Skip to main content
. 2023 Jun 2;12:e85633. doi: 10.7554/eLife.85633

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Mus musculus, C57BL6, male and female) Pax7-Cre-ERT2 Jackson Laboratory #012476 Transgenic mice
Strain, strain background (M. musculus, C57BL6, male and female) Brainbow2.1 Jackson Laboratory #017492 Transgenic mice
Strain, strain background (M. musculus, C57BL6, male and female) Myoglobin-KO Cyagen Germline knockout mice
Cell line (M. musculus) RAW264.7 ATCC TIB71
Cell line (M. musculus) C2C12 ATCC CRL-1772 Myoblasts (apoptosed)
Antibody Anti-heme oxygenase 1 (rabbit polyclonal) Abcam ab13243 IF (1:150)
Antibody Anti-8-oxoguanine (mouse monoclonal) Abcam ab206461 IF (1:150)
Antibody Anti-mouse F4/80 (rat monoclonal) Santa Cruz Biotechnology sc-52664 IF (1:50)
Antibody Anti-arginase-1 (goat polyclonal) Abcam ab60176 IF (1:150)
Antibody Anti-MERTK (rabbit polyclonal) Abcam ab95925 IF (1:150)
Antibody Anti-mouse iNOS (rabbit monoclonal) Cell Signaling Technology #13120 IF (1:100)
Antibody Anti-myeloperoxidase (rabbit polyclonal) Abcam ab9535 IF (1:75)
Antibody Anti-CD38 (rabbit monoclonal) Cell Signaling Technology #68336 IF (1:75)
Antibody Anti-myoglobin (rabbit monoclonal) Cell Signaling Technology #25919 IF (1:100)
WB (1:1000)
Antibody Anti-GAPDH (mouse monoclonal) Merck MAB374 WB (1:5000)
Antibody Anti-mouse light chain (goat polyclonal) Merck AP200P HRP conjugate
WB (1:10,000)
Antibody Anti-rabbit IgG (goat polyclonal) Merck AP132P HRP conjugate (1:3000)
Antibody Anti-mouse citH3 (rabbit polyclonal) Abcam ab5103 IF (1:150)
Antibody Anti-nitrotyrosine (mouse monoclonal) Abcam ab7048 IF (1:100)
Antibody Anti-hemoglobin (rabbit polyclonal) Proteintech 16665-1-AP IF (1:100)
Antibody Anti-hemopexin (rabbit polyclonal) Proteintech 15736-1-AP IF (1:100)
Antibody Anti-haptoglobin (rabbit polyclonal) Proteintech 14537-1-AP IF (1:100)
Antibody Anti-rabbit IgG (donkey polyclonal) Abcam ab150064 Conjugated to Alexa Fluor 594
IF (1:1000)
Antibody Anti-rabbit IgG (donkey polyclonal) Abcam ab150075 Conjugated to Alexa Fluor 647
IF (1:1000)
Antibody Anti-goat IgG (donkey polyclonal) Abcam ab150129 Conjugated to Alexa Fluor 488
IF (1:1000)
Antibody Anti-mouse IgG (donkey polyclonal) Abcam ab150107 Conjugated to Alexa Fluor 647 IF (1:1000)
Sequence-based reagent Myoglobin common reverse IDT PCR primers CCTTGCTCTGACTGTGTTAGCCTCAG
Sequence-based reagent Myoglobin wildtype forward IDT PCR primers GTGTGACAGAGTGGCTGTCATACTTTGT
Sequence-based reagent Myoglobin knockout forward IDT PCR primers CCGTTGACCCACCTTGTCTCAA
Sequence-based reagent Pax7 common forward IDT PCR primers GCTGCTGTTGATTACCTGGC
Sequence-based reagent Pax7 wildtype reverse IDT PCR primers CTGCACTGAGACAGGACCG
Sequence-based reagent Pax7 transgene reverse IDT PCR primers CAAAAGACGGCAATATGGTG
Sequence-based reagent Brainbow2.1 common reverse IDT PCR primers CCAGATGACTACCTATCCTC
Sequence-based reagent Brainbow2.1 wildtype forward IDT PCR primers AAAGTCGCTCTGAGTTGTTAT
Sequence-based reagent Brainbow2.1 transgene forward IDT PCR primers GAATTAATTCCGGTATAACTTCG
Peptide, recombinant protein Myoglobin (equine) Sigma-Aldrich M0630
Peptide, recombinant protein Interferon gamma Stem Cell Technologies 78021.1
Commercial assay or kit GenElute Mammalian Genomic DNA Miniprep Kits Sigma-Aldrich G1N70
Commercial assay or kit Iron assay kit Abcam ab83366
Commercial assay or kit Perls’ Prussian blue iron stain Abcam ab150674
Commercial assay or kit DeadEnd Fluorometric TUNEL System Promega G3250
Commercial assay or kit Mouse Luminex Discovery Assay R&D Systems LXSAMSM-21
Commercial assay or kit ROS-Glo H2O2 Assay Promega G8821
Commercial assay or kit Efferocytosis Assay Kit Cayman Chemical 601770
Commercial assay or kit MycoAlert PLUS mycoplasma detection kit Lonza LT07-705
Commercial assay or kit FTA Sample Collection Kit for Mouse Cell Authentication Service ATCC 137-XV
Chemical compound, drug Cardiotoxin Sigma-Aldrich C9759 N. mossambica venom
Chemical compound, drug Naniproin PMID:27173146 N. nigricollis venom
Chemical compound, drug Deferoxamine mesylate Sigma-Aldrich D9533
Chemical compound, drug Tamoxifen Sigma-Aldrich T5648
Chemical compound, drug Buprenorphine (Bupredyne) Jurox Animal Health
Chemical compound, drug Isoflurane Piramal Critical Care
Chemical compound, drug Menadione Sigma-Aldrich M5625
Chemical compound, drug Lipo-polysaccharide Sigma-Aldrich L4391
Chemical compound, drug Sodium chloride solution, 0.9% Sigma-Aldrich S8776
Software, algorithm GraphPad Prism GraphPad Software
Software, algorithm MATLAB This paper Thresholding of blue color from Prussian blue iron deposits
Other Ceramic magnets Magnetic Source CD14C See ‘Murine pressure injury model’
Other Neodymium magnets Liftontech Supreme Pte Ltd See ‘Murine pressure injury model’
Other Vectashield Hardset with DAPI Vector Laboratories H-1500-10 See ‘Immunofluorescence staining’
Other BODIPY 581/591C11 probe Invitrogen D3861 See ‘BODIPY 581/591C11 detection’
Other Eosin Y solution Sigma-Aldrich HT110116 See ‘Histopathology scoring of H&E-stained sections’
Other Shandon Gill Hematoxylin 2 Thermo Fisher 6765007 See ‘Histopathology scoring of H&E-stained sections’