool samples of diarrheal patients admitted to Infectious Disease Hospital, Kolkata and B C Roy Hospital, Kolkata. This is the first study done in Eastern India using molecular biological techniques that report the prevalence of E. moshkovskii in clinical stool samples. According to the active surveillance study for the detection of common enteric parasites going on over the past two decades, we have observed a decreasing trend of E. histolytica infection in the last few years around Kolkata [42,44–45]. Also, non-seasonal sporadic infections with E. histolytica have been observed, which is unusual for a tropical area like Kolkata [42,45]. Microscopic investigation of diarrheal stool samples has uncovered the presence of cysts/trophozoites of amoeba that have a similar morphological feature to E. histolytica by a significant proportion throughout the year in Kolkata. After performing PCR-based molecular identification, it was found that the most abundant species of Entamoeba observed in diarrheal stool samples in Kolkata is a morphologically indistinguishable amoeba from E. histolytica and is a related species called E. moshkovskii. A recent study in Egypt showed that 85% of amoebic infections were caused by so-called non-pathogenic Entamoeba spp. such as E. dispar, E. moshkovskii, and E. hartmani [46]. This observation has led to an increased interest in the study of traditionally non-pathogenic Entamoeba species. Humans are a true host for amphizoic amoeba E. moshkovskii [27]. Moreover, recent evidence from different studies supports the pathogenicity of E. moshkovskii [23,27,29–30]. Although E. moshkovskii is identified as a cause of human infection, endemicity has not been appropriately assessed in most epidemiological studies [47]. In this study, we employed microscopic and molecular tools to determine the prevalence and genetic structure of E. moshkovskii in and around Kolkata.
The present study reported that Entamoeba spp was prevalent in diarrhoeal stool samples and other enteric pathogens in Kolkata. More than half of the amoebic infection was caused by E. moshkovskii. This finding is alarming as it implies that E. histolytica infections previously decreased and E. moshkovskii has been taking its place. Although E. moshkovskii was highly prevalent in diarrheal patients, we did not find any hematophagous trophozoites of E. moshkovskii during microscopy, indicating its non-invasive nature. These results will boost research for a better understanding of the mechanism of pathogenicity in the parasite. The raw data revealed that a more significant proportion of men were infected with E. moshkovskii than women. Still, the difference was not statistically significant, which indicates that the probability of infection with E. moshkovskii is equal for both genders. Our data revealed that E. moshkovskii infections were most predominant in ages 5–12. The higher prevalence of E. moshkovskii in this age group might be associated with their lack of health education regarding hygiene practices. A recent study in Bangladesh reported that 21% of children aged 2–5 were infected with E. moshkovskii, which was associated with diarrhoea [23]. Many other studies also reported E. moshkovskii as an enteropathogen in patients suffering from diarrhoea or dysentery [7,23,27,29–30]. Our study was conducted among patients with diarrhoeal complaints. A notable percentage of individuals were infected with E. moshkovskii, and the presence of mono-infection/ sole infection of E. moshkovskii was statistically associated with diarrhoeal occurrence. Therefore, the diarrheal incidents associated with E. moshkovskii were not commonly coinfected in Kolkata. These results indicate that E. moshkovskii may not simply be a commensal of the human gut; instead, it acts as a “potential” pathogen causing diarrhoea and other gastrointestinal disorders in the study area.
A typical seasonal pattern generally observed in many parasitic infections like E. histolytica and G. lamblia usually showed the highest peaks in the wet season. It gradually decreased with the arrival of the dry season [48–52]. Interestingly we observed a unique seasonal pattern of E. moshkovskii infection in Kolkata. We reveal two remarkable peaks of infection in summer and post-fall season. The result of such an unusual study finding has yet to be explained, requiring further detailed investigations.
Further, we have performed phylogenetic analysis and multiple alignments of the E. moshkovskii population from Kolkata based on the 18S rRNA locus. Multiple alignments showed that 44.12% (n/N = 30/68) isolates were 100% similar at the sequenced region compared to the Laredo strain of E. moshkovskii, and the rest of the isolates were novel genetic variants. Phylogenetic analysis clarified the relationships among subpopulations clustered together with their respective variants. However, further research is needed using high-resolution molecular markers to conclude whether the subpopulation is a different genotype of E. moshkovskii or a completely new lineage. Since this was a hospital-based surveillance study and patients came from a limited geographical area, the distribution of different genotypes needed to be better understood. But the findings of this study confirmed the distribution of a richly diverse population of E. moshkovskii species in Kolkata and adjacent areas. The findings of this study highlighted the epidemiological significance of E. moshkovskii infection in Eastern India as it is the first report in this geographical area and exposes the existence of this species as a possible emerging enteric pathogen in India.
Most research on E. moshkovskii infection has mainly focused on the prevalence of this pathogen without considering the co-occurrence of other enteric pathogens [22–33]. In this study, a correlation was observed between 18S rRNA SNPs and clinical features. However, the correlation between SNPs and clinical features does not necessarily indicate a direct control of their impact on pathogenicity. The sequence of the 18S ribosomal RNA can be used as a phylogenetic marker, allowing for the identification of pathogenic organisms in clinical samples. It can also be utilized to detect E. moshkovskii isolates and enables further diagnostic testing. The identified SNPs may exhibit an essential role of E. moshkovskii in adapting to the gut environment or in acquiring other enteric pathogens.
The nucleotide diversity (π) value is an important index in molecular genetics to determine the degree of genetic polymorphism within a population [53]. The estimator of nucleotide diversity, π, with a higher value than 0.01, suggests comparatively significant variations in most organisms [54–55]. In this study, nucleotide diversity for all subgroups was lower than 0.01, indicating a lower degree of genetic polymorphism among the haplotypes. The haplotype diversity index was highest in the IB/V subgroup and lowest in the ISTH subgroup. The average haplotype diversity index was 0.677, considering differences among the haplotypes of each subgroup. The obtained average haplotype diversity index suggests that the E. moshkovskii population is highly diverse in this geographical area and influenced by a moderate recombination rate [53]. The high levels of genetic diversity suggested the strong viability and adaptability of the E. moshkovskii population. This may increase the average fitness of E. moshkovskii populations in a changing environment. However, the 18S rRNA data showed that the average nucleotide diversity was reasonably low. The nucleotide diversity was low since it is a highly conserved component with minimal nucleotide substitution rates. Our neutrality test results implied that the Sole D and IOEP subpopulations were not under directional selection pressure. IEH subpopulation was influenced by selection pressure, which resulted in the adaptation of these isolates to coexist with E. histolytica via changes in its genetic constitution. Pairwise genetic differentiation (FST) among different coinfected subgroups ranged from low to high. The FST can range from 0 to 1, where 0 suggests complete sharing of genetic material and 1 suggests no sharing [53,55]. According to the standard FST scale, the fixation index is FST less than 0.05 = little genetic difference; FST of 0.05 0.15 = moderate genetic difference; FST of 0.15–0.25 = great genetic difference and FST greater than 0.25 = very great genetic difference [43]. The majority of FST values of different coinfected subgroups obtained in this study were lower than 0.25, indicating low to moderate genetic differentiation within the different coinfected/sole infected subgroups of the E. moshkovskii population in this geographical area. Whereas FST values with the highest levels of differentiation were observed for IEH subgroups versus three other subgroups–Sole D, IOEP and ISTH indicating a higher genetic differentiation and higher genetic drift or lower gene flow within IEH coinfected subgroups of the parasite [55]. The higher FST values also implied that this genome region may have undergone positive selection pressure in IEH coinfected subgroup [56]. Therefore, the obtained IEH subgroup might be genetically isolated and corresponds to the speciation process. More studies should be performed using other genetic markers to validate whether the coinfected subgroup of E. moshkovskii really corresponds to a new lineage or only to a different genotype of E. moshkovskii; it should be remembered that we only considered a fragment of 18S rRNA gene in this study.
Conclusion
In conclusion, the present study suggested that E. moshkovskii is one of the causative agents for acute diarrhoea in humans. The study found that many diarrhoeal patients infected with this species were negative for other enteric pathogens such as bacteria and viruses. The study recommends further research to understand the transmission dynamics of E. moshkovskii and proper diagnosis to avoid the development of drug-resistant strains. It also highlights the need for public health authorities to implement prevention and control strategies. The findings of the study raise concerns about the importance of proper diagnosis and control of E. moshkovskii infection.
Supporting information
(DOCX)
(DOCX)
Acknowledgments
The authors extend their appreciation to all patients who took part in the study. We are also grateful for the assistance provided by the hospital staff and sample collector in the sample collection process
Data Availability
Representative sequences obtained in this study were deposited in GenBank under the accession numbers ON965383 - ON965450.
Funding Statement
The National Institute of Infectious Diseases (NIID), Tokyo, Japan, and the Indian Council of Medical Research (ICMR), Government of India, provided grant funding to Dr. Sandipan Ganguly. Sanjib K. Sardar received financial support through the ICMR Fellowship. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.WHO/PAHO/UNESCO report. World Health Organization/Pan American Health Organization/UNESCO report of a consultation of experts on amoebiasis. Mexico City, Mexico 28–29 January, 1997. Epidemiol Bull. 1997 Mar; 18(1):13–4. . [PubMed] [Google Scholar]
- 2.Tanyuksel M, Petri WA Jr. Laboratory diagnosis of amebiasis. Clin Microbiol Rev. 2003. Oct; 16(4):713–29. doi: 10.1128/CMR.16.4.713-729.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Fotedar R, Stark D, Beebe N, Marriott D, Ellis J, Harkness J. Laboratory diagnostic techniques for Entamoeba species. Clin Microbiol Rev. 2007. Jul; 20(3), 511–532. doi: 10.1128/CMR.00004-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Espinosa-Cantellano M, Martínez-Palomo A. Pathogenesis of intestinal amebiasis: from molecules to disease. Clin Microbiol Rev. 2000. Apr; 13(2), 318–331. doi: 10.1128/CMR.13.2.318 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Pritt BS, Clark C G. Amebiasis. Mayo Clin Proc. 2008. Oct; 83(10), 1154–1160. doi: 10.4065/83.10.1154 [DOI] [PubMed] [Google Scholar]
- 6.Ali IK. Intestinal amebae. Clin Lab Med. 2015. Jun; 35(2), 393–422. doi: 10.1016/j.cll.2015.02.009 [DOI] [PubMed] [Google Scholar]
- 7.Heredia RD, Fonseca JA, López MC. Entamoeba moshkovskii perspectives of a new agent to be considered in the diagnosis of amebiasis. Acta Trop. 2012. Sep; 123: 139–145. doi: 10.1016/j.actatropica.2012.05.012 [DOI] [PubMed] [Google Scholar]
- 8.Nath J, Ghosh SK, Singha B, Paul J. Molecular Epidemiology of Amoebiasis: A Cross-Sectional Study among North East Indian Population. PLoS Negl Trop Dis. 2015. Dec 3; 9(12), e0004225. doi: 10.1371/journal.pntd.0004225 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kantor M, Abrantes A, Estevez A, Schiller A, Torrent J, Gascon J, et al. Entamoeba histolytica: Updates in Clinical Manifestation, Pathogenesis, and Vaccine Development. Can J Gastroenterol Hepatol. 2018; 4601420. doi: 10.1155/2018/4601420 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Hamzah Z, Petmitr S, Mungthin M, Leelayoova S, Chavalitshewinkoon-Petmitr P. Differential detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii by a single-round PCR assay. J Clin Microbiol. 2006. Sep; 44:3196–3200. doi: 10.1128/JCM.00778-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Royer TL, Gilchrist C, Kabir M, Arju T, Ralston KS, Haque R, et al. Entamoeba bangladeshi nov. sp., Bangladesh. Emerg Infect Dis. 2012; 18(9), 1543–1545. doi: 10.3201/eid1809.120122 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Tengk SA, Moktar, Norhayati. 2011. Public health and clinical importance of amoebiasis in Malaysia: A review. Trop Biomed. 2011 Aug; 28. 194–222. . [PubMed] [Google Scholar]
- 13.Singh P, Galhotra A. Water, Amoebiasis and Public Health. Water and Health. Springer, New Delhi; 2013. p.169–177. doi: 10.1007/978-81-322-1029-0_11 [DOI] [Google Scholar]
- 14.Yimer M, Zenebe Y, Mulu W, Abera B, Saugar JM. Molecular prevalence of Entamoeba histolytica/dispar infection among patients attending four health centres in north-west Ethiopia. Trop Doct. 2017. Jan; 47(1):11–15. doi: 10.1177/0049475515627236 [DOI] [PubMed] [Google Scholar]
- 15.Gomes TDS, Garcia MC, Souza Cunha FD, Werneck de Macedo H, Peralta JM, Peralta RHS. Differential diagnosis of Entamoeba spp. in clinical stool samples using SYBR Green real-time polymerase chain reaction. Scientific World Journal. 2014. Feb 12; 2014:645084. doi: 10.1155/2014/645084 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Burrows RB. Morphological Differentiation of Entamoeba hartmanni and E. Polecki from E. histolytica. Am J Trop Med Hyg. 1959. Sep; 8:583–9. doi: 10.4269/ajtmh.1959.8.583 [DOI] [PubMed] [Google Scholar]
- 17.Khairnar K, Parija SC. A novel nested multiplex polymerase chain reaction (PCR) assay for differential detection of Entameoba histolytica, E. moshkovskii and E. dispar DNA in stool samples. BMC Microbiol. 2007. May 24; 7:47. doi: 10.1186/1471-2180-7-47 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Scaglia M, Gatti S, Strosselli M, Grazioli V, Villa MR. Entamoeba moshkovskii (Tshalaia, 1941): morpho-biological characterization of new strains isolated from the environment, and a review of the literature. Ann Parasitol Hum Comp. 1983; 58(5):413–22. doi: 10.1051/parasite/1983585413 [DOI] [PubMed] [Google Scholar]
- 19.Clark CG, Diamond LS. The Laredo strain and other ’Entamoeba histolytica-like’ amoebae are Entamoeba moshkovskii. Mol Biochem Parasitol. 1991. May; 46(1):11–8. doi: 10.1016/0166-6851(91)90194-b [DOI] [PubMed] [Google Scholar]
- 20.Dreyer DA. Growth of a strain of Entamoeba histolytica at room temperature. Tex Rep Biol Med. 1961;19:393–6. . [PubMed] [Google Scholar]
- 21.Diamond L S, Bartgis I L. Entamoeba moshkovskii: axenic cultivation. Exp Parasitol. 1970. Oct; 28(2):171–5. doi: 10.1016/0014-4894(70)90086-x [DOI] [PubMed] [Google Scholar]
- 22.Ngui R, Angal L, Fakhrurrazi S, Lian YL, Ling L, Ibrahim J, et al. Differentiating Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii using nested polymerase chain reaction (PCR) in rural communities in Malaysia. Parasit Vectors. 2012; 5(1), 187–193. doi: 10.1186/1756-3305-5-187 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Ali IKM, Hossain MB, Roy S, Ayeh-Kumi PF, Petri WA Jr, Haque R, et al. Entamoeba moshkovskii infections in children, Bangladesh. Emerg Infect Dis. 2003; 9(5):580–584. doi: 10.3201/eid0905.020548 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Beck DL, Dogan N, Maro V, Sam NE, Shao J, Houpt ER. High prevalence of Entamoeba moshkovskii in a Tanzanian HIV population. Acta Trop. 2008. Jul; 107(1):48–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Delialioglu N, Aslan G, Ozturk C, Ozturhan H, Sen S, Emekdas G. Detection of Entamoeba histolytica antigen in stool samples in Mersin, Turkey. J Parasitol. 2008; 94:530–2. doi: 10.1645/GE-1355.1 [DOI] [PubMed] [Google Scholar]
- 26.Khairnar K, Parija SC. A novel nested multiplex polymerase chain reaction (PCR) assay for differential detection of Entamoeba histolytica, E. moshkovskii and E. dispar DNA in stool samples. BMC Microbiol. 2007. May 24; 7:47. doi: 10.1186/1471-2180-7-47 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Shimokawa C, Kabir M, Taniuchi M, Mondal D, Kobayashi S, Ali IK, et al. Entamoeba moshkovskii is associated with diarrhea in infants and causes diarrhea and colitis in mice. J Infect Dis. 2012; 206(5), 744–751. doi: 10.1093/infdis/jis414 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Anuar TS, Al-Mekhlafi HM, Ghani MK, Azreen SN, Salleh FM, Ghazali N, et al. First molecular identification of Entamoeba moshkovskii in Malaysia. Parasitology. 2012; 139(12):1521–5. doi: 10.1017/S0031182012001485 [DOI] [PubMed] [Google Scholar]
- 29.Parija SC, Khairnar K. Entamoeba moshkovskii and Entamoeba dispar-associated infections in pondicherry, India. J Health Popul Nutr. 2005. Sep; 23(3):292–5. . [PubMed] [Google Scholar]
- 30.Kyany’a C, Eyase F, Odundo E, Kipkirui E, Kipkemoi N, Kirera R, et al. First report of Entamoeba moshkovskii in human stool samples from symptomatic and asymptomatic participants in Kenya. Tropical diseases, travel medicine and vaccines, 5, 23. doi: 10.1186/s40794-019-0098-4. [DOI] [PMC free article] [PubMed]
- 31.Al-Areeqi MA, Sady H, Al-Mekhlafi HM, Anuar TS, Al-Adhroey AH, Atroosh WM, et al. First molecular epidemiology of Entamoeba histolytica, E. dispar and E. moshkovskii infections in Yemen: different species-specific associated risk factors. Trop Dis Travel Med Vaccines. 2019; 22(4):493–504. doi: 10.1111/tmi.12848 [DOI] [PubMed] [Google Scholar]
- 32.Fotedar R, Stark D, Beebe N, Marriott D, Ellis J, Harkness J. PCR detection of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii in stool samples from Sydney, Australia. J Clin Microbiol. 2007. Mar; 45(3):1035–7. doi: 10.1128/JCM.02144-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Ayed SB, Aoun K, Maamouri N, Abdallah RB, Bouratbine A. First molecular identification of Entamoeba moshkovskii in human stool samples in Tunisia. Am J Trop Med Hyg. 2008. Nov; 79(5):706–7. . [PubMed] [Google Scholar]
- 34.Fonseca JA, Heredia RD, Ortiz C, Mazo M, Clavijo-Ramírez CA, Lopez MC. Identification of Entamoeba moshkovskii in Treated Waste Water Used for Agriculture. Ecohealth. 2016. Mar;13(1):156–60. doi: 10.1007/s10393-015-1084-6 [DOI] [PubMed] [Google Scholar]
- 35.Stensvold CR, Lebbad M, Victory EL, Verweij JJ, Tannich E, Alfellani M, et al. Increased sampling reveals novel lineages of Entamoeba: consequences of genetic diversity and host specificity for taxonomy and molecular detection. Protist, 2011; 1;162(3):525–41. doi: 10.1016/j.protis.2010.11.002 [DOI] [PubMed] [Google Scholar]
- 36.Haghighi A, Kobayashi S, Takeuchi T, Thammapalerd N, Nozaki T. Geographic diversity among genotypes of Entamoeba histolytica field isolates. 2003. Aug; 41(8):3748–56. doi: 10.1128/JCM.41.8.3748–3756.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Haghighi A, Rasti S, Mojarad EN, Kazemi B, Bandehpour M, Nochi Z, et al. Entamoeba dispar: Genetic diversity of Iranian isolates based on serine-rich Entamoeba dispar protein gene. Pak J Biol Sci. 2008;11(23):2613–8. doi: 10.3923/pjbs.2008.2613.2618 [DOI] [PubMed] [Google Scholar]
- 38.Dong H, Li J, Qi M, Wang R, Yu F, Jian F, et al. Prevalence, molecular epidemiology, and zoonotic potential of Entamoeba spp. in nonhuman primates in China. Infect Genet Evol. 2017; 54:216–220. doi: 10.1016/j.meegid.2017.07.002 [DOI] [PubMed] [Google Scholar]
- 39.Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol Biol Evol. 2018 Jun 1; 35:1547–1549. doi: 10.1093/molbev/msy096 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 1993. May; 10:512–526. doi: 10.1093/oxfordjournals.molbev.a040023 [DOI] [PubMed] [Google Scholar]
- 41.Felsenstein J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution. 1985. Jul; 39:783–791. doi: 10.1111/j.1558-5646.1985.tb00420.x [DOI] [PubMed] [Google Scholar]
- 42.Mukherjee AK, Chowdhury P, Bhattacharya MK, Ghosh M, Radendran K, Ganguly S. Hospital-based surveillance of enteric parasites in Kolkata. 2009. Jun 19; 2:110. doi: 10.1186/1756-0500-2-110 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Ajogbasile FV, Kayode AT, Oluniyi PE, Akano KO, Uwanibe JN, Adegboyega BB, et al. 2021. Genetic diversity and population structure of Plasmodium falciparum in Nigeria: insights from microsatellite loci analysis. Malar J. 2021 May; 20(1):236. doi: 10.1186/s12936-021-03734-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Karmakar S, Dutta S, Ganguly S. Surveillance of enteric parasites in an infectious diseases hospital, Kolkata, India. Am J of Biotech and Bioinfo. 2017; 1:5. doi: 10.28933/ajobb-2017-09-2805 [DOI] [Google Scholar]
- 45.Mukherjee AK, Das K, Bhattacharya MK, Nozaki T, Ganguly S. Trend of Entamoeba histolytica infestation in Kolkata. Gut Pathog. 2010. Oct 6; 2(1):12. doi: 10.1186/1757-4749-2-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Abozahra R., Mokhles M., & Baraka K. Prevalence and Molecular Differentiation of Entamoeba histolytica, Entamoeba dispar, Entamoeba moshkovskii, and Entamoeba hartmanni in Egypt. Acta Parasitol. 2020. Dec; 65(4), 929–935. doi: 10.1007/s11686-020-00241-y [DOI] [PubMed] [Google Scholar]
- 47.Samie A, Mahlaule L, Mbati P, Nozaki T, Elbakri A. Prevalence and distribution of Entamoeba species in a rural community in northern South Africa. 2020. Feb 20; 18:e00076. doi: 10.1016/j.fawpar.2020.e00076 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Mbae CK, Nokes DJ, Mulinge E, Nyambura J, Waruru A, Kariuki S. 2013. Intestinal parasitic infections in children presenting with diarrhoea in outpatient and inpatient settings in an informal settlement of Nairobi, Kenya. BMC Infect Dis. 2013 May 27; 13, 243. doi: 10.1186/1471-2334-13-243 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Calegar DA, Monteiro KJL, Gonçalves AB, Boia M N, Jaeger LH, Nunes BC, et al. Infections with Giardia duodenalis and Entamoeba histolytica/Entamoeba dispar as Hidden and Prevalent Conditions in Periurban Communities in the State of Rio de Janeiro, Brazil. J Trop Med. 2020; 1–6. doi: 10.1155/2020/3134849 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Cook GC. Amoebiasis and Giardiasis. Clin Drug Invest. 1994. December; 1–18. doi: 10.1007/BF03260000 [DOI] [Google Scholar]
- 51.Kumar S, Singh VA. Prevalence of Entamoeba histolytica and Giardia lamblia infection in a Rural Area of Haryana, India. Int. J. Curr. Microbiol. App. Sci. 2016. June; 5(6): 204–209. doi: http%3A//dx.doi.org/10.20546/ijcmas.2016.506.024 [Google Scholar]
- 52.Vargas M, Gascon J, Casals C, Schellenberg D, Urassa H, Kahigwa E, et al. Etiology of diarrhea in children less than five years of age in Ifakara, Tanzania. Am J Trop Med Hyg. 2004. May; 70(5), 536–539. . [PubMed] [Google Scholar]
- 53.Mao M, Liu HL. Genetic diversity of Trichomonas vaginalis clinical isolates from Henan province in central China. Pathog Glob Health. 2015. Jul; 109(5):242–246. doi: 10.1179/2047773215Y.0000000020 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Neigel JE, Avise JC. Application of a random walk model to geographic distribution of animal mitochondrial DNA variation. Genetics. 1993. Dec; 135(4), 1209–1220. doi: 10.1093/genetics/135.4.1209 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Deng Y, Liu T, Xie Y, Wie Y, Xie Z, Shi Y, et al. High Genetic Diversity and Low Differentiation in Michelia shiluensis, an Endangered Magnolia Species in South China. Forests, 11(4). doi: 10.3390/f11040469 [DOI] [Google Scholar]
- 56.Das K, Sardar SK, Ghosal A, Saito-Nakano Y, Dutta S, Nozaki T, et al. Multilocus sequence typing (MLST) of Entamoeba histolytica identifies kerp2 as a genetic marker associated with disease outcomes. Parasitol Int. 2021. Aug; 83, 10237. doi: 10.1016/j.parint.2021.102370 [DOI] [PubMed] [Google Scholar]




