Protocol to isolate RBP-mRNA complexes using RNA-CLIP and examine target mRNAs

Summary

RNA-binding proteins (RBPs) regulate diverse functions by interacting with target transcripts. Here we present a protocol to isolate RBP-mRNA complexes using RNA-CLIP and examine target mRNAs in association with ribosomal populations. We describe steps to identify specific RBPs and RNA targets reflecting a variety of developmental, physiological, and pathological states. This protocol enables RNP complex isolation from tissue sources (liver and small intestine) or populations of primary cells (hepatocytes), but not at a single-cell level.

For complete details on the use and execution of this protocol, please refer to Blanc et al. (2014)¹ and Blanc et al. (2021).²

Graphical abstract

Highlights

• •Optimized isolation protocol for RBP-mRNA complexes from tissues and cells
• •Characterization of RBP-bound mRNAs in translating ribosomal fractions
• •Characterization of RBP targets from different physiological and pathologic states

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

RNA-binding proteins (RBPs) regulate diverse functions by interacting with target transcripts. Here we present a protocol to isolate RBP-mRNA complexes using RNA-CLIP and examine target mRNAs in association with ribosomal populations. We describe steps to identify specific RBPs and RNA targets reflecting a variety of developmental, physiological, and pathological states. This protocol enables RNP complex isolation from tissue sources (liver and small intestine) or populations of primary cells (hepatocytes), but not at a single-cell level.

Before you begin

Prepare all the buffers the day before starting. Individual solutions and components of the buffers are prepared with sterile water and filtered. The polysome isolation protocol is optimized for murine liver and small intestine. However, the procedure can easily be adapted to other tissue types and cell cultures with specific modifications, discussed below. Cell extracts prepared from small intestine contain abundant RNases and it is essential to include RNase- and protease inhibitors to maintain integrity of both RNA and proteins. Maintain a clean RNAse-free environment, autoclave dissecting tools, perform all manipulations on ice and keep all solutions, samples, centrifuge tubes, rotor and centrifuge at 4°C in order to reduce activity of RNases and proteases.

All animal handling procedures must conform to institutional (IACUC) protocols. All animal studies reported here were approved by the Washington University Institutional Animal Care and Use Committee (IACUC 20190062 and 21-0276).

Refer to key resources table for a detailed list of material and reagents.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit polyclonal anti-FLAG (1 μg/μL beads)	Thermo Fisher Scientific	Cat#PA1-984B
Chemicals and recombinant proteins
Acid phenol:chloroform MB grade	Ambion	Cat#9720
Glycogen	Roche	Cat#46468429
Guanidine hydrochloride	Fisher Scientific	Cat#BP178
Igepal CA-630 (NP-40)	Sigma-Aldrich	Cat#18896
Ketamine	Dechra	N/A
Phosphate buffered saline	Fisher	Cat#BP399
Sucrose	Fisher Scientific	Cat#BP220
Triton X-100	Fisher Scientific	Cat#BP151-100
Xylazine (AnaSed)	Akorn Inc	N/A
Trypan blue solution	Sigma-Aldrich	Cat#93595
BSA molecular biology grade	New England Biolabs	Cat#B9000S
CIP (5000 U/mL)	New England Biolabs	Cat#M0525S
Collagenase type IV	Sigma-Aldrich	Cat#C5138
Cycloheximide	Sigma-Aldrich	Cat#C7658
Heparin	Sigma-Aldrich	Cat#H3149
Platinum Pfx DNA polymerase (2.5 U/μL)	Invitrogen	Cat#11708-013
Protease inhibitor (cOmplete Mini)	Roche	Cat#11836153001
Proteinase K (600 U/mL-20 mg/mL)	Thermo Scientific	Cat#E08481
RNaseOUT (140 U/mL)	Invitrogen	Cat#100000840
RNAse T1 (1000 U/mL)	Thermo Scientific	Cat#EN0542
RQ1 DNAse (1 u/μL)	Promega	Cat#PR-M6101
T4 PNK (10000 U/mL)	New England Biolabs	Cat#M0201L
T4 RNA Ligase 1 (10000 U/mL)	New England Biolabs	Cat#M0204S
SuperScript III	Invitrogen	Cat#12574026
Fetal bovine serum	Gibco	Cat#A31605
HBSS (-Ca2+, - Mg2+)	Gibco	Cat#14175-079
Hepatocyte wash medium	Gibco	Cat#17704-024
L-15 (Leibovitz’s) medium	Gibco	Cat#11415-064
Penicillin-Streptomycin	Gibco	Cat#15140-122
Other
15 mL conical centrifuge tube	Thermo Scientific	Cat#339650
Dissecting scissors (large blade)	Henry Schein Medical	Cat#1113121
Dissecting scissors (fine blade)	McKesson	Cat#SKLAR 47-1135
Forceps	Miltex	Cat#18-782
IV catheter	Surflo	Cat#SR-OX2225CA
Gradient Master	BioComp Instruments	N/A
Kontes Dounce glass tissue grinder (2 mL)	DWK Life Sciences
NANODrop 2000 spectrophotometer	Thermo Scientific	N/A
Peristaltic pump	Gilson	N/A
ChIP-Grade Protein G Magnetic Beads	Cell Signaling	Cat#9006
Yeast tRNA	Thermo Fisher Scientific	Cat#AM7119
4-12% Bis-Tris	Invitrogen	Cat#NP0321BOX
10 mM dNTP mix	Sigma-Aldrich	Cat#D7295
MOPS	Invitrogen	Cat#NP0001
Hybond C-extra nitrocellulose	Invitrogen	Cat#LC2006
Chemical-resistant marker	Fisher Healthcare	Cat#22-026-799
LI-COR Odyssey	LI-COR	N/A
QIAquick Gel Extraction kit	QIAGEN	Cat#28704
Polypropylene centrifuge tubes	Beckman Coulter	Cat#331372
Oligonucleotides
RL3-biotin	5′-GGCGACCUUCACUGACUGUG-3′
RL5a-TYE705	5′-AGGGAGGACGAUGCGG-3′
DP5a	5′-AGGGAGGACGATGCGG-3′
DP3	5′-CCGCTGGAAGTGACTGACAC-3′
DSFP5a	5′AATGATACGGCGACCACCG ACTATGGATACTTAGTCAGGG AGGACGATGCGG-3′
RPIX1-DP3	5′CAAGCAGAAGACGGCATACGAGAT CGTGATGTGACTGGAGTTCCTTGGCA CCCGAGAATTCCACCGCTGGAAGTGA CTGACAC-3′
SSP1	5′-CTATGGATACTTAGTCAGGGAGGACG ATGCGG-3′

Materials and equipment

• •Perfusion medium

(Ca²⁺and Mg²⁺) free-HBSS. Need 40 mL per mouse.

• •Digest medium

0.05% Collagenase Type IV dissolved in perfusion medium. Prepare 25 mL solution per mouse.

	Reagent	Final concentration	Volume
Complete NP-40 Lysis buffer (10 mL)	HEPES (pH 7.5) (1M)	50 mM	0.5 mL
	KCl (3M)	150 mM	0.5 mL
	EDTA (0.5M)	2 mM	40 μL
	NaF (1M)	1 mM	10 μL
	NP-40 (20%)	0.5%	250 μL
	DTT (1M)	1 mM	10 μL
	Protease Inhibitor (7×)	1×	1.4 mL
	Na3VO4 (0.1M)	2 mM	200 μL
	Sodium Pyrophosphate (1M)	5 mM	50 μL
	RNaseOUT	0.3 Units	2 μL
NDE buffer (10 mL)	HEPES (pH 7.5) (1M)	50 mM	0.5 mL
	KCl (3M)	150 mM	0.5 mL
	NaF (1M)	1 mM	10 μL
	Protease Inhibitor (7×)	1×	1.4 mL
	Na3VO4 (0.1M)	2 mM	200 μL
	Sodium Pyrophosphate (1M)	5 mM	200 μL
	RNaseOUT	0.3 Units	2 μL
NT2 buffer (10 mL)	Tris-HCl (pH 7.5) (1M)	50 mM	0.5 mL
	NaCl (5M)	150 mM	0.3 mL
	MgCl2 (1M)	1 mM	10 μL
	NP-40 (20%)	0.05%	25 μL
High salt NT2 buffer (10 mL)	Tris-HCl (pH 7.5) (1M)	50 mM	0.5 mL
	NaCl (5M)	500 mM	1 mL
	MgCl2 (1M)	1 mM	10 μL
	NP-40 (20%)	0.05%	25 μL
RNase T1 buffer (1×) (1 mL)	Tris-HCl (pH 7.5) (1M)	50 mM	50 μL
	NaCl (5M)	50 mM	10 μL
	EDTA (0.5M)	2 mM	4 μL
CIP wash buffer (1×) (1 mL)	Tris-HCl (pH 7.5) (1M)	50 mM	50 μL
	EGTA (0.5M)	20 mM	40 μL
	NP-40 (20%)	0.05%	2.5 μL
PNK wash buffer (1×) (1 mL)	Tris-HCl (pH 7.5) (1M)	50 mM	50 μL
	MgCl2 (1M)	10 mM	10 μL
	NP-40 (20%)	0.05%	2.5 μL
PK buffer (2×) (1 mL)	Tris-HCl (pH 7.5) (1M)	50 mM	50 μL
	NaCl (5M)	100 mM	20 μL
	EDTA (0.5M)	10 mM	20 μL
	SDS (20%)	0.5%	25 μL
Polysome Lysis buffer (5 mL)	Tris-HCl (pH 7.5) (1M)	25 mM	125 μL
	NaCl (5M)	250 mM	250 μL
	MgCl2 (1M)	5 mM	25 μL
	DTT (1M)	5 mM	25 μL
	Heparin (40 mg/mL)	0.2 mg/mL	25 μL
	RNaseOUT (40U/μL)	20 U/mL	2.5 μL
	Cycloheximide (20 mg/mL)	0.1 mg/mL	25 μL
	Protease inhibitor (7×)	1×	714 μL
Sucrose gradient buffer (100 mL)	Tris-HCl (pH 7.5) (1M)	25 mM	2.5 mL
	KCl (3M)	140 mM	4.7 mL
	MgCl2 (1M)	5 mM	0.5 mL
	DTT (1M)	0.5 mM	50 μL
	Cycloheximide (20 mg/mL)	0.1 mg/mL	0.5 mL

All the buffers are prepared freshly and kept at 4°C.

Reverse transcription reaction

Reagent	Final concentration	Amount
RNA		11.5 μL
dNTPs (10 mM)	0.5 mM	1 μL
DP3 primer (10 μM)	0.25 μM	0.5 μL
DTT (0.1 M)	5 mM	1 μL
First strand buffer (5×)	1×	4 μL
RNaseOUT		1 μL
Superscript III (200U/μL)		1 μL

PCR amplification reaction (round 1)

Reagent	Final concentration	Amount
cDNA		2 μL
Pfx buffer (10×)	1×	2.5 μL
dNTP (10 mM)	0.3 mM	0.75 μL
MgS04 (50 mM)	1 mM	0.5 μL
Dp5a primer (10 μM)	0.3 μM	0.75 μL
DP3 primer (10 μM)	0.3 μM	0.75 μL
Platinum Pfx (2.5U/μL)	0.5 U	0.2 μL
H20	N/A	18.3 μL

PCR amplification reaction (round 2)

Reagent	Final concentration	Amount
PCR	50 ng
Pfx buffer (10×)	1×	2.5 μL
dNTP (10 mM)	0.3 mM	0.75 μL
MgS04 (50 mM)	1 mM	0.5 μL
DSFP5a primer (10 μM)	0.3 μM	0.75 μL
RPIX-D3 primer (10 μM)	0.3 μM	0.75 μL
Platinum Pfx (2.5U/μL)	0.5 U	0.2 μL

Step-by-step method details

Part 1 HITS-CLIP analysis of RBP complexes

The protocol begins with isolation of primary hepatocytes. However, the method can be adapted to whole tissue with modifications regarding lysate preparation (see note in cell lysis section). Here, we use primary hepatocytes isolated from transgenic mice expressing FLAG-tagged protein which allows the utilization of commercially available FLAG antibody and minimizes non-specific pull down of proteins. One advantage of this approach, modified from earlier descriptions,³ is that all purification steps to enrich RBP complexes are performed directly on the magnetic beads used during immunoprecipitation which minimizes incidental loss.⁴ The success of HITS-CLIP relies on an efficient interaction between the antibody and its target protein. Prior to immunoprecipitation check by Western blot that the antibody recognizes the protein of interest with minimal non-specific protein detection. As a negative control test the antibody on cells that do not express the targeted protein.

Primary hepatocyte isolation

Liver perfusion

Timing: ∼20 min per mouse

Note: The procedure is similar to the STAR protocol⁵ published in 2020 and we detail modifications to the procedure with our specifications.

• 1.Set up a peristaltic pump at 3.5 mL/min as perfusion flow rate.
• 2.Wash the tubing of pump with 70% Ethanol, PBS and then perfusion medium.
• 3.Place Perfusion medium and Digest medium in a water bath set at 37°C.
• 4.Keep the Leibovitz’s L-15 medium in ice until receiving the dissected perfused liver.
• 5.After anesthesia, the mouse is positioned on a dissecting board, belly up and the abdomen is sanitized with 70% ethanol.
• 6.
  Perform a midline ventral incision with large blade scissors.

  • a.
    Pull aside the flap of the skin to expose the body wall.
  • b.
    Make an incision into the peritoneum with fine blade scissors to expose the liver.
• 7.Cannulate the vena cava with a 22-gauge iv catheter and perfuse the liver with perfusion medium for 10 min.

Note: This step chelates calcium and flushes blood out of the liver which becomes pale.

• 8.Perfuse the liver with Digest medium containing 0.05% Collagenase in perfusion medium.

Note: this allows dissociation of extracellular matrix. After 6–7 minutes of digestion, the liver appears very soft and fragile.

• 9.
  Isolate the liver.

  • a.
    Remove the gall bladder.
  • b.
    Using fine blade scissors dissociate the liver from the diaphragm, the esophagus, stomach, kidney and small intestine.
  • c.
    Place the liver in a 15 mL plastic conical tube containing 15 mL of Leibovitz’s L-15 medium supplemented with 5% FBS and 1% of a mix of penicillin and streptomycin solution.

CRITICAL: The perfused liver is kept on ice. To minimize loss of viability, we limit the number of isolations to 3 mice at a time.

Note: for more details, refer to video presentation in (Chami-Natan and Goldstein, 2020⁵).

Hepatocyte isolation

Timing: 30–45 min

All the following steps are performed in sterile environment in a tissue culture hood.

• 10.Manually disrupt the liver in the 50 mL tube using a rubber cell scraper, keeping the 50 mL tube in ice.

Note: All liver lobes should be dissociated and completely disaggregated into a slurry. To complete the tissue disruption and reduce tissue clumps, pipet up and down through a 25 mL serological pipet followed by 2–3 passages through a 10 mL pipet.

• 11.Filter the 15 mL suspension through a 100 μm nylon cell strainer into a new 50 mL tube on ice.
• 12.Spin at 50 × g for 5 min at 4°C. The hepatocytes are contained in the pellet.
• 13.Wash the pellet twice with 30 mL hepatocyte wash medium, with a 5 min spin at 50 × g between each wash.
• 14.After the final spin, the hepatocytes are resuspended in 10 mL hepatocyte wash medium supplemented with 5% FBS and 1% Penicillin-Streptomycin.
• 15.Count cell number and determine viability using Trypan blue.

Note: Usually a 1:3 or 1:4 dilution allows accurate determination with expected 80%–90% viability.

• 16.Plate cells on 10 mm collagen-coated dishes at a density of 5- to 100 × 10⁶. Place the dishes in a humidified 5% CO₂ incubator set a 37°C until the next day.

Crosslinking immunoprecipitation (CLIP)

Timing: ∼ 24 h

Our method takes advantage of the observation that UV irradiation generates covalent bonds between RNA-protein complexes at contact sites.⁶ The RBP of interest bound to its RNA targets can then be purified using stringent conditions. The co-purified RNAs are then partially digested with RNases, the protein compound of the complex is eliminated by treatment with proteinase K and the RNA purified after addition of RNA linkers allowing cDNA synthesis and deep sequencing (HIT).

UV-irradiation

• 17.Wash the monolayer of primary hepatocytes twice with 4 mL ice-cold PBS.
• 18.Remove the liquid and place the dishes without their cover on a layer of ice in a Stratalinker 2400 (Stratagene) and irradiate with 400 mj/cm² of 254 nm UV light.
• 19.Scrape the hepatocytes in 1 mL NP-40 complete lysis buffer.
• 20.Incubate 5 min on ice.
• 21.Freeze cells at −80°C to promote lysis.

Note: An alternative to these previous steps is to scrape the cells in 2 mL ice cold PBS containing protease and phosphatase inhibitors after irradiation. Spin at 300 × g for 5 min at 4°C, resuspend the cell pellet in 1 mL cold PBS and transfer into a 1.5 mL Eppendorf. Tube kept on ice. Spin at 300 × g for 5 min, aspirate the supernatant leaving a thin layer of liquid to prevent the cell pellet to dry and store at −80°C until further processing.⁷ This allows preparation of more cells in order to perform large-scale immunoprecipitation. The energy of irradiation may be adjusted according to the affinity of the RBP to its targets. One can use 100 to 400 mj/cm2 or perform several irradiations at a given energy level. Use the condition that yield to maximum signal upon Western blot.

Cell lysis

• 22.Thaw lysates on ice and complete the lysis by homogenizing with a glass Dounce and Pestle B (tight). Perform 20 strokes (up and down).

Note: Check efficiency of lysis under microscope. If unbroken cells remain perform two additional strokes and check again. When starting from frozen cell pellets, thaw pellet on ice, wash once with cold PBS, spin at 300 × g, remove PBS, resuspend cells in Complete NP-40 Lysis buffer and proceed with Dounce homogenization.

Alternative: Rather than using isolated hepatocytes, one can use whole liver as starting material. Freshly harvested livers are washed twice with 10 mL chilled PBS and minced with a razor blade. Minced pieces of liver are covered with 1–2 mL chilled PBS, placed on a petri dish on a layer of ice and exposed to 400 mj/cm² of 254 nm UV irradiation in a Stratalinker 2400. Following three cycles of irradiation, the minced pieces of liver are collected by centrifugation at 380 × g and resuspended in complete NP-40 Lysis buffer. Prepare the lysate by homogenizing using a glass Dounce and Pestle A (loose) (20 strokes) followed by 20 strokes with Pestle B (tight). Clear the lysate by centrifugation at 13,000 × g for 15 min at 4°C and proceed with immunoprecipitation.

• 23.Clear the lysates by centrifugation at 13,000 × g for 15 min at 4°C.
• 24.Incubate lysates with RNaseOUT (3 μL/mL lysate) for 5 min on ice.
• 25.Treat Lysates with RQ1 DNAse (30 μL/mL lysate) for 5 min at 37°C, gently mixing every 2 min.

Note: DNAse treatment is important to eliminate contamination with genomic DNA. Make sure to add RNase inhibitor in lysis buffer. It does not inhibit RNase T1 used downstream.

Immunoprecipitation

• 26.Add 0.5M EDTA (4 μL/mL lysate, i.e., 2 mM final concentration) to chelate Mg²⁺ which inhibits RNase T1 and add RNase T1 (0.3 μL/mL lysate) (0.3 Units/μL final concentration) for partial digestion of the bound RNA. Incubate at 24°C for 15 min and then place on ice.
• 27.
  Dilute lysate 1:1 with NDE buffer containing proteases and phosphatases inhibitors. Keep on ice until immunoprecipitation is undertaken.

  • a.
    Preparation of ChIP-Grade Protein G Magnetic beads

    Note: Use a magnetic tube rack to wash and handle magnetic beads. Once a tube containing the magnetic beads is placed on the rack, the beads migrate towards the magnet allowing removal of liquid without disturbing the beads. Make sure all the beads have moved towards the magnet before removing any liquid. All the washes are conducted by mixing the beads in solution by inversion 3 times. Following the washes, tubes containing beads are placed back on the magnet and wash solution is carefully aspirated.

    • i.
      Resuspend the beads by gentle inversion.
    • ii.
      Wash appropriate volume of beads (50 μL of beads per mL lysate) twice with 10 volumes of NT2 buffer.
    • iii.
      Resuspend beads in 5 volumes of NT2 buffer supplemented with 5 mg/mL BSA and 0.2 mg/mL yeast tRNA and incubate at 4°C for 1 h. This allows the blocking of the beads minimizing further a-specific binding.
    • iv.
      Wash the beads twice with 10–20 volumes of NT2 buffer and resuspend in 10 volumes of 1× NDE buffer.
  • b.
    Coating of pre-equilibrated beads with anti-FLAG antibody.

    • i.
      Dilute beads (40 μL/mL lysate) into 5 volumes of NT2 buffer supplemented with 1 mg/mL BSA and 0.2 mg/mL yeast tRNA.
    • ii.
      Add anti-FLAG antibody (4 μg/40 μL beads) and incubate with constant rotation for 4 h at 4°C.
    • iii.
      Wash antibody-bound beads twice with 10–20 volumes of NT2 buffer (Mix the beads in solution, away from the magnet).
  • c.
    Immunoprecipitation.

    • i.
      Add antibody-bound beads (40 μL) to 2 mL diluted cell lysates.
    • ii.
      Incubate 14 h at 4°C under constant rotation.
    • iii.
      Capture the beads using magnetic tube rack.
    • iv.
      Wash the beads twice with 1 mL NT2 buffer.
    • v.
      Wash the beads twice with 1 mL high salt NT2 buffer.
    • vi.
      Capture the beads and aspirate the remaining wash buffer.

On-beads treatment

Timing: ∼2.5 h

Mild digestion of bound RNA

Note: at every change of conditions of incubation, 2 μL of RNaseOUT is added per 100 μL of reaction to preserve the RBP complexes.

• 28.Resuspend the RBP complexes-bound beads into 100 μL RNase T1 mix (1× RNaseT1 buffer, 2 μL RNaseOUT, 1.6 U/μL final RNase T1) and incubate 15 min at 25°C, then place on ice for 5 min.
• 29.Add 1 mL of high salt NT2. Buffer and separate the beads.
• 30.Wash twice with high salt NT2 buffer.

5′end dephosphorylation

• 31.Resuspend washed beads in 50 μL CIP reaction (1× CIP buffer, 0.2 U RNaseOUT, 0.5 U/μL CIP) and incubate 10 min at 37°C with periodic gentle mixing as beads tend to sediment at the bottom of the tube.
• 32.Add 1 mL of CIP wash buffer and separate the beads.
• 33.Wash the beads twice with CIP wash buffer.
• 34.Wash twice with PNK wash buffer. After the last wash remove all the wash buffer.

5′ and 3′ RNA adapter ligation

• 35.Ligate RL3-Biotin primer by incubating beads in 50 μL ligation mix (1× ligase buffer, 0.2 U RNaseOUT, 20 pmol RL3-biotin primer, 12.5 U T4 RNA ligase) at 25°C for 2 h (Figure 1)
• 36.Add 1 mL PNK wash buffer and separate the beads.
• 37.Wash once with 1 mL PNK wash buffer.
• 38.Resuspend the beads in 100 μL of PNK mix containing 1× ligase buffer, 0.2 U RNaseOUT and 25 U T4 PNK and incubate at 37°C for 20 min.
• 39.Add 1 mL of PNK wash buffer and separate the beads. Remove solution.
• 40.Resuspend in 50 μL ligation reaction containing RL5a-TYE705 RNA adapter and incubate at 25°C for 2 h.
• 41.Wash once in 1 mL NT2 buffer.
• 42.Wash once with high salt NT2 buffer.
• 43.Wash three times with 2 mL PNK wash buffer.
• 44.Completely remove the last wash buffer.

Note: RL5a-TYE705 allows visualization by near-infrared fluorescence.

Figure 1.

CLIP-Seq adapters and multiplex oligonucleotides

(A) Following immunoprecipitation of the RNP complexes, 5′and 3′RNA adapters with TYE705 and biotin dye, respectively are ligated to the RNAs of the RNP complexes.

(B) Upon Western blot, isolation of the RNP complexes and RNA extraction, the RNAs are reverse-transcribed using DP3 primer and PCR amplified using DP5a and DP3 primers.

(C) Following initial target amplification a second round of PCR is performed with indexed primers allowing sequencing of several samples together in a single illumina flow cell lane. After gel purification DNA is ready for quantification and high-throughput sequencing using primer SSP1.

Electrophoretic separation of RNP complexes and RNA extraction

Timing: ∼ 8–24 h

Electrophoresis and separation of labeled RNP complexes

• 45.Resuspend the beads in 40 μL of 1× SDS-PAGE loading buffer.
• 46.Denature and release RBP complexes by heating the beads for 5 min at 95°C.

Note: depending on the size of the heating block available, transfer the beads to either a 200 μL PCR tube or a 600 μL Eppendorf tube.

• 47.Remove the beads by placing the tubes on the magnetic tube rack.
• 48.Collect the supernatant, load on a 4–12 Bis-Tris Novex gel and run at 180 V for 90 min at 4°C.
• 49.Transfer RNP complexes with 1× MOPS transfer buffer containing 10% Methanol onto nitrocellulose (Hybond C-extra) for 2h30 min at 33V.
• 50.Mark the membrane with a chemically resistant marker at the upper and lower right corner for orientation.
• 51.Wash the membrane with 10 mL PBS.
• 52.Visualize the labeled RNP complexes using Licor Odyssey at 700 nm.
• 53.Capture and print the TIFF images.
• 54.Line up images and membrane and excise areas of nitrocellulose overlapping the labeled RNP complexes.

Note: the excised pieces of nitrocellulose can be kept frozen at −80°C until further process. In absence of visual detection of RNP complexes, a region 75 KDa above the size of the immunoprecipitated protein can be excised before proteinase K treatment and RNA isolation. This 75 KDa size corresponds to ∼ 220 nucleotide long RNA.^8,9

• 55.Pre-incubate 11 μg of tRNA (220 ng/μL final) with 11 Units of RQ1-DNase in 50 μL for 30 min at 37°C.
• 56.Add 5 μL of 20 mM EGTA to inactivate DNase. The tRNA is now at a concentration of 0.2 μg/μL.
• 57.Prepare a PK solution by diluting the tRNA 1:8 and proteinase K 1:5 to a final concentration of 25 ng/μL and 2 mg/mL respectively in a final volume of 200 μL in 1× PK buffer.
• 58.Incubate at 37°C for 30 min to eliminate RNAses in the PK solution.
• 59.Incubate the pieces of nitrocellulose with 200 μL of RNAse-free PK solution for 20 min at 55°C with agitation on a rotating wheel.
• 60.Add 200 μL of 50 mM Tris and 100 mM NaCl and incubate for 20 min at 37°C on rotating wheel.

RNA extraction

• 61.Add an equal volume (400 μL) of cold phenol/chloroform/IAA (125:24:1) pH 4.5. Vortex 1 min. Spin 5 min at max speed (16,800 × g ) at 24°C.
• 62.
  Collect the aqueous phase and add an equal volume of chloroform.

  • a.
    Vortex 30 s, spin at 16,800 × g for 5 min.
  • b.
    Collect the aqueous phase into a new Eppendorf tube.
  • c.
    Add 1/10 of volume of 3M Na-Acetate pH 5, 3 volumes of ethanol, vortex and precipitate at −20°C 14 h or −80°C for 1 h.
• 63.Spin 30 min at maximum speed (16,800 × g) in a centrifuge refrigerated at 4°C.
• 64.
  Wash the pellet with 75% Ethanol (100 μL).

  • a.
    spin 10 min at maximum speed (16,800 × g).
  • b.
    remove the supernatant and air-dry the pellet 10 min at 24°C.
  • c.
    Resuspend the pellet in 11.5 μL RNAse-free H₂O.

Synthesis of cDNA and PCR amplification

Timing: ∼ 6 h

Reverse transcription

• 65.
  Add to the RNA dNTPs (0.5 mM final), DP3 primer and H₂O to 13 μL. (Figure 1).

  • a.
    Heat at 65°C for 5 min, then place on ice for 1 min.
  • b.
    Add DTT, 5× first strand buffer, RNAseOUT and Superscript III in a total volume reaction of 20 μL.
  • c.
    Place in thermocycler and incubate at 50°C for 45 min followed by 15 min at 55°C and 15 min at 70°C. Keep the cDNA at 4°C.

PCR amplification

• 66.Combine 2 μL of cDNA with 5′ and 3′ primers, DP5a and DP3, in 25 μL reaction containing dNTP and 0.5 Units Platinum Pfx DNA polymerase.
• 67.Place the reaction in a thermocycle and perform the following PCR reaction:

Steps	Temperature	Time	Cycles
Denaturation	94°C	2 min	1
Denaturation	94°C	30 s	40
Annealing	58°C	30 s
Elongation	68°C	30 s
Final elongation	68°C	10 min	1
Hold	4°C	infinite

• 68.Gel purify PCR products on a 2.3% agarose gel following Qiagen Gel extraction procedure.
• 69.Use an aliquot of the purified PCR products (50 ng) to perform a second round of amplification with 5′ primer DSFP5a and 3′ indexed primer (RPIX-D3) in 25 μL reaction (see Figure 1 for schematic of CLIP-seq adapters and oligonucleotides).

The amplification parameters are as follow:

Steps	Temperature	Time	Cycles
Denaturation	94°C	2 min	1
Denaturation	94°C	30 s	35
Annealing	62°C	45 s
Elongation	68°C	45 s
Final elongation	68°C	10 min	1
Hold	4°C	infinite

Note: Purification of PCR products can be performed with any other DNA cleanup system, such as AMPure XP (Beckman Coulter), PureLink Quick Gel Extraction kit (ThermoFisher).

CRITICAL: Evaluating the concentration of DNA after the first round of PCR is necessary to prevent overloading the second PCR reaction with too much DNA which can cause non-specific products as a result of false priming. This step also provides A260/280 and A260/230 ratio which will indicate the quality of the sample. A ratio greater than 1.8 is indicative of good quality and absence of contamination that could impair the second round of amplification.

• 70.Gel purify the final PCR products and submit for high throughput sequencing using primer SSP1. Single-read sequencing is performed on an Illumina HiSeq 2000. For detailed bioinformatics analysis.²

Part 2 Polysome profiling of mRNAs

Mouse tissue dissection

Timing: 30 min

Small intestine

• 71.Anesthetize the mouse with ketamine and xylazine followed by cervical dislocation.
• 72.Secure the animal on a dissecting board with pins.
• 73.Sanitize the abdomen with 70% ethanol.
• 74.
  Use forceps to hold the skin and perform a midline ventral incision with large blade scissors.

  • a.
    Pull aside the flap of the skin to expose the body wall. Make an incision with fine blade scissor to expose the internal abdominal organs.
  • b.
    Unfold the small intestine and carefully displace outside the ventral cavity.

    Note: this allows the dissection of the entire small intestine from the gastro-duodenal junction proximally to the ileo-cecal junction and colon at its distal end.

  • c.
    Place the entire small intestine on a petri dish containing 5 mL ice-cold PBS.
  • d.
    Open the intestine longitudinally along the antimesenteric border.
  • e.
    Wash twice with 5 mL cold PBS.
  • f.
    Incubate in 5 mL PBS supplemented with 100 μg/mL cycloheximide for 5 min on ice.
  • g.
    Scrape the mucosa with gentle compression using a glass slide.
  • h.
    Resuspend the scraped mucosa in 1 mL cold polysome lysis buffer (PLB).
  • i.
    Keep into a 1.7 mL Eppendorf tube on ice for 5–15 min.

    Note: while the tissue is incubating in lysis buffer, another small intestine isolation can be performed from a different animal.

Liver

• 75.
  Follow the same steps as above 71 to 74a to identify and remove the five liver lobes.

  • a.
    Remove the gallbladder and dissect out the liver.
  • b.
    Place the liver in a petri dish on ice and wash twice in 10 mL cold PBS.
  • c.
    Cut the liver lobes in 0.5 cm pieces with fine blade scissors and incubate in 10 mL ice-cold PBS supplemented with 100 μg/mL cycloheximide for 5 min on ice.
  • d.
    Mince the liver pieces with a razor blade.
  • e.
    Transfer the finely minced liver into a 2 mL Eppendorf tube.
  • f.
    Incubate in 1.2 mL cold PLB on ice for 5–15 min.

Note: the volume of PLB can be adjusted to the size of the tissue.

Extract preparation

Timing: 30–45 min

• 76.
  Disrupt the tissue in a chilled 2 mL Dounce glass tissue grinder.

  CRITICAL: To prepare extract from scraped intestinal mucosa, 20 strokes with pestle B is usually sufficient to achieve more than 90% cell disruption. A stroke is defined as a single down and up movement of the pestle inside the Dounce. To prepare extract from minced liver, 20 stokes with pestle A followed by 20 strokes of pestle B are required.

  Note: Depending on the intrinsic fibrous nature of the tissue the type of pestle (A i.e. “loose” or B i.e. “tight’) and the number of strokes can be adjusted to obtain maximum cell disruption. To generate extract from adipocytes or primary hepatocytes, we perform 20 strokes with pestle B. By contrast, to generate an extract from muscle 30 strokes with pestle A followed by 20 strokes with pestle B was required. Verify complete cell disruption by examining an aliquot of the extract under a light microscope. Avoid excessive foaming. When starting from primary hepatocytes, prepare extract from 2-3 100 mm dishes at 80% confluency (20–50 × 10⁶ cells per 100 mm dish).

  • a.
    For both tissue types, following the first homogenization, evaluate the volume of extract.
  • b.
    Add 10% Triton X-100 to achieve a final concentration of 1%.
  • c.
    Perform 10 additional strokes using pestle B.
  • d.
    Centrifuge the extracts at 10,000 × g for 10 min in a centrifuge equilibrated at 4°C.
  • e.
    Load cleared extract on top of a 10%–50% sucrose gradient. (∼750 μL per 12 mL gradient).

Sucrose gradient preparation

Timing: 30 min

• •10% sucrose buffer: 0.1 g/mL sucrose in sucrose gradient buffer.
• •50% sucrose buffer: 0.5 g/mL sucrose in sucrose gradient buffer.

Note: Prepare the stock sucrose gradient buffer the day before use. The day of use add DTT and cycloheximide. Prepare 50 mL each.

Rotor and centrifuge tubes buckets are prechilled at 4°C.

• 77.Pipette 6 mL of complete 50% sucrose buffer in each polypropylene centrifuge tube (Beckman).
• 78.Add the upper complete 10% sucrose buffer layer by placing the pipette tip against the side of the tube and pipetting down the solution very slowly. Place a capillary cap on top of the tube and secure it with Parafilm.

Note: A properly poured gradient should show a clear interface between the two layers.

• 79.
  Make the gradient using an automatic gradient maker. We use the Biocomp model 106 Gradient Master.

  • a.
    Level the MagnaBase tube holder using a bubble level set at the center of the tube holder.
  • b.
    Press the keys [Recall] [0] followed by keys [1], [4] and [7] to adjust 0.1, 1 and 10 degrees up respectively and keys [3], [6], [9] for similar degrees down (Figure 2).
  • c.
    Place the centrifuge tubes in the tube holder and set the gradient maker for time, angle and speed of rotation of the tube holder.

Note: If using gradient maker Biocomp model106 set up the following three cycles.

• •Cycle 1: 5 s/87º/30 rpm.
• •Cycle 2: 15 s/87º/0 rpm.
• •Cycle 3: 19 s/80 º/20 rpm.
• •Cycles 1 and 2 are consecutive and repeated 5 times followed by one time cycle 3.

Note: At the end of the run, the tube holder returns to a vertical position. The gradients are ready and kept at 4°C until the extracts are ready for loading. If using a different gradient maker, some pre-set programs may be available.

Alternative: The sucrose gradients can also be prepared using a traditional hand-made method.¹⁰ This consists of loading at the bottom of the SWT41 tube 2.4 mL of the 50% sucrose solution and quickly freezing in either liquid nitrogen or by placing tubes at -80°C. None of these procedures affect the quality of the tubes. Once the 50% sucrose layer is frozen, 2.4 mL of 40% sucrose is added and frozen. The 30, 20 and 10% sucrose layers are added following the same procedure. Let the gradients thaw at 4°C the night before use.

• 80.Gently and slowly load the lysates (∼750 μL) on top of each centrifuge tube placing the P1000 pipette tip at a 45⁰ angle to the meniscus of the sucrose solution against the wall of the centrifuge tube and pipetting down slowly. The sample will spread gently across the surface of the gradient.
• 81.Balance paired tubes with lysis buffer. SWT41 rotor has centrifuge buckets paired as follows: 1–4, 2–5 and 3–6. Close the buckets with their respective caps and place the assembled rotor-buckets in the ultracentrifuge chamber.
• 82.Spin the samples at 261,000 × g for 2h15 at 4°C.
• 83.Prepare 13 × 2mL Eppendorf tubes marking each to indicate 900 μL and keep them on ice.

Figure 2.

BioComp gradient maker

Sucrose gradients are prepared by loading 6 mL of 50% sucrose gradient buffer at the bottom of the ultracentrifugation tube, followed by slow loading of 6 mL of 10% sucrose gradient buffer. By moving the tube slowly, the interphase between the two solutions can be observed. The ultracentrifugation tube is closed by a capillary cap and secured with parafilm before being positioned on the Magnabase Tube holder of the gradient maker. The tube holder has been previously leveled using keys 7, 4, 1 (up) and 9, 6, 3 (down). Enter parameters for time, angle and speed of rotation and start run. The Magnabase moves to the first set angle and start to rotate. The procedure takes approximately 2 min. At the end of the procedure the Magnabase returns to the original vertical position. The gradients are ready. The separation between the two solutions is no longer visible.

Fractions collection

• 84.Remove centrifuge tube from its bucket and place it on a tube holder.
• 85.Pierce the centrifuge tube at the base using a 26-gauge needle.
• 86.Slowly remove the needle and start to collect the fraction from the bottom of the tube. Keep the fractions on ice.
• 87.Use a NANODrop instrument to read absorbance at 260 nm of 2 μL aliquot per fraction after blanking the spectrophotometer with water.

RNA extraction

Timing: ∼ 2 days

To each fraction add.

• •1 volume (900 μL) of 8M guanidine HCl.
• •1/10 volume (90 μL) sodium acetate 3M pH 5.2.
• •1 μL glycogen (∼20 μg).

Note: To reduce the number of pipetting steps, a master mix can be prepared and 991 μL added to each fraction. After vortexing, the RNA can be extracted immediately or the fractions kept at −20°C until further extraction. Glycogen is used as carrier of nucleic acids during precipitation.

• 88.
  Split each fraction into 2 × 2 mL Eppendorf tube, each containing 900 μL.

  • a.
    Add to each tube 1 volume (900 μL) phenol: chloroform: IAA (125:24:1) pH4.
  • b.
    Vortex 10 s and incubate on ice for 15 min.
  • c.
    Spin at 14,000 rpm for 20 min at 4°C.
  • d.
    Collect the aqueous phase and add 1 volume (900 μL) isopropanol. Vortex and incubate at −20°C for 14 h.

Note: incubation can be performed at −80°C for a shorter period of time (hours).

• 89.Precipitate the RNA by centrifuging 20 min at 4°C at 16 800 × g.
• 90.
  Wash with 50 μL 75% Ethanol.

  • a.
    Combine identical fraction.
  • b.
    Spin the resulting 13 fractions for 15 min at 4°C at 16 800 × g.
  • c.
    Air dry 10 min at 24°C, open cap and resuspend in 100 μL water.
• 91.Add 7.5M LiCl to a final concentration of 2M. Vortex and incubate 14 h at −20°C or −80°C for 30 min.

Note: By specific interaction of ribose sugar of RNA and lithium, Lithium chloride precipitation will eliminate any remaining DNA and protein in the solution, making final RNA quantitation more accurate.

• 92.Spin down the RNA at 16 800 × g for 20 min at 4°C.

CRITICAL: Make sure of the orientation of the tubes in the centrifuge to know which side the RNA pellet will be. At that point the pellet is transparent and not visible.

• 93.
  Wash the pellet with 50 μl 75% Ethanol.

  • a.
    Spin at 16,800 × g for 15 min at 4°C.
  • b.
    Remove the supernatant and air dry 10 min at 24°C.
  • c.
    Resuspend in 20 μL water and determine the concentration in each fraction.

Note: The concentrations vary between fractions (100–900 ng/μL). The RNA is ready for cDNA synthesis followed by quantitative PCR of the genes of interest.

Expected outcomes

In the few hours following plating the hepatocytes appear round. After 14 h culture their appearance will transform into polygonal-shaped cells (Chami-Natan and Goldstein, 2020). The dead cells will float and are removed by careful aspiration of the medium.

The intensity of the signal from the RBP complexes and abundance of PCR products depend on the quantity of starting material and the efficiency of cross link between the protein of interest and their RNA targets. Make sure the protein of interest is expressed (Western blot, immunohistochemical detection) in the tissue/cell source of lysate. 20 × 10⁶ total cells with more than 80% viability should yield a highly concentrated lysate. Primary hepatocytes do not maintain physiologic function in culture for more than 48h after plating. Make sure the downstream experiments leading to the RBP complexes isolation are started 24 h following hepatocyte isolation.

For polysome isolation one may see distinct bands, depending on the quantity of extract loaded at the top of the gradient. Proceed even if bands are not visible. After fractionation, two major peaks of absorption at 260 nm should be detected. The first peak represents the top of the gradient and corresponds to monosomal or free RNA fractions (1–4), reflecting non- translating RNAs. A second peak corresponding to polysomal fractions (6–13) containing translated RNAs engaged with ribosomes (Figure 3).¹ The closer to the bottom of the gradient transcripts sediment the more highly translated they are.

Figure 3.

Polysome distribution of Sox9 mRNA from WT and A1cf ^+/Tg liver extracts following fractionation by sucrose gradient centrifugation

RNA was extracted from thirteen individual fractions. Following cDNA synthesis Sox9 mRNA abundance in each fraction was evaluated by quantitative PCR. Fractions were collected from the bottom (highly translated RNAs, (polysome)) to the top of the gradient (monosome fractions, less efficiently translated RNAs).

Limitations

The perfusion rate may vary with the genotype, age and disease state of the animals. Animals older than 8–12 weeks or animals with steatosis or fibrosis may require a different perfusion speed. Similarly, the duration of the digestion can be adjusted. Ultimately, the yield and viability of hepatocytes will guide perfusion rates and times of digestion which range between 4 and 6 min.

Immunoprecipitation of the RBP of interest is a critical step. Using a high-quality antibody validated for IP and with validated specificity for the targeted RBP could be a technical challenge. Therefore when possible using an epitope tagged RBP target is a good approach to circumvent this technical limitation.

A second point is that performing HITClIP from hepatocytes overexpressing a target RBP is that the transcriptome composition of transgenic hepatocyte may be different from a wild-type hepatocyte. Therefore, an RNA target identified from transgenic hepatocytes should be considered in context.

The size of the polysome peaks depends on the proliferative state of the starting material and can vary between tissue types, cell types and conditions.

Troubleshooting

Problem 1

Poor hepatocyte viability.

Potential solution

Low viability reflects either over-digestion or incomplete digestion with Collagenase IV.

Optimization can be accomplished by changing the duration of digestion (less than 6 min or more than 6 min) and may be required before setting up the HIT-ClIP experiment. Also, Collagenase IV activity may vary from lot to lot, so noting the lot numbers is highly recommended. Optimizing digestion with different samples of Collagenase IV may be necessary.

Problem 2

Not enough PCR product for RNA-Seq.

Potential solution

After the last round of amplification with the primers DSFP5a and RPIX-DP3, PCR products are gel purified. If the yield of gel-purified PCR DNA is inadequate, repeat the PCR (adjusting cycle number as needed) and combine the gel-purified products in order to obtain a minimum of 1 μg of DNA in a total volume of 20–40 μL.

Problem 3

No polysomes.

Potential solutions

• •Make sure to load concentrated tissue or cell extract on top of the gradient.
• •Make sure that cycloheximide is added to all buffers.

Problem 4

Poor resolution between peaks.

Potential solution

When manipulating gradients move slowly and carefully to limit gradient disruption.

Resource availability

Lead contact

Any information and request for resources and reagents should be directed to and will be fulfilled by the lead contact, Nicholas O. Davidson, email: nod@wustl.edu.

Materials availability

The study did not create new reagents.

Data and code availability

This study did not generate unique datasets or code.