Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus, C57BL6, male and female) | Pax7-Cre-ERT2 | Jackson Laboratory | #012476 | Transgenic mice |
| Strain, strain background (M. musculus, C57BL6, male and female) | Brainbow2.1 | Jackson Laboratory | #017492 | Transgenic mice |
| Strain, strain background (M. musculus, C57BL6, male and female) | Myoglobin-KO | Cyagen | Germline knockout mice | |
| Cell line (M. musculus) | RAW264.7 | ATCC | TIB71 | |
| Cell line (M. musculus) | C2C12 | ATCC | CRL-1772 | Myoblasts (apoptosed) |
| Antibody | Anti-heme oxygenase 1 (rabbit polyclonal) | Abcam | ab13243 | IF (1:150) |
| Antibody | Anti-8-oxoguanine (mouse monoclonal) | Abcam | ab206461 | IF (1:150) |
| Antibody | Anti-mouse F4/80 (rat monoclonal) | Santa Cruz Biotechnology | sc-52664 | IF (1:50) |
| Antibody | Anti-arginase-1 (goat polyclonal) | Abcam | ab60176 | IF (1:150) |
| Antibody | Anti-MERTK (rabbit polyclonal) | Abcam | ab95925 | IF (1:150) |
| Antibody | Anti-mouse iNOS (rabbit monoclonal) | Cell Signaling Technology | #13120 | IF (1:100) |
| Antibody | Anti-myeloperoxidase (rabbit polyclonal) | Abcam | ab9535 | IF (1:75) |
| Antibody | Anti-CD38 (rabbit monoclonal) | Cell Signaling Technology | #68336 | IF (1:75) |
| Antibody | Anti-myoglobin (rabbit monoclonal) | Cell Signaling Technology | #25919 | IF (1:100) WB (1:1000) |
| Antibody | Anti-GAPDH (mouse monoclonal) | Merck | MAB374 | WB (1:5000) |
| Antibody | Anti-mouse light chain (goat polyclonal) | Merck | AP200P | HRP conjugate WB (1:10,000) |
| Antibody | Anti-rabbit IgG (goat polyclonal) | Merck | AP132P | HRP conjugate (1:3000) |
| Antibody | Anti-mouse citH3 (rabbit polyclonal) | Abcam | ab5103 | IF (1:150) |
| Antibody | Anti-nitrotyrosine (mouse monoclonal) | Abcam | ab7048 | IF (1:100) |
| Antibody | Anti-hemoglobin (rabbit polyclonal) | Proteintech | 16665-1-AP | IF (1:100) |
| Antibody | Anti-hemopexin (rabbit polyclonal) | Proteintech | 15736-1-AP | IF (1:100) |
| Antibody | Anti-haptoglobin (rabbit polyclonal) | Proteintech | 14537-1-AP | IF (1:100) |
| Antibody | Anti-rabbit IgG (donkey polyclonal) | Abcam | ab150064 | Conjugated to Alexa Fluor 594 IF (1:1000) |
| Antibody | Anti-rabbit IgG (donkey polyclonal) | Abcam | ab150075 | Conjugated to Alexa Fluor 647 IF (1:1000) |
| Antibody | Anti-goat IgG (donkey polyclonal) | Abcam | ab150129 | Conjugated to Alexa Fluor 488 IF (1:1000) |
| Antibody | Anti-mouse IgG (donkey polyclonal) | Abcam | ab150107 | Conjugated to Alexa Fluor 647 IF (1:1000) |
| Sequence-based reagent | Myoglobin common reverse | IDT | PCR primers | CCTTGCTCTGACTGTGTTAGCCTCAG |
| Sequence-based reagent | Myoglobin wildtype forward | IDT | PCR primers | GTGTGACAGAGTGGCTGTCATACTTTGT |
| Sequence-based reagent | Myoglobin knockout forward | IDT | PCR primers | CCGTTGACCCACCTTGTCTCAA |
| Sequence-based reagent | Pax7 common forward | IDT | PCR primers | GCTGCTGTTGATTACCTGGC |
| Sequence-based reagent | Pax7 wildtype reverse | IDT | PCR primers | CTGCACTGAGACAGGACCG |
| Sequence-based reagent | Pax7 transgene reverse | IDT | PCR primers | CAAAAGACGGCAATATGGTG |
| Sequence-based reagent | Brainbow2.1 common reverse | IDT | PCR primers | CCAGATGACTACCTATCCTC |
| Sequence-based reagent | Brainbow2.1 wildtype forward | IDT | PCR primers | AAAGTCGCTCTGAGTTGTTAT |
| Sequence-based reagent | Brainbow2.1 transgene forward | IDT | PCR primers | GAATTAATTCCGGTATAACTTCG |
| Peptide, recombinant protein | Myoglobin (equine) | Sigma-Aldrich | M0630 | |
| Peptide, recombinant protein | Interferon gamma | Stem Cell Technologies | 78021.1 | |
| Commercial assay or kit | GenElute Mammalian Genomic DNA Miniprep Kits | Sigma-Aldrich | G1N70 | |
| Commercial assay or kit | Iron assay kit | Abcam | ab83366 | |
| Commercial assay or kit | Perls’ Prussian blue iron stain | Abcam | ab150674 | |
| Commercial assay or kit | DeadEnd Fluorometric TUNEL System | Promega | G3250 | |
| Commercial assay or kit | Mouse Luminex Discovery Assay | R&D Systems | LXSAMSM-21 | |
| Commercial assay or kit | ROS-Glo H2O2 Assay | Promega | G8821 | |
| Commercial assay or kit | Efferocytosis Assay Kit | Cayman Chemical | 601770 | |
| Commercial assay or kit | MycoAlert PLUS mycoplasma detection kit | Lonza | LT07-705 | |
| Commercial assay or kit | FTA Sample Collection Kit for Mouse Cell Authentication Service | ATCC | 137-XV | |
| Chemical compound, drug | Cardiotoxin | Sigma-Aldrich | C9759 | N. mossambica venom |
| Chemical compound, drug | Naniproin | PMID:27173146 | N. nigricollis venom | |
| Chemical compound, drug | Deferoxamine mesylate | Sigma-Aldrich | D9533 | |
| Chemical compound, drug | Tamoxifen | Sigma-Aldrich | T5648 | |
| Chemical compound, drug | Buprenorphine (Bupredyne) | Jurox Animal Health | ||
| Chemical compound, drug | Isoflurane | Piramal Critical Care | ||
| Chemical compound, drug | Menadione | Sigma-Aldrich | M5625 | |
| Chemical compound, drug | Lipo-polysaccharide | Sigma-Aldrich | L4391 | |
| Chemical compound, drug | Sodium chloride solution, 0.9% | Sigma-Aldrich | S8776 | |
| Software, algorithm | GraphPad Prism | GraphPad Software | ||
| Software, algorithm | MATLAB | This paper | Thresholding of blue color from Prussian blue iron deposits | |
| Other | Ceramic magnets | Magnetic Source | CD14C | See ‘Murine pressure injury model’ |
| Other | Neodymium magnets | Liftontech Supreme Pte Ltd | See ‘Murine pressure injury model’ | |
| Other | Vectashield Hardset with DAPI | Vector Laboratories | H-1500-10 | See ‘Immunofluorescence staining’ |
| Other | BODIPY 581/591C11 probe | Invitrogen | D3861 | See ‘BODIPY 581/591C11 detection’ |
| Other | Eosin Y solution | Sigma-Aldrich | HT110116 | See ‘Histopathology scoring of H&E-stained sections’ |
| Other | Shandon Gill Hematoxylin 2 | Thermo Fisher | 6765007 | See ‘Histopathology scoring of H&E-stained sections’ |